Hi Vivek, The details pages for the particular SNP should help clarify the confusion you are experiencing:
http://genome.ucsc.edu/cgi-bin/hgc?o=22488676&t=22488711&g=snp128&i=rs32326997&c=chr1&l=22488676&r=22488711&db=mm9 You are correct on your interpretation of what the reference sequence is. See below: AGtcaatctatcaatcaatcaatcaatcaatcaat (reference sequence) RGTCAATCTATCAATCAATCAATCAATCAATCAAT (*rs32326997* sequence) This page (http://genome.ucsc.edu/goldenPath/help/iupac.html) states that the R stands for either A or G. I hope that this clarifies things for you. If you have further questions, please email the list: [email protected]. Vanessa Kirkup Swing UCSC Genome Bioinformatics Group ---------- Forwarded message ---------- From: Vivek Appadurai <[email protected]> Date: Tue, May 8, 2012 at 8:47 AM Subject: [Genome] Mouse SNP128 file To: [email protected] Hi, I'm trying to use the mouse dbSNP file provided for the mm9 reference and I'm having some issues interpreting the data. For example: 756 chr1 22488676 22488711 rs32326997 0 + AGTCAATCTATCAATCAATCAATCAATCAATCAAT AGTCAATCTATCAATCAATCAATCAATCAATCAAT A/G genomic single unknown 0 0 intron rangeSubstitution 1 In this region I'm interpreting the ref Allele to be AGTCAATCTATCAATCAATCAATCAATCAATCAAT and the alt alleles to be A/G However the genotype xml files from NBCI version of the dbSNP file indicates something like this: SnpInfo rsId="32326997" observed="A/G" I'd appreciate if you could validate my assumptions regarding the interpretation of the allele fields. Thanks, Vivek. _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
