Hello Aly, BLAT on DNA is designed to quickly find sequences of 95% and greater similarity of length 25 bases or more. For whatever sequences you input BLAT will return a list of regions that your query maps to, ranked according to how similar they are. You can read more about BLAT and how it differs from BLAST here:
http://genome.ucsc.edu/cgi-bin/hgBlat?command=start&org=Human&db=hg18 To explore genes in the neighborhood of a region of interest you can turn on one of our gene prediction tracks such as UCSC genes. To read more about UCSC genes see the track description page found here: http://genome.ucsc.edu/cgi-bin/hgTrackUi?&c=chr9&g=knownGene Hopefully this information will help get you started exploring the implications of your results. Best regards, Pauline Fujita UCSC Genome Bioinformatics Group http://genome.ucsc.edu On 9/22/10 8:42 AM, Aletheia Lima Souza wrote: > Hello there, > > I am working with some specific genes (ZNF160 and MCART1) for microarray > analysis. > My probes presented high signal, however, when I did BLAT, my probes are not > located on my target gene. > According to UCSC BLAT, my probes detected Human mRNAs from GeneBank. > > My questions are: > > 1. What this information means? > 2. Which gene can be related? > > These are the sequences I am working with: > > ZNF160 *TGGAGATCATTCCATTACACTCCAGCCTGGGCACCAGGAACGAAACTCGT* > > MCART1 > CCTAGCTG*CTCGGGAGGCTGAGGCAGGAGAATCTCTTTCTTAATTGGCCA* > > Thank you fr your help. > > regards, > > aly > -- > Aletheia L. Souza, M.Sc, DVM > Phd student in Animal Reproduction > Universidade Federal do Ceara > Brazil > 85-3366-9697 > http://www.reproducao.ufc.br/ > > Research Scholar > Krawetz Laboratory > 271 C. S. Mott Center > 275 East Hancock Avenue > Detroit, MI 48201 > School of Medicine > Department of Obstetrics and Gynecology > Center for Molecular Medicine and Genetics > Wayne State University > USA > > "It is not the strongest of the species that survives, it is the one that is > most adaptable to change" > Charles Darwin > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
