Hello Aly,

BLAT on DNA is designed to quickly find sequences of 95% and greater 
similarity of length 25 bases or more. For whatever sequences you input 
BLAT will return a list of regions that your query maps to, ranked 
according to how similar they are. You can read more about BLAT and how 
it differs from BLAST here:

http://genome.ucsc.edu/cgi-bin/hgBlat?command=start&org=Human&db=hg18

To explore genes in the neighborhood of a region of interest you can 
turn on one of our gene prediction tracks such as UCSC genes. To read 
more about UCSC genes see the track description page found here:

http://genome.ucsc.edu/cgi-bin/hgTrackUi?&c=chr9&g=knownGene

Hopefully this information will help get you started exploring the 
implications of your results.

Best regards,

Pauline Fujita

UCSC Genome Bioinformatics Group
http://genome.ucsc.edu



On 9/22/10 8:42 AM, Aletheia Lima Souza wrote:
> Hello there,
>
> I am working with some specific genes (ZNF160 and MCART1) for microarray
> analysis.
> My probes presented high signal, however, when I did BLAT, my probes are not
> located on my target gene.
> According to UCSC BLAT, my probes detected Human mRNAs from GeneBank.
>
> My questions are:
>
> 1. What this information means?
> 2. Which gene can be related?
>
> These are the sequences I am working with:
>
> ZNF160     *TGGAGATCATTCCATTACACTCCAGCCTGGGCACCAGGAACGAAACTCGT*
>
> MCART1
>    CCTAGCTG*CTCGGGAGGCTGAGGCAGGAGAATCTCTTTCTTAATTGGCCA*
>
> Thank you fr your help.
>
> regards,
>
> aly
> --
> Aletheia L. Souza, M.Sc, DVM
> Phd student in Animal Reproduction
> Universidade Federal do Ceara
> Brazil
> 85-3366-9697
> http://www.reproducao.ufc.br/
>
> Research Scholar
> Krawetz Laboratory
> 271 C. S. Mott Center
> 275 East Hancock Avenue
> Detroit, MI 48201
> School of Medicine
> Department of Obstetrics and Gynecology
> Center for Molecular Medicine and Genetics
> Wayne State University
> USA
>
> "It is not the strongest of the species that survives, it is the one that is
> most adaptable to change"
> Charles Darwin
> _______________________________________________
> Genome maillist  -  [email protected]
> https://lists.soe.ucsc.edu/mailman/listinfo/genome
>   

_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to