It's just another way of passing information to the cgi script via PATH_INFO rather than through GET or POST parameters: your guess is as good as mine on whether or not it's for load balancing. - actually your's is probably better if you've seen a range URLs from this site, or have visitted it a few times from different machines (some forms of load balancing are based on the incoming IP address - so you'd need to have a different IP to get routed to a different CGI server).
Pete > -----Original Message----- > From: Robert Nicholson [mailto:[EMAIL PROTECTED]] > Sent: 15 October 2002 11:26 > To: Giuseppe Torelli > Cc: [EMAIL PROTECTED] > Subject: Re: LWP fetching problem > > > I'm curious does anybody know if the syntax /1 after the .cgi > script is > some form of load balancing or not? > > On Tuesday, October 15, 2002, at 05:47 PM, Giuseppe Torelli wrote: > > > Hi, > > > > I have to simulate an HTML form that send > > some data to a cgi on a server from a perl script. > > > > Obviously I'm using LWP but the problem is that > > that I get the HTML code of the page back and not > > the results. What is wrong ? The code follows; > > > > use LWP::UserAgent; > > use HTTP::Request::Common; > > > > @Blastform=( program=>"SAGE14", > > database=>"human|seq", > > alignments=>"20", > > seqfile=>"", > > > > > sequence=>"ATGTGGCTGCTTTTAACAATGGCAAGTTTGATATCTGTACTGGGGACTACA > CATGGTTT" > > , > > seqident=>"", > > matrix=>"blosum62", > > filter=>"default", > > expect=>"10", > > cutoff=>"default", > > strand=>"default", > > descriptions=>"20", > > wordlength=>"11", > > echofilter=>"1", > > graphicalview=>"1", > > ignore=>"1", > > email=>"0", > > email_address=>""); > > > > $ua = LWP::UserAgent->new; > > $ua->agent("Mozilla/5.0 (X11; U; Linux 2.4.18 i686"); > > $req = $ua->request(POST > > "http://tigrblast.tigr.org/tgi/index.cgi/1",content_type=>"multipart/ > form-data",content=>\@Blastform); > print $req->as_string; > > Please help ! > -- > Giuseppe Torelli > > Bioinformatic Programmer > Laboratory of Molecular Evolution > Stazione Zoologica A. Dohrn > Villa Comunale > 80121 Naples - Italy > Tel. 0039 81 5833311 > Fax: 0039 81 7641355
