Hello,
We are having trouble understanding your question. Have you tried using 
the position/search box in the mouse assembly? Entering any of these 
provides a genomic view. Among other options, tracks can be 
added/removed and you can zoom in or out.

NM_013499
chr1:196938568
chr1:196938568-196938591

Another option is to BLAT a sequence against the target genomic and click on 
the "browser" link in the output. This would be good for sequences not already 
aligned in a track.

Please clarify your question a bit more if this does not address it,
Thank you,
Jennifer Jackson
UCSC Genome Bioinformatics Group

[email protected] wrote:
> Hi!
>
> I'm trying to get the alignments for different species against the  
> whole mouse genome, just like in GenomeBrowser's conservation  
> controls-part (30-way multiz alignment & conservation), so I could  
> look after some motives in the whole genome wide.
>
> I have downloaded knownGene.exonNuc.fa.gz and it looks good otherwise,  
> but how can I compare the fastas, for example some of the starting  
> points between the file and the browser?
> For example, in knownGene.exonNuc.fa:
>
> NM_013499_mm9_7_10 24 1 1 chr1:196938568-196938591-
> GCTCAATCAGTGGTCTAATTGTTG
>
> But I can't seem to get to the exact point like chr1:196938568 with  
> browser, so I could check if the fasta alignments match.
>
> Thankyou in advance!
>
> Kerttu Mäkilä
> /Institute of biotechnology, Helsinki
>
>
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>   
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to