Hi Franklin, As you note, this is a bioconductor package, and they have a separate mailing list for support (fully of terribly knowledgeable and responsive folks) I know it's somewhat unpleasant to be told to look elsewhere after you've spent a good amount of time on it already, but I think it's worth your time to repost to that list: http://www.bioconductor.org/help/mailing-list/mailform/
Cheers, Michael On Sun, Oct 7, 2012 at 5:22 PM, Johnson, Franklin Theodore <franklin.john...@email.wsu.edu> wrote: > Dear Help, > > > > After loading the pd.Citrus library and checking the DataFrame, I ran >> the R code for: >> >> 1) 'oligo' >> >> >> >> {> library(pd.citrus) >> Loading required package: RSQLite >> Loading required package: DBI >> > data(pmSequence) >> >> > show(pmSequence) >> DataFrame with 341730 rows and 2 columns >> fid sequence >> <integer> <DNAStringSet> >> 1 990 GCTTTTGGAACGATGGCGATGGCTA >> 2 991 CGACGGGTTGCCTTCGGAGCTAAAT >> 3 992 TACTGCAGAAGACCATTACCCTACA >> 4 993 TCACATAGCTGTGCAAGGACCGTAT >> 5 994 TCGCCTAGCAAAGCTGCCAGCATGT >> 6 995 TTACGTCTACGTGGTGGTGCTAAGA >> 7 996 CCGAACGACCTGTTGGACCAAAGCA >> 8 999 AAGCTAGTCTAGCTCCACCGACGGC >> 9 1000 TTTTCACCGGTGACGTGCCGGTCGC >> ... ... ... >> 341722 963599 AAATTCGACATTTTCTTTACTGAGA >> 341723 963790 GGATGCCCTCCGGTAATTGAATCAT >> 341724 963802 GTTCAGCTCAAACCCTACATAGAGA >> 341725 963818 GGAAAAATGTCTCAACCAGCTGGTT >> 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA >> 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT >> 341728 963863 AAACACGGTTATTCATCTGCGAAAC >> 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA >> 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA >> > getwd() >> [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi >> cells/exData"} >> >> {library(oligo) >> > celFiles<-list.celfiles("exData", full.names=TRUE) >> > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", >> "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", >> "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL", >> "GSM839733_GF_28mm_PC-3.CEL", "GSM839734_GF_41mm_EC-1.CEL", >> "GSM839735_GF_41mm_EC-2.CEL", "GSM839736_GF_41mm_EC-3.CEL", >> "GSM839737_GF_41mm_PC-1.CEL", "GSM839738_GF_41mm_PC-2.CEL", >> "GSM839739_GF_41mm_PC-3.CEL", pkgname="pd.citrus") >> Platform design info loaded. >> Reading in : GSM839728_GF_28mm_EC-1.CEL >> Reading in : GSM839729_GF_28mm_EC-2.CEL >> Reading in : GSM839730_GF_28mm_EC-3.CEL >> Reading in : GSM839731_GF_28mm_PC-1.CEL >> Reading in : GSM839732_GF_28mm_PC-2.CEL >> Reading in : GSM839733_GF_28mm_PC-3.CEL >> Reading in : GSM839734_GF_41mm_EC-1.CEL >> Reading in : GSM839735_GF_41mm_EC-2.CEL >> Reading in : GSM839736_GF_41mm_EC-3.CEL >> Reading in : GSM839737_GF_41mm_PC-1.CEL >> Reading in : GSM839738_GF_41mm_PC-2.CEL >> Reading in : GSM839739_GF_41mm_PC-3.CEL >> > pmSeq<-pmSequence(affyCit) >> > pmSeq[1:10] >> A DNAStringSet instance of length 10 >> width seq >> [1] 25 GCTTTTGGAACGATGGCGATGGCTA >> [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT >> [3] 25 TACTGCAGAAGACCATTACCCTACA >> [4] 25 TCACATAGCTGTGCAAGGACCGTAT >> [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT >> [6] 25 TTACGTCTACGTGGTGGTGCTAAGA >> [7] 25 CCGAACGACCTGTTGGACCAAAGCA >> [8] 25 AAGCTAGTCTAGCTCCACCGACGGC >> [9] 25 TTTTCACCGGTGACGTGCCGGTCGC >> [10] 25 GGTTAAGCCCGGCACTATCCGGGCA >> > pmsLog2<-log2(pm(affyCit)) >> > plot(pmsLog2) #the plots looks good across arrays (object=affyCit) >> >> However, still get: >> > coefs<-getAffinitySplineCoefficients(pmsLog2, pmSeq) >> Error in model.frame.default(formula = intensities ~ design, >> drop.unused.levels = TRUE) : >> variable lengths differ (found for 'design') > > > >> sessionInfo() > R version 2.15.1 (2012-06-22) > Platform: i386-pc-mingw32/i386 (32-bit) > > locale: > [1] LC_COLLATE=English_United States.1252 > [2] LC_CTYPE=English_United States.1252 > [3] LC_MONETARY=English_United States.1252 > [4] LC_NUMERIC=C > [5] LC_TIME=English_United States.1252 > > attached base packages: > [1] stats graphics grDevices utils datasets methods base > > other attached packages: > [1] oligo_1.22.0 Biobase_2.18.0 oligoClasses_1.20.0 > [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 > > loaded via a namespace (and not attached): > [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 > [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 > [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 > [10] IRanges_1.16.2 iterators_1.0.6 parallel_2.15.1 > [13] preprocessCore_1.20.0 splines_2.15.1 stats4_2.15.1 > [16] tools_2.15.1 zlibbioc_1.4.0 > > I have been working on the issue for two weeks already. > > For example, above I loaded the Citrus.pd, additionally, I tried working with > library(citruscdf), although this did not work either? > > Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but > cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles > and read.celfiles commands), although R version for 'oligo' is 2.15 or > greater, so cannot use the list matrix generated in 'affyio' version 1.27 on > R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6. I > am also using the recently updated BioC version 2.11. > > In oligo using R v. 2.15, I am able to view the .CEL images, make boxplots, > MAplots of the data, but cannot proceed beyond this point (as indicated > above). > > > > In summary, is this a bug in the 'oligo' package?? > > > > Any assistance is greatly appreciated. > > If you have questions or need additional information, please feel free to > contact me. > > > > Best Regards, > > > > Franklin > ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.