Hi Vince, To answer your 2 questions:
1) When they appear as one record in the psl output? A single-sided gap in either query or target greater than 8, or a double-sided gap. 2) None of the gaps in your example are greater than 5. However there is a double gap. There is a reasonable extension to axt that would just use this format for double-gaps: xxx-----TCTyyyy xxxCCGCC---yyyy BLAT may somdeday be extended to do this, but no concrete plan or timeframe is available. Thanks for the suggestion. Please contact us again at [email protected] if you have any further questions. --- Luvina Guruvadoo UCSC Genome Bioinformatics Group On 4/5/2012 6:06 AM, Vince Forgetta wrote: > Hi Brook, > > Thanks for the information. From my experience analyzing axt-formatted > BLAT output I have seen "small" gaps: > > 1880 chrI 23756490 23756857 GAC44FG01DKAZH 1 362 - 32274 > caaaagaccagctagacctcgcatccaatcaagtctagattaataaatttttaaataaatcaaccccaaaatcaaaaccataaactcaagtctcataagcatgtccgacaccttcctcgcaactcactatcccacgccgagatatccccacagagcctcgttggctgctcgctgtcgctatatctgtatcagtctcactgtagcgctctttccctttttgtccgcctctcgcattttcgtcatccccacaacacagcggtagcgctcctcttctcctcctcctgctgcttactatctattgccttctcttaaacttaactttcccgcgccttctcatttttagttctctactttctcaactcgtctct > caaaagaccagctagacctcgcatccaatcaagtctagattaataaa-ttttaaataaatcaaccccaaaatcaaaaccataaactcaagtctcataagcatgtccgacaccttcctcgcaactcactatcccacgccgagatatccccacagagcctcgttggctgctcgctgtcgctatatctgtatcagtctcactgtagcgctctttccc-ttttgtccgcctctcgcattttcgtcatccccacaacacagcggtagcgctcctcttctcctcctcctgctgcttactatctattgccttctcttaaacttaac-ttcccgcgccttctcattt--agttctctac-ttctcaactcgtctct > > So, to more precisely define my question: > > Given that small gaps are possible in axt-formatted BLAT alignments: > > 1) what is the cutoff for breaking them into two axt alignment records > when they appear as one record in the psl output? > 2) can this cutoff be modified to give the same results as the psl > output? > > Thanks in advance for the help. > > Vince > > > On Wed, 2012-04-04 at 18:55 -0700, Brooke Rhead wrote: >> Hi Vince, >> >> There is not a way to make BLAT join the two alignments. Rows in the >> axt alignment format (http://genome.ucsc.edu/goldenPath/help/axt.html) >> cannot contain gaps. >> >> I hope this is helpful. If you have further questions, please contact >> us again at [email protected]. >> >> -- >> Brooke Rhead >> UCSC Genome Bioinformatics Group >> >> >> >> On 3/30/12 7:09 AM, Vince Forgetta wrote: >>> >>> Hi, >>> >>> I am using BLAT to align 454 reads back to an assembly that uses the >>> same reads. I noticed that the axt output breaks across two alignments, >>> while the psl output is within one line (see below). Is there a way to >>> report the axt output as one alignment? >>> >>> Thanks in advance for the help. >>> >>> Vince >>> >>> ** PSL OUTPUT ** >>> 381 2 0 0 5 9 9 13 + >>> GAC44FG01BFDF9 392 0 392 chrI 31789037 24269501 >>> 24269897 14 164,6,48,3,6,6,6,6,19,7,80,7,18,7, >>> 0,164,170,218,221,227,233,239,245,265,277,358,366,385, >>> 24269501,24269666,24269673,24269722,24269727,24269735,24269742,24269749,24269756,24269775,24269785,24269865,24269872,24269890, >>> >>> ** AXT OUTPUT ** >>> 0 chrI 24269502 24269782 GAC44FG01BFDF9 1 272 + 20942 >>> <ALIGNMENT> >>> >>> 1 chrI 24269786 24269897 GAC44FG01BFDF9 278 392 + 9145 >>> <ALIGNMENT> >>> >>> _______________________________________________ >>> Genome maillist - [email protected] >>> https://lists.soe.ucsc.edu/mailman/listinfo/genome > > _______________________________________________ > Genome maillist - [email protected] > https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
