Hi,I would like to know how I can test if the PCR result are trustworthy - for example when I have done the test with the primersForward: AGAAGTCGGAATCGTGGGCCReverse: AAACAGCTGAGCTGATTGGCI obtain as a result that the PCR shows no expression for Sfrs3. Can I trust this result? How can I check if it's correct?Thank you and have a nice day.Adriana _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
- [Genome] check PCR results Pitea Adriana
- Re: [Genome] check PCR results Mary Goldman
