Yes, that’s me. Sorry about the “Nb”s ... I was adding comments and trying to make the lines runnable.
I should have said that I wrote these example functions just for this discussion. They’re not well tested, nor, likely/possibly, proof against edge conditions such as empty datasets. BTW, I guess the “alphabet” for trigrams of DNA sequences has 4^3 = 64 elements. Mike Sent from my iPad > On 12 Oct 2019, at 21:00, 'Jim Russell' via Programming > <[email protected]> wrote: > > > >> On Oct 12, 2019, at 1:52 PM, 'Mike Day' via Programming >> <[email protected]> wrote: >> >> Sorry, I wasn’t considering trigrams in my off the cuff stuff, >> >> Mike > > Thanks Mike (Day?). Can’t always tell with fourm replies until I reply… > > I appreciate (and am still studying) your stuff, and learning a lot from all > these exchanges. I converted your reply to a script also, and so far have > {with my comments enclosed like this}: > > NB.> eg for Ric Sherlock’s example, modified for unequal sample sizes: > NB.> Apologies for non-alignment, as seen on iPad anyway. > > NB. {Defs moved to front, earlier results commented, and expected to > NB. change -- due to ?, but kept to sompare shape and type.} > NB. {Still trying to understand the monad/duad stuff...} > NB. {Changed a couple of Nb.'s t0 NB.} > > NB. absolute frequencies for one set > fr1 =: 3 : 0 > y fr1~ /:~ ~. y > : > alf =. x > ser =. y > <:@#/.~ alf, ser > ) > NB. relative frequencies for one set > rfr1 =: (%+/)@:fr1 > NB. compare frequencies > cfr =: 3 : 0 > y cfr~ /:~ ~.;y > : > alf =. x > sers=. y > alf&fr1 every y > ) > NB. compare relative frequencies > crfr =: 3 : 0 > y crfr~ /:~ ~.;y NB. Default base is sorted nub of all inputs. > : > alf =. x > sers=. y > alf&rfr1 every y > ) > ]'X Y'=: 'actg' {~ 2 30 ?@$ 4 > tttgcctataaacaatgcagaccagcacgt > ggcttcaacgactccagagtcttgctgagt > NB.catctaagtcgataatccacttacttccgg > NB.cagcaaggacaggtgctaatacacactcgc > [X =: 'actg' {~ 40?@$ 4 > attaggtgccgacagaagtggccaacctcatcgacaaagg > NB.ttagcacttccctcagagttacccacactagctggtgcag > [each NB. in Z? > [&.> > fr1 each X;Y NB. Absolute frequencies, using sorted nubs as base > +----------+-------+ > |13 10 11 6|6 8 8 8| > +----------+-------+ > NB.+---------+--------+ > NB.|9 13 8 10|10 9 7 4| > NB.+---------+--------+ > rfr1 each X;Y NB. Relative freqs > +---------------------+------------------------------+ > |0.325 0.25 0.275 0.15|0.2 0.266667 0.266667 0.266667| > +---------------------+------------------------------+ > NB.+--------------------+------------------------------+ > NB.|0.225 0.325 0.2 0.25|0.333333 0.3 0.233333 0.133333| > NB.+--------------------+------------------------------+ > NB. Comparisons > crfr X;Y NB. Absolute > 0.325 0.25 0.275 0.15 > 0.2 0.266667 0.266667 0.266667 > NB.9 13 8 10 > NB.10 9 7 4 > NB. load'~/user/temp.ijs' > crfr X;Y NB. Relative > 0.325 0.25 0.275 0.15 > 0.2 0.266667 0.266667 0.266667 > NB. 0.225 0.325 0.2 0.25 > NB.0.333333 0.3 0.233333 0.133333 > NB.You can supply your “alphabet” as Left argument.. > 'tagc' fr1 X NB. In your preferred order! > 6 13 11 10 > NB.10 9 8 13 > NB.fns below sign off,{now moved to front} > NB.Mike > NB. > ---------------------------------------------------------------------- > For information about J forums see http://www.jsoftware.com/forums.htm ---------------------------------------------------------------------- For information about J forums see http://www.jsoftware.com/forums.htm
