Hi Brook, Thanks for the information. From my experience analyzing axt-formatted BLAT output I have seen "small" gaps:
1880 chrI 23756490 23756857 GAC44FG01DKAZH 1 362 - 32274 caaaagaccagctagacctcgcatccaatcaagtctagattaataaatttttaaataaatcaaccccaaaatcaaaaccataaactcaagtctcataagcatgtccgacaccttcctcgcaactcactatcccacgccgagatatccccacagagcctcgttggctgctcgctgtcgctatatctgtatcagtctcactgtagcgctctttccctttttgtccgcctctcgcattttcgtcatccccacaacacagcggtagcgctcctcttctcctcctcctgctgcttactatctattgccttctcttaaacttaactttcccgcgccttctcatttttagttctctactttctcaactcgtctct caaaagaccagctagacctcgcatccaatcaagtctagattaataaa-ttttaaataaatcaaccccaaaatcaaaaccataaactcaagtctcataagcatgtccgacaccttcctcgcaactcactatcccacgccgagatatccccacagagcctcgttggctgctcgctgtcgctatatctgtatcagtctcactgtagcgctctttccc-ttttgtccgcctctcgcattttcgtcatccccacaacacagcggtagcgctcctcttctcctcctcctgctgcttactatctattgccttctcttaaacttaac-ttcccgcgccttctcattt--agttctctac-ttctcaactcgtctct So, to more precisely define my question: Given that small gaps are possible in axt-formatted BLAT alignments: 1) what is the cutoff for breaking them into two axt alignment records when they appear as one record in the psl output? 2) can this cutoff be modified to give the same results as the psl output? Thanks in advance for the help. Vince On Wed, 2012-04-04 at 18:55 -0700, Brooke Rhead wrote: > Hi Vince, > > There is not a way to make BLAT join the two alignments. Rows in the > axt alignment format (http://genome.ucsc.edu/goldenPath/help/axt.html) > cannot contain gaps. > > I hope this is helpful. If you have further questions, please contact > us again at [email protected]. > > -- > Brooke Rhead > UCSC Genome Bioinformatics Group > > > > On 3/30/12 7:09 AM, Vince Forgetta wrote: > > > > > > Hi, > > > > I am using BLAT to align 454 reads back to an assembly that uses the > > same reads. I noticed that the axt output breaks across two alignments, > > while the psl output is within one line (see below). Is there a way to > > report the axt output as one alignment? > > > > Thanks in advance for the help. > > > > Vince > > > > ** PSL OUTPUT ** > > 381 2 0 0 5 9 9 13 + > > GAC44FG01BFDF9 392 0 392 chrI 31789037 24269501 > > 24269897 14 164,6,48,3,6,6,6,6,19,7,80,7,18,7, > > 0,164,170,218,221,227,233,239,245,265,277,358,366,385, > > 24269501,24269666,24269673,24269722,24269727,24269735,24269742,24269749,24269756,24269775,24269785,24269865,24269872,24269890, > > > > ** AXT OUTPUT ** > > 0 chrI 24269502 24269782 GAC44FG01BFDF9 1 272 + 20942 > > <ALIGNMENT> > > > > 1 chrI 24269786 24269897 GAC44FG01BFDF9 278 392 + 9145 > > <ALIGNMENT> > > > > _______________________________________________ > > Genome maillist - [email protected] > > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
