It's just another way of passing information to the cgi script via PATH_INFO rather 
than through GET or POST parameters:  your guess is as good as mine on whether or not 
it's for load balancing. - actually your's is probably better if you've seen a range 
URLs from this site, or have visitted it a few times from different machines (some 
forms of load balancing are based on the incoming IP address - so you'd need to have a 
different IP to get routed to a different CGI server).

Pete

> -----Original Message-----
> From: Robert Nicholson [mailto:[EMAIL PROTECTED]]
> Sent: 15 October 2002 11:26
> To: Giuseppe Torelli
> Cc: [EMAIL PROTECTED]
> Subject: Re: LWP fetching problem
> 
> 
> I'm curious does anybody know if the syntax /1 after the .cgi 
> script is  
> some form of load balancing or not?
> 
> On Tuesday, October 15, 2002, at 05:47 PM, Giuseppe Torelli wrote:
> 
> > Hi,
> >
> > I have to simulate an HTML form that send
> > some data to a cgi on a server from a perl script.
> >
> > Obviously I'm using LWP but the problem is that
> > that I get the HTML code of the page back and not
> > the results. What is wrong ? The code follows;
> >
> >         use LWP::UserAgent;
> >         use HTTP::Request::Common;
> >
> > @Blastform=(     program=>"SAGE14",
> >                         database=>"human|seq",
> >                         alignments=>"20",
> >                         seqfile=>"",
> >                          
> > 
> sequence=>"ATGTGGCTGCTTTTAACAATGGCAAGTTTGATATCTGTACTGGGGACTACA
> CATGGTTT" 
> > ,
> >                         seqident=>"",
> >                         matrix=>"blosum62",
> >                         filter=>"default",
> >                         expect=>"10",
> >                         cutoff=>"default",
> >                         strand=>"default",
> >                         descriptions=>"20",
> >                         wordlength=>"11",
> >                         echofilter=>"1",
> >                         graphicalview=>"1",
> >                         ignore=>"1",
> >                         email=>"0",
> >                         email_address=>"");
> >
> > $ua = LWP::UserAgent->new;
> > $ua->agent("Mozilla/5.0 (X11; U; Linux 2.4.18 i686");
> > $req = $ua->request(POST  
> > 
"http://tigrblast.tigr.org/tgi/index.cgi/1",content_type=>"multipart/ 
> form-data",content=>\@Blastform);
> print $req->as_string;
>
> Please help !
> -- 
> Giuseppe Torelli
>
> Bioinformatic Programmer
> Laboratory of Molecular Evolution
> Stazione Zoologica A. Dohrn
> Villa Comunale
> 80121 Naples - Italy
> Tel.  0039 81 5833311
> Fax: 0039 81 7641355

Reply via email to