Hello Aaron, First of all, thank you very much for answering my question. I see that the "sequence coordinates listed do not correspond to the sequence itself... for normal XMFA genome alignments". So in order to retrieve all the orthologs a perl script was kindly written by Alejandro Akermann from UNSAM, Argentina, and that solved my problem. The script is available upon request. Thanks again, Tomás.
> ---------- Forwarded message ---------- > From: tomas duffy <[email protected]> > To: [email protected] > Date: Mon, 5 Apr 2010 21:36:05 -0300 > Subject: [Mauve-users] Export Orthologs question > Hello, > I've aligned a few chlamydial genomes in GenBank format. When I use > the Export Orthologs function I get the two files I'm supposed to get, > the one with the positions of the orthologs in each genome, and the > one that also includes the sequences. > Unfortunately, the sequences do not correspond with the position > stated in the header. For example, this is the sequences of one of the > first group of orthologs: > >0:266-1267:TC_0001 + > tactgttctgaaggagatgagtttgctggagcttctttagccttttcacgacgataagctagatactaagctctttgatt > ataccaaagttcactagattaaaccggataaaaagaatttcttccaagtccttaagctcttctttatgggtcatacggac > ctcatatgtctacctcaaatctatggtatagatctcttaatctttctgagacagaatatcccgattttcgccaataggaa > aagggacaatatctcctagtcttttttctagttaagcctcgtatacgtagcgtaggcatattgtaacaaacatctcctta > agtcctttagttttttagaaaaggggttgacacacactaatcactatatcgaaatctaggaaaatgctgatcaccagtgc > taccgtaaaaaatgttgttacttcacaatttactgctttcgcaagcgcatatacctctatagcgttgtaacgtacgtctt > taccctcgcctataacaacgaggttcgctatactacctaccctctcaagccgtataagctcttttttacctagtctaccc > gaaacaattatgtccttaagagagaatatcgcgtttcatacgtagaatgaacataccaggcaaatctctacgagaaagaa > gcgtaggagttagacccctatttgccgttatagtttacctaggacggttacaagctcttcgaaacgaacttacggccgat > ctacttctcctccctcgtctataccattactatttcggacgacccaaaataaatctacaatagtactttcgagttcttac > atgcgtagaaggtcatcaacggatagttcagtcacctcttataagatactaataccggcggtcagacgtacctaccaatt > catttcttcctcgatagagcctcagaaacaatcgttaatttgctcgaccccgatgccgatattaatcgatacgttgaggt > acccaaaatcttaccgatcgatctctgcgagaaggaaaaattcctttttcaagaaact > > This gene (266-1267:TC_0001) when I look it up on EMBL is different > from the sequences above. > > What is it that I'm doing wrong? Am I miss interpreting something? > > Thanks in advances, > > Tomas Duffy > > > > > ---------- Forwarded message ---------- > From: Aaron Darling <[email protected]> > To: [email protected] > Date: Mon, 05 Apr 2010 22:47:20 -0700 > Subject: Re: [Mauve-users] Export Orthologs question > Hi Tomas, excellent question, more below... > > On Mon, 2010-04-05 at 21:36 -0300, tomas duffy wrote: > > Hello, > > I've aligned a few chlamydial genomes in GenBank format. When I use > > the Export Orthologs function I get the two files I'm supposed to get, > > the one with the positions of the orthologs in each genome, and the > > one that also includes the sequences. > > Unfortunately, the sequences do not correspond with the position > > stated in the header. For example, this is the sequences of one of the > > first group of orthologs: > > >0:266-1267:TC_0001 + > > > tactgttctgaaggagatgagtttgctggagcttctttagccttttcacgacgataagctagatactaagctctttgatt > > <snip> > > > > acccaaaatcttaccgatcgatctctgcgagaaggaaaaattcctttttcaagaaact > > > > This gene (266-1267:TC_0001) when I look it up on EMBL is different > > from the sequences above. > > > > What is it that I'm doing wrong? Am I miss interpreting something? > > I think you're using Mauve correctly, and although I can't say with > certainty unless you tell me exactly which other genomes you were > aligning, I believe the output was also generated correctly by Mauve. > > As you observed, the sequence coordinates listed do not correspond to > the sequence itself. However, in some cases that is an expected result > for the ortholog export functionality (but NOT for normal XMFA genome > alignments). It's true that this behavior is counter-intuitive, however > several design decisions led to the behavior. First, when Mauve > generates an ortholog alignment file, it includes everything between the > left-most and right-most alignment column covered by the orthologous > features. The feature (e.g. a gene) may be annotated in one organism to > contain a much larger range of sequence than it does in another genome. > Rather than trim the alignment to the smallest range, Mauve includes the > largest orthologous range possible. There are various reasons we chose > to do this, but it may not be desirable behavior in all cases, so > perhaps a good software improvement would be more flexibility here. But > I digress. > The second issue leading to the behavior you observed is how Mauve names > the homologous features in the output file. Mauve defaults to using the > locus_tag qualifier from the genbank file, however, for some feature > classes and in some (degenerate) genbank format files, /locus_tag > qualifiers may not be present. In fact, there may not be any reasonable > name for the feature in any qualifier, but only feature type and the > sequence range. I wish such GenBank files didn't exist, but they do. > (and I wish more people would use XML, and I wish...). To handle such > degenerate cases, the features are "named" in part by the coordinate > range they were annotated with in the genbank file. Thus, the feature > you pasted above is "named" 266-1267:TC_0001. In your case the genbank > file also has a locus_tag, so TC_0001 is appended to the name. > > Admittedly, the formatting here looks like it should be specifying the > sequence range given immediately after the header line, and this is > confusing with the XMFA format. I think a good revision of the export > orthologs function would be to give the full sequence range, then give > the annotated feature range (and label it as such, in XML, hey!), then > the feature name or locus tag. > > Anyhow, I think that's what happened in your output file, and that what > you observed isn't a bug, it's just counter-intuitive behavior. > Confusing FastA header lines are the bane of bioinformatics. > > -Aaron ------------------------------------------------------------------------------ Download Intel® Parallel Studio Eval Try the new software tools for yourself. Speed compiling, find bugs proactively, and fine-tune applications for parallel performance. See why Intel Parallel Studio got high marks during beta. http://p.sf.net/sfu/intel-sw-dev _______________________________________________ Mauve-users mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/mauve-users
