You'r right. I started to define it assigned as a string, but screwed that up
too. Took me just as long to learn del definition too :-).
> On Oct 12, 2019, at 12:53 PM, Brian Schott <schott.br...@gmail.com> wrote:
>
> Your verb show needs a y in it.
>
>
> show=: verb define
> <: #/.~&> y
> )
> show supertrig
> |noun result was required: show
> | <:#/.~&>
> $trig
> 2
> show=: verb define
> <: #/.~&> y
> )
> show supertrig
> 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
> 0 0 0 0 0 0 0 0 0 0 0 0 0 0
> 1 1 1 1 1 1 2 2 2 2 2 1 1 2 1 1 1 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
> 1 1 1 1 1 1 1 1 1 1 1 1 1 1
>
>> On Sat, Oct 12, 2019 at 12:23 PM 'Jim Russell' via Programming <
>> programm...@jsoftware.com> wrote:
>>
>> Genius! I tried (and failed) to convert your reply to a script on my
>> iPhone:
>>
>> X=:'Now is the time for all good men to come ti'
>> Y=: 'Now is the time for the quick brown good men to come ti'
>> trig=: 3,\&.> X;Y
>> NB. Get the nub of the union of both sets of trigrams and prepend it to
>> each trigram set.
>> supertrig=: (,~&.> <@~.@;) trig
>> NB. Now we can use Key to count the trigrams in each set and decrement by
>> 1 (for the extra copy that we added).
>>
>> show=: verb define
>> <: #/.~&>
>> )
>> show supertrig
>>
>> It almost worked, in particular your code did (j701):
>> load'~/user/ric.ijs'
>> |syntax error: show
>> | show supertrig
>> |[-11] /j/user/ric.ijs
>> supertrig
>> +---+---+
>> |Now|Now|
>> |ow |ow |
>> |w i|w i|
>> | is| is|
>> |is |is |
>> |s t|s t|
>> | th| th|
>> |the|the|
>> |he |he |
>> |e t|e t|
>> | ti| ti|
>> |tim|tim|
>>
>> . Clip...
>>
>> | |to |
>> | |o c|
>> | | co|
>> | |com|
>> | |ome|
>> | |me |
>> | |e t|
>> | | ti|
>> +---+---+
>> show
>> 3 : '<: #/.~&>'
>>
>> <: #/.~&> supertrig
>> 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
>> 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
>> 1 1 1 1 1 1 2 2 2 2 2 1 1 2 1 1 1 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1
>> 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
>>
>>
>>>> On Oct 12, 2019, at 1:22 AM, Ric Sherlock <tikk...@gmail.com> wrote:
>>>
>>> Here's one approach...
>>>
>>> I find it much easier to work with if there is actual data. The following
>>> may not be representative of your data but it gives us somewhere to
>> start.
>>>
>>> ]'X Y'=: 'actg' {~ 2 30 ?@$ 4
>>>
>>> ggtaaaatgactgtagtgaagaaggagtcc
>>>
>>> ctgattaaggttcggtgtcgataccgcgca
>>>
>>>
>>> We now have 2 strings X and Y. Let's obtain the trigrams for each string
>>>
>>> trig=: 3,\&.> X;Y Get the nub of the union of both sets of trigrams and
>>> prepend it to each trigram set. supertrig=: (,~&.> <@~.@;) trig Now we
>> can
>>> use Key to count the trigrams in each set and decrement by 1 (for the
>> extra
>>> copy that we added). <: #/.~&> supertrig
>>>
>>> 1 2 1 2 1 1 2 1 1 1 1 1 2 1 2 2 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
>>>
>>> 2 0 1 0 0 0 1 0 0 1 1 0 0 1 0 1 0 1 0 0 1 0 2 1 1 1 1 2 1 1 1 1 1 1 2 1 1
>>>
>>> Or to summarise by trigram:
>>>
>>> (~.@; trig);|: <: #/.~&> supertrig
>>>
>>> +---+---+
>>>
>>> |ggt|1 2|
>>>
>>> |gta|2 0|
>>>
>>> |taa|1 1|
>>>
>>> |aaa|2 0|
>>>
>>> |aat|1 0|
>>>
>>> |atg|1 0|
>>>
>>> |tga|2 1|
>>>
>>> |gac|1 0|
>>>
>>> |act|1 0|
>>>
>>> |ctg|1 1|
>>>
>>> |tgt|1 1|
>>>
>>> |tag|1 0|
>>>
>>> |agt|2 0|
>>>
>>> |gtg|1 1|
>>>
>>> |gaa|2 0|
>>>
>>> |aag|2 1|
>>>
>>> |aga|1 0|
>>>
>>> |agg|1 1|
>>>
>>> |gga|1 0|
>>>
>>> |gag|1 0|
>>>
>>> |gtc|1 1|
>>>
>>> |tcc|1 0|
>>>
>>> |gat|0 2|
>>>
>>> |att|0 1|
>>>
>>> |tta|0 1|
>>>
>>> |gtt|0 1|
>>>
>>> |ttc|0 1|
>>>
>>> |tcg|0 2|
>>>
>>> |cgg|0 1|
>>>
>>> |cga|0 1|
>>>
>>> |ata|0 1|
>>>
>>> |tac|0 1|
>>>
>>> |acc|0 1|
>>>
>>> |ccg|0 1|
>>>
>>> |cgc|0 2|
>>>
>>> |gcg|0 1|
>>>
>>> |gca|0 1|
>>>
>>> +---+---+
>>>
>>>
>>>> On Sat, Oct 12, 2019 at 4:40 PM 'Jim Russell' via Programming <
>>>> programm...@jsoftware.com> wrote:
>>>>
>>>> Sure, thanks. I'm working to re-implement a text comparison program I
>> did
>>>> using VBA & Microsoft Access a number of years back.
>>>>
>>>> The object is to compare two text documents and see how similar one is
>> to
>>>> the other by comparing the number of unique trigrams that are found in
>>>> each.
>>>> For each text string a table of trigrams is constructed with the
>>>> expression 3,\x. The resulting table of 3-character samples m is then
>>>> tallied using #/.~m . This yields a vector of counts of each unique
>> trigram
>>>> corresponding to (an unseen) nub of m. The count, and a copy of the nub
>> of
>>>> m, represent a summary of the text in string x.
>>>> This same process then repeated to creat a smry for the second string,
>> y.
>>>>
>>>> The next step in the process is to assign a score of 0 to 1 based on a
>>>> comparison of the two string summaries. It would seem sensible to
>> compare
>>>> the nub of the two text strings to each other. What is the difference in
>>>> counts between the trigrams they have in common, and how many trigram
>> hits
>>>> for each are unique?
>>>> That is where using nub1 #/. nub2 would be attractive, were it not
>>>> required that the arguments had the same row counts, and Key could not
>>>> count unmatched rows.
>>>>
>>>> As it stands, I fear I am duplicating effort to find the nubs in
>> preparing
>>>> the summaries, and again if I have to use i. to calculate the scores.
>> If I
>>>> get a vector result when I use key on vectors, might I expect a table
>>>> result (including the counts and the nub) when key is applied to tables?
>>>>
>>>> Or is there a more appropriate approach? (In access and VBA, I used
>>>> dictionary objects with 3 character keys, as I recall. But I was very
>>>> pleasantly surprised at how well the 3 character trigrams recognized
>> text
>>>> similarities.)
>>>>
>>>> I really appreciate any insights you might have, Ric, and thanks for
>>>> tolerating my ignorance.
>>>>
>>>>>> On Oct 11, 2019, at 10:23 PM, Ric Sherlock <tikk...@gmail.com> wrote:
>>>>>
>>>>> Not sure I'm understanding your questions. Maybe including some of the
>>>>> expressions you've tried to illustrate your points would help?
>>>>
>>>> ----------------------------------------------------------------------
>>>> For information about J forums see http://www.jsoftware.com/forums.htm
>>>>
>>> ----------------------------------------------------------------------
>>> For information about J forums see http://www.jsoftware.com/forums.htm
>> ----------------------------------------------------------------------
>> For information about J forums see http://www.jsoftware.com/forums.htm
>>
>
>
> --
> (B=) <-----my sig
> Brian Schott
> ----------------------------------------------------------------------
> For information about J forums see http://www.jsoftware.com/forums.htm
----------------------------------------------------------------------
For information about J forums see http://www.jsoftware.com/forums.htm
