You should probably look into Biopython:
http://biopython.org/wiki/Main_Page
Your question should involve fairly straightforward use of the Seq methods
of Biopython. You should not try to write your own FASTA parser: Biopython
comes with a good one already.
Note that the tutor mailing list is
On 08/03/16 12:19, syed zaidi wrote:
One thing. This is a plain text mailing list and because Python is space
dependant you need to post in plain text not HTML/RTF or the layout gets
lost in the mail system. (as you see below).
The main things you need to tell us are what libraries you are
using
On 08/03/16 11:56, Paul Z wrote:
> There is AP with UDP-Server(sending UDP messages).
> My computer has connected the AP.
How did you do that? Via a socket? From Python?
> I know how to receive messages form a client via socket.
Your terminology confuses me. You send messages from
a client to
Hi,
There is AP with UDP-Server(sending UDP messages).
My computer has connected the AP. I know how to receive messages form a client
via socket.
But, Now, how to receive messages from a server?
Thanks!
___
Tu
Well, fasta is a file format used by biologists to store biological
sequencesthe format is as under> sequence information (sequence name, sequence
length etc)genomic sequence> sequence information (sequence name, sequence
length etc)genomic sequenceI want to match the name of sequence with anoth
On 08/03/16 10:00, Benjamin Fishbein wrote:
> Despite scouring stack overflow and other places, I can’t figure out how to
> simulate key presses.
> I’m using Mac 10.10.5.
> Most answers to this involve sending keys to an element, but my problem is
> that I have no element to send to; I’m trying t
Dear Ali,
I suggest your best way is to use the resource at the EMBL or the
National Library of Congress, NIH, resources.
There you can compare your FASTA sequences with authentic databases. The
programs know about FASTA and will recognise the format. It will
identify the gene for you. And i
Despite scouring stack overflow and other places, I can’t figure out how to
simulate key presses.
I’m using Mac 10.10.5.
Most answers to this involve sending keys to an element, but my problem is that
I have no element to send to; I’m trying to automate key presses for choosing
(browsing) a file
On 08/03/16 07:33, syed zaidi wrote:
> Hello all,
Hello,
For future reference, please do not hijack an old thread
for a new topic -
a) it messes up0 the archives for searching
b) it means those using threaded readers will probably
not see your message
> I am stuck in a problem, I hope someone
Hello all,
I am stuck in a problem, I hope someone can help me out. I have a FASTA file
with multiple sequences and another file with the gene coordinates. SAMPLEFASTA
FILE:
>EBM_revised_C2034_1
>length=611GCAGCAGTAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTT
10 matches
Mail list logo