Your verb show needs a y in it.
show=: verb define <: #/.~&> y ) show supertrig |noun result was required: show | <:#/.~&> $trig 2 show=: verb define <: #/.~&> y ) show supertrig 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 2 2 2 2 2 1 1 2 1 1 1 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 On Sat, Oct 12, 2019 at 12:23 PM 'Jim Russell' via Programming < [email protected]> wrote: > Genius! I tried (and failed) to convert your reply to a script on my > iPhone: > > X=:'Now is the time for all good men to come ti' > Y=: 'Now is the time for the quick brown good men to come ti' > trig=: 3,\&.> X;Y > NB. Get the nub of the union of both sets of trigrams and prepend it to > each trigram set. > supertrig=: (,~&.> <@~.@;) trig > NB. Now we can use Key to count the trigrams in each set and decrement by > 1 (for the extra copy that we added). > > show=: verb define > <: #/.~&> > ) > show supertrig > > It almost worked, in particular your code did (j701): > load'~/user/ric.ijs' > |syntax error: show > | show supertrig > |[-11] /j/user/ric.ijs > supertrig > +---+---+ > |Now|Now| > |ow |ow | > |w i|w i| > | is| is| > |is |is | > |s t|s t| > | th| th| > |the|the| > |he |he | > |e t|e t| > | ti| ti| > |tim|tim| > > . Clip... > > | |to | > | |o c| > | | co| > | |com| > | |ome| > | |me | > | |e t| > | | ti| > +---+---+ > show > 3 : '<: #/.~&>' > > <: #/.~&> supertrig > 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 > 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 > 1 1 1 1 1 1 2 2 2 2 2 1 1 2 1 1 1 1 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 > 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 > > > > On Oct 12, 2019, at 1:22 AM, Ric Sherlock <[email protected]> wrote: > > > > Here's one approach... > > > > I find it much easier to work with if there is actual data. The following > > may not be representative of your data but it gives us somewhere to > start. > > > > ]'X Y'=: 'actg' {~ 2 30 ?@$ 4 > > > > ggtaaaatgactgtagtgaagaaggagtcc > > > > ctgattaaggttcggtgtcgataccgcgca > > > > > > We now have 2 strings X and Y. Let's obtain the trigrams for each string > > > > trig=: 3,\&.> X;Y Get the nub of the union of both sets of trigrams and > > prepend it to each trigram set. supertrig=: (,~&.> <@~.@;) trig Now we > can > > use Key to count the trigrams in each set and decrement by 1 (for the > extra > > copy that we added). <: #/.~&> supertrig > > > > 1 2 1 2 1 1 2 1 1 1 1 1 2 1 2 2 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 > > > > 2 0 1 0 0 0 1 0 0 1 1 0 0 1 0 1 0 1 0 0 1 0 2 1 1 1 1 2 1 1 1 1 1 1 2 1 1 > > > > Or to summarise by trigram: > > > > (~.@; trig);|: <: #/.~&> supertrig > > > > +---+---+ > > > > |ggt|1 2| > > > > |gta|2 0| > > > > |taa|1 1| > > > > |aaa|2 0| > > > > |aat|1 0| > > > > |atg|1 0| > > > > |tga|2 1| > > > > |gac|1 0| > > > > |act|1 0| > > > > |ctg|1 1| > > > > |tgt|1 1| > > > > |tag|1 0| > > > > |agt|2 0| > > > > |gtg|1 1| > > > > |gaa|2 0| > > > > |aag|2 1| > > > > |aga|1 0| > > > > |agg|1 1| > > > > |gga|1 0| > > > > |gag|1 0| > > > > |gtc|1 1| > > > > |tcc|1 0| > > > > |gat|0 2| > > > > |att|0 1| > > > > |tta|0 1| > > > > |gtt|0 1| > > > > |ttc|0 1| > > > > |tcg|0 2| > > > > |cgg|0 1| > > > > |cga|0 1| > > > > |ata|0 1| > > > > |tac|0 1| > > > > |acc|0 1| > > > > |ccg|0 1| > > > > |cgc|0 2| > > > > |gcg|0 1| > > > > |gca|0 1| > > > > +---+---+ > > > > > >> On Sat, Oct 12, 2019 at 4:40 PM 'Jim Russell' via Programming < > >> [email protected]> wrote: > >> > >> Sure, thanks. I'm working to re-implement a text comparison program I > did > >> using VBA & Microsoft Access a number of years back. > >> > >> The object is to compare two text documents and see how similar one is > to > >> the other by comparing the number of unique trigrams that are found in > >> each. > >> For each text string a table of trigrams is constructed with the > >> expression 3,\x. The resulting table of 3-character samples m is then > >> tallied using #/.~m . This yields a vector of counts of each unique > trigram > >> corresponding to (an unseen) nub of m. The count, and a copy of the nub > of > >> m, represent a summary of the text in string x. > >> This same process then repeated to creat a smry for the second string, > y. > >> > >> The next step in the process is to assign a score of 0 to 1 based on a > >> comparison of the two string summaries. It would seem sensible to > compare > >> the nub of the two text strings to each other. What is the difference in > >> counts between the trigrams they have in common, and how many trigram > hits > >> for each are unique? > >> That is where using nub1 #/. nub2 would be attractive, were it not > >> required that the arguments had the same row counts, and Key could not > >> count unmatched rows. > >> > >> As it stands, I fear I am duplicating effort to find the nubs in > preparing > >> the summaries, and again if I have to use i. to calculate the scores. > If I > >> get a vector result when I use key on vectors, might I expect a table > >> result (including the counts and the nub) when key is applied to tables? > >> > >> Or is there a more appropriate approach? (In access and VBA, I used > >> dictionary objects with 3 character keys, as I recall. But I was very > >> pleasantly surprised at how well the 3 character trigrams recognized > text > >> similarities.) > >> > >> I really appreciate any insights you might have, Ric, and thanks for > >> tolerating my ignorance. > >> > >>>> On Oct 11, 2019, at 10:23 PM, Ric Sherlock <[email protected]> wrote: > >>> > >>> Not sure I'm understanding your questions. Maybe including some of the > >>> expressions you've tried to illustrate your points would help? > >> > >> ---------------------------------------------------------------------- > >> For information about J forums see http://www.jsoftware.com/forums.htm > >> > > ---------------------------------------------------------------------- > > For information about J forums see http://www.jsoftware.com/forums.htm > ---------------------------------------------------------------------- > For information about J forums see http://www.jsoftware.com/forums.htm > -- (B=) <-----my sig Brian Schott ---------------------------------------------------------------------- For information about J forums see http://www.jsoftware.com/forums.htm
