Hi! I'm trying to get the alignments for different species against the whole mouse genome, just like in GenomeBrowser's conservation controls-part (30-way multiz alignment & conservation), so I could look after some motives in the whole genome wide.
I have downloaded knownGene.exonNuc.fa.gz and it looks good otherwise, but how can I compare the fastas, for example some of the starting points between the file and the browser? For example, in knownGene.exonNuc.fa: NM_013499_mm9_7_10 24 1 1 chr1:196938568-196938591- GCTCAATCAGTGGTCTAATTGTTG But I can't seem to get to the exact point like chr1:196938568 with browser, so I could check if the fasta alignments match. Thankyou in advance! Kerttu Mäkilä /Institute of biotechnology, Helsinki _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
