I'm curious does anybody know if the syntax /1 after the .cgi script is
some form of load balancing or not?
On Tuesday, October 15, 2002, at 05:47 PM, Giuseppe Torelli wrote:
> Hi,
>
> I have to simulate an HTML form that send
> some data to a cgi on a server from a perl script.
>
> Obviously I'm using LWP but the problem is that
> that I get the HTML code of the page back and not
> the results. What is wrong ? The code follows;
>
> use LWP::UserAgent;
> use HTTP::Request::Common;
>
> @Blastform=( program=>"SAGE14",
> database=>"human|seq",
> alignments=>"20",
> seqfile=>"",
>
> sequence=>"ATGTGGCTGCTTTTAACAATGGCAAGTTTGATATCTGTACTGGGGACTACACATGGTTT"
> ,
> seqident=>"",
> matrix=>"blosum62",
> filter=>"default",
> expect=>"10",
> cutoff=>"default",
> strand=>"default",
> descriptions=>"20",
> wordlength=>"11",
> echofilter=>"1",
> graphicalview=>"1",
> ignore=>"1",
> email=>"0",
> email_address=>"");
>
> $ua = LWP::UserAgent->new;
> $ua->agent("Mozilla/5.0 (X11; U; Linux 2.4.18 i686");
> $req = $ua->request(POST
> "http://tigrblast.tigr.org/tgi/index.cgi/1",content_type=>"multipart/
> form-data",content=>\@Blastform);
> print $req->as_string;
>
> Please help !
> --
> Giuseppe Torelli
>
> Bioinformatic Programmer
> Laboratory of Molecular Evolution
> Stazione Zoologica A. Dohrn
> Villa Comunale
> 80121 Naples - Italy
> Tel. 0039 81 5833311
> Fax: 0039 81 7641355
