A suggestion about parrot sugar
For example: "use parrot Foo::Bar", which would load parrot library under Foo/Bar. However, this would be easy and useful for rakudo, but would not for other possible Perl6 implementations. _ Hotmail: Trusted email with Microsoft’s powerful SPAM protection. https://signup.live.com/signup.aspx?id=60969
Re: Two questions on Perl 6 functionality
I still have several points unclear, this is my sample:
###
class Base {
method toHash() {
return {};
}
}
role FooBar {
has $.foo is rw;
has $.bar is rw;
toHash.wrap({
my $hash = callsame();
$hash = $self.foo;
return $hash;
});
}
class Compose is Base does FooBar {
}
my $obj = Compose.new(foo=>'foovalue', bar=>'barvalue');
my $data = $obj->toHash;###
1: It tells me "toHash" is not defined, as the role actually don't has that.
2: It seems that wrapping will affect the closure globally, but I only want
class with specific role has specific modification.
> Date: Sun, 20 Jun 2010 13:53:59 +0200
> From: mor...@faui2k3.org
> To: jianding...@msn.com
> CC: perl6-users@perl.org
> Subject: Re: Two questions on Perl 6 functionality
>
>
>
> Xi Yang wrote:
> > You might mis-understood method modifiers. I mean:
> > before x()
> > after x()
> > around x()
> >
>
> In Perl 6, you do that with wrapping:
>
> http://perlcabal.org/syn/S06.html#Wrapping
>
>
> Cheers,
> Moritz
_
Hotmail: Powerful Free email with security by Microsoft.
https://signup.live.com/signup.aspx?id=60969
RE: Two questions on Perl 6 functionality
Very subtle implementation, I'm trying to understand those things. Thanks! > Date: Sun, 20 Jun 2010 13:53:59 +0200 > From: mor...@faui2k3.org > To: jianding...@msn.com > CC: perl6-users@perl.org > Subject: Re: Two questions on Perl 6 functionality > > > > Xi Yang wrote: > > You might mis-understood method modifiers. I mean: > > before x() > > after x() > > around x() > > > > In Perl 6, you do that with wrapping: > > http://perlcabal.org/syn/S06.html#Wrapping > > > Cheers, > Moritz _ Hotmail: Free, trusted and rich email service. https://signup.live.com/signup.aspx?id=60969
RE: Two questions on Perl 6 functionality
You might mis-understood method modifiers. I mean:
before x()
after x()
around x()
> Date: Sun, 20 Jun 2010 12:17:46 +0200
> From: mor...@faui2k3.org
> To: jianding...@msn.com
> CC: perl6-users@perl.org
> Subject: Re: Two questions on Perl 6 functionality
>
> Hi,
>
> Xi Yang wrote:
> > 1: Does Perl 6 has method modifiers like those in Moose?
>
> Perl 6 has traits, so you can write for example
>
> class A {
>method x() is rw { ...}
> }
>
> to indicate that it's an lvalue routine (though I don't think it's
> implemented in Rakudo yet).
>
> > Where can I get the doc about that? By reading apocalypse?
>
> The Apocalypses are of historical interest only. Please read the
> Synopsis instead
>
> http://perlcabal.org/syn/
> http://perlcabal.org/syn/S06.html
> http://perlcabal.org/syn/S12.html
>
>
> > 2: Does Perl 6 has build-in support for message passing (like those in Glib
> > and Actionscript)?
>
> I fear I'm not qualified to answer that, and I hope somebody else picks
> up the topic.
>
> Cheers,
> Moritz
_
Hotmail: Free, trusted and rich email service.
https://signup.live.com/signup.aspx?id=60969
Two questions on Perl 6 functionality
1: Does Perl 6 has method modifiers like those in Moose? Where can I get the doc about that? By reading apocalypse? 2: Does Perl 6 has build-in support for message passing (like those in Glib and Actionscript)? _ Hotmail: Trusted email with Microsoft’s powerful SPAM protection. https://signup.live.com/signup.aspx?id=60969
Is there already have these utilities?
Like those in perl5: File::Spec;File::Path;Getopt::Long; P.S.: There seems has something wrong with my damned windows hotmail, as it weirdly ignores newlines... _ Hotmail: Trusted email with powerful SPAM protection. https://signup.live.com/signup.aspx?id=60969
RE: Something wrong with str.reverse
Thanks!So the API has changed permanently? > Date: Fri, 18 Jun 2010 13:29:11 +0800 > From: qiuhong...@gmail.com > To: perl6-users@perl.org > Subject: Re: Something wrong with str.reverse > > 于 2010年06月18日 13:25, Xi Yang 写道: > > I'm using rakudo 2010_05, with parrot 2.4.0. I found the $str.reverse just > > don't work at all: > > $ perl6 -e 'my $str="abcde"; say $str; say $str.reverse;'abcdeabcde > Use say $str.flip; _ Hotmail: Free, trusted and rich email service. https://signup.live.com/signup.aspx?id=60969
Something wrong with str.reverse
I'm using rakudo 2010_05, with parrot 2.4.0. I found the $str.reverse just don't work at all: $ perl6 -e 'my $str="abcde"; say $str; say $str.reverse;'abcdeabcde _ Hotmail: Powerful Free email with security by Microsoft. https://signup.live.com/signup.aspx?id=60969
Severe performance loss, comparing with perl 5
I'm trying to use use Perl 6 to process some nucleotide sequences. However, I
found it strangely slow on substr or string concat operations, compared with
its Perl 5 equivalent.
Here are the codes, Perl 6 on top, Perl 5 on middle, a test input file on
bottom (should be stored to "makeseq.fasta"). The Perl 6's revcom() sub works
very slow.
#!/usr/bin/perl6use
v6;use Bio::SeqIO;
say "program initialized";my $IN = Bio::SeqIO.new('fasta','makeseq.fasta');
say "input stream created";
while (my $obj = $IN.next_seq) {say "\tid: <",$obj.display_id,">";
say "\tseq: <{$obj.seq}>"; say "\trev: <{revcom($obj.seq)}>";}
sub revcom(Str $seq) { my $len = $seq.chars; my $result; loop (my
$i=$len-1; $i>=0; $i--) { given ($seq.substr($i,1)) {
when ('A') {$result~='T'} when ('T')
{$result~='A'} when ('G') {$result~='C'}
when ('C') {$result~='G'} when ('a') {$result~='t'}
when ('t') {$result~='a'} when ('g')
{$result~='c'} when ('c') {$result~='g'} }
} return
$result;}
#!/usr/bin/perl
use strict;use Bio::SeqIO;use feature qw/say switch/;
say "program initialized";
my $IN = Bio::SeqIO->new(-file=>'makeseq.fasta');
say "input stream created";
while (my $obj = $IN->next_seq) {say "\tid: <",$obj->display_id,">";say
"\tseq: <",$obj->seq,">";say "\trev: <",revcom($obj->seq),">";}
sub revcom {my $seq = shift;my $len = length $seq; my $result;
for (my $i=$len-1; $i>=0; $i--) { given (substr $seq,$i,1) {
when ('A') {$result.='T'} when ('T')
{$result.='A'} when ('G') {$result.='C'}
when ('C') {$result.='G'} when ('a') {$result.='t'}
when ('t') {$result.='a'} when ('g')
{$result.='c'} when ('c') {$result.='g'} }
} return $result;}
>EMBOSS_001ccgacaacgaatatacgggctgtttgcttgcgtttgagaggtcgtattcccagatgcgtaacgtagcgctccactccgttcgaaaggccggaggaaacaatcgctgaacaactgggtagacataaccatgtcgtctctgtgctactcccccacgggtatattaaggcagataaggttgcttagtgggacctataac>EMBOSS_002cggattcagaattggacccggaagcatgcaggcgtggaatgtgggttaagggaccgaagtatttcgttactattccgatagtatccgatgagtccgtagcgggatgcacgtcataatcctagccttgaacgaccgggtactggttacgcaattccacccatgtaccttcccacagcccacatgcgacttatt>EMBOSS_003tctacgtatgggaataggacgtgctcaatacacgcatggcttgccgtccatcgggagcgttgcaagtcaaagagctaggcttaacctggactgagtggtcattgcgccgatgcacggcctgcctcagcgctgggagtaatcgtcaatagcaagtgtattgtagcgtcatcccaggcctcgaggcctaa>EMBOSS_004gttgccgaacgcgccactctcccgcggtgcttaatcgagttggactcaccacctaccacacaacaccggatgcgctaactccgggcatctgtcgcaaggcttcatggaaccctacactggtaatcatggtaatagattcaacgtgggttccgttcatatagacaccactcacaaaggcgttcgtgccctgat>EMBOSS_005atatcactcagcctgtggacgtgagccacccgcgctcactctcgctgtagattatgtcagagaacgtagaatctgtaatcatcggtcatatgaagtaatccaccgacaccgagcaacgttgctactgacaacgggacatttaagagtgctggaaattgagttattccgcctggataattggcggtttg
_
Hotmail: Trusted email with powerful SPAM protection.
https://signup.live.com/signup.aspx?id=60969
