Dear Help,
After loading the pd.Citrus library and checking the DataFrame, I ran > the R code for: > > 1) 'oligo' > > > > {> library(pd.citrus) > Loading required package: RSQLite > Loading required package: DBI > > data(pmSequence) > > > show(pmSequence) > DataFrame with 341730 rows and 2 columns > fid sequence > <integer> <DNAStringSet> > 1 990 GCTTTTGGAACGATGGCGATGGCTA > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT > 3 992 TACTGCAGAAGACCATTACCCTACA > 4 993 TCACATAGCTGTGCAAGGACCGTAT > 5 994 TCGCCTAGCAAAGCTGCCAGCATGT > 6 995 TTACGTCTACGTGGTGGTGCTAAGA > 7 996 CCGAACGACCTGTTGGACCAAAGCA > 8 999 AAGCTAGTCTAGCTCCACCGACGGC > 9 1000 TTTTCACCGGTGACGTGCCGGTCGC > ... ... ... > 341722 963599 AAATTCGACATTTTCTTTACTGAGA > 341723 963790 GGATGCCCTCCGGTAATTGAATCAT > 341724 963802 GTTCAGCTCAAACCCTACATAGAGA > 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT > 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT > 341728 963863 AAACACGGTTATTCATCTGCGAAAC > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA > > getwd() > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi > cells/exData"} > > {library(oligo) > > celFiles<-list.celfiles("exData", full.names=TRUE) > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL", > "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL", > "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL", > "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL", > "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus") > Platform design info loaded. > Reading in : GSM839728_GF_28mm_EC-1.CEL > Reading in : GSM839729_GF_28mm_EC-2.CEL > Reading in : GSM839730_GF_28mm_EC-3.CEL > Reading in : GSM839731_GF_28mm_PC-1.CEL > Reading in : GSM839732_GF_28mm_PC-2.CEL > Reading in : GSM839733_GF_28mm_PC-3.CEL > Reading in : GSM839734_GF_41mm_EC-1.CEL > Reading in : GSM839735_GF_41mm_EC-2.CEL > Reading in : GSM839736_GF_41mm_EC-3.CEL > Reading in : GSM839737_GF_41mm_PC-1.CEL > Reading in : GSM839738_GF_41mm_PC-2.CEL > Reading in : GSM839739_GF_41mm_PC-3.CEL > > pmSeq<-pmSequence(affyCit) > > pmSeq[1:10] > A DNAStringSet instance of length 10 > width seq > [1] 25 GCTTTTGGAACGATGGCGATGGCTA > [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT > [3] 25 TACTGCAGAAGACCATTACCCTACA > [4] 25 TCACATAGCTGTGCAAGGACCGTAT > [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT > [6] 25 TTACGTCTACGTGGTGGTGCTAAGA > [7] 25 CCGAACGACCTGTTGGACCAAAGCA > [8] 25 AAGCTAGTCTAGCTCCACCGACGGC > [9] 25 TTTTCACCGGTGACGTGCCGGTCGC > [10] 25 GGTTAAGCCCGGCACTATCCGGGCA > > pmsLog2<-log2(pm(affyCit)) > > plot(pmsLog2) #the plots looks good across arrays (object=affyCit) > > However, still get: > > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq) > Error in model.frame.default(formula = intensities ~ design, > drop.unused.levels = TRUE) : > variable lengths differ (found for 'design') > sessionInfo() R version 2.15.1 (2012-06-22) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_United States.1252 [2] LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] oligo_1.22.0 Biobase_2.18.0 oligoClasses_1.20.0 [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 loaded via a namespace (and not attached): [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 [10] IRanges_1.16.2 iterators_1.0.6 parallel_2.15.1 [13] preprocessCore_1.20.0 splines_2.15.1 stats4_2.15.1 [16] tools_2.15.1 zlibbioc_1.4.0 I have been working on the issue for two weeks already. For example, above I loaded the Citrus.pd, additionally, I tried working with library(citruscdf), although this did not work either? Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles and read.celfiles commands), although R version for 'oligo' is 2.15 or greater, so cannot use the list matrix generated in 'affyio' version 1.27 on R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6. I am also using the recently updated BioC version 2.11. In oligo using R v. 2.15, I am able to view the .CEL images, make boxplots, MAplots of the data, but cannot proceed beyond this point (as indicated above). In summary, is this a bug in the 'oligo' package?? Any assistance is greatly appreciated. If you have questions or need additional information, please feel free to contact me. Best Regards, Franklin [[alternative HTML version deleted]] ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.