Hello, We are having trouble understanding your question. Have you tried using the position/search box in the mouse assembly? Entering any of these provides a genomic view. Among other options, tracks can be added/removed and you can zoom in or out.
NM_013499 chr1:196938568 chr1:196938568-196938591 Another option is to BLAT a sequence against the target genomic and click on the "browser" link in the output. This would be good for sequences not already aligned in a track. Please clarify your question a bit more if this does not address it, Thank you, Jennifer Jackson UCSC Genome Bioinformatics Group [email protected] wrote: > Hi! > > I'm trying to get the alignments for different species against the > whole mouse genome, just like in GenomeBrowser's conservation > controls-part (30-way multiz alignment & conservation), so I could > look after some motives in the whole genome wide. > > I have downloaded knownGene.exonNuc.fa.gz and it looks good otherwise, > but how can I compare the fastas, for example some of the starting > points between the file and the browser? > For example, in knownGene.exonNuc.fa: > > NM_013499_mm9_7_10 24 1 1 chr1:196938568-196938591- > GCTCAATCAGTGGTCTAATTGTTG > > But I can't seem to get to the exact point like chr1:196938568 with > browser, so I could check if the fasta alignments match. > > Thankyou in advance! > > Kerttu Mäkilä > /Institute of biotechnology, Helsinki > > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
