Hello there, I am working with some specific genes (ZNF160 and MCART1) for microarray analysis. My probes presented high signal, however, when I did BLAT, my probes are not located on my target gene. According to UCSC BLAT, my probes detected Human mRNAs from GeneBank.
My questions are: 1. What this information means? 2. Which gene can be related? These are the sequences I am working with: ZNF160 *TGGAGATCATTCCATTACACTCCAGCCTGGGCACCAGGAACGAAACTCGT* MCART1 CCTAGCTG*CTCGGGAGGCTGAGGCAGGAGAATCTCTTTCTTAATTGGCCA* Thank you fr your help. regards, aly -- Aletheia L. Souza, M.Sc, DVM Phd student in Animal Reproduction Universidade Federal do Ceara Brazil 85-3366-9697 http://www.reproducao.ufc.br/ Research Scholar Krawetz Laboratory 271 C. S. Mott Center 275 East Hancock Avenue Detroit, MI 48201 School of Medicine Department of Obstetrics and Gynecology Center for Molecular Medicine and Genetics Wayne State University USA "It is not the strongest of the species that survives, it is the one that is most adaptable to change" Charles Darwin _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
