experimental/rangerrick generate-infofiles.pl,1.13,1.14
Update of /cvsroot/fink/experimental/rangerrick In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659 Modified Files: generate-infofiles.pl Log Message: new upstream Index: generate-infofiles.pl === RCS file: /cvsroot/fink/experimental/rangerrick/generate-infofiles.pl,v retrieving revision 1.13 retrieving revision 1.14 diff -u -d -r1.13 -r1.14 --- generate-infofiles.pl 24 Mar 2006 17:01:26 - 1.13 +++ generate-infofiles.pl 29 Mar 2006 12:53:11 - 1.14 @@ -106,6 +106,7 @@ '^libhttpd-persistent$' = [ '1.3', '1010' ], '^libidl2(-shlibs)?$' = [ '0.8.5', '1001' ], '^libmath..(-dev)?$'= [ '0.0.4', '1001' ], + '^libmp4v21(-dev|-shlibs)?$'= [ '2.0.0', '1013' ], '^libmusicbrainz4(-shlibs)?$' = [ '2.1.1', '1001' ], '^libnc-dap3(-shlibs)?$'= [ '3.5.2', '1001' ], '^(libncurses5(-shlibs)?|ncurses)$' = [ '5.4-20041023', '1006' ], --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
experimental/rangerrick/10.4-transitional/main/finkinfo/languages mono.info,1.3,1.4 mono.patch,1.2,1.3
Update of /cvsroot/fink/experimental/rangerrick/10.4-transitional/main/finkinfo/languages In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/10.4-transitional/main/finkinfo/languages Modified Files: mono.info mono.patch Log Message: new upstream Index: mono.info === RCS file: /cvsroot/fink/experimental/rangerrick/10.4-transitional/main/finkinfo/languages/mono.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- mono.info 16 Mar 2006 21:01:40 - 1.3 +++ mono.info 29 Mar 2006 12:53:12 - 1.4 @@ -1,5 +1,5 @@ Package: mono -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 21 Description: .NET-compatible CIL engine Type: java(1.4) @@ -16,7 +16,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.com/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: a8c58b1d0722771745c228adbb27f3c1 +Source-MD5: 330cc66c6a44525950daf10c4f17c10e PatchScript: sed -e 's,@FINKPREFIX@,%p,g' %a/%n.patch | patch -p1 SetCPPFLAGS: -I%p/include Index: mono.patch === RCS file: /cvsroot/fink/experimental/rangerrick/10.4-transitional/main/finkinfo/languages/mono.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- mono.patch 20 Mar 2006 22:40:05 - 1.2 +++ mono.patch 29 Mar 2006 12:53:12 - 1.3 @@ -1,4 +1,3 @@ - --- mono-1.1.13/configure 2006-01-06 14:26:30.0 -0500 +++ mono-1.1.13-new/configure 2006-01-11 07:53:18.0 -0500 @@ -35519,7 +35519,7 @@ @@ -10,36 +9,6 @@ ;; *-*-*netbsd*) LIBC=libc.so.12 mono-1.1.13/data/config.in 2006-01-06 11:55:07.0 -0500 -+++ mono-1.1.13-new/data/config.in 2006-01-11 07:56:43.0 -0500 -@@ -2,15 +2,19 @@ - dllmap dll=cygwin1.dll target=@LIBC@ / - dllmap dll=libc target=@LIBC@ / - dllmap dll=intl target=@INTL@ / -- dllmap dll=libxslt.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=libmySQL.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=odbc32.dll target=[EMAIL PROTECTED]@ / -+ dllmap dll=libxslt.dll target=@FINKPREIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=libmySQL.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=odbc32.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / - dllmap dll=oci target=clntsh / - dllmap dll=db2cli target=[EMAIL PROTECTED]@/ - dllmap dll=msvcrt target=@LIBC@/ -- dllmap dll=MonoPosixHelper target=[EMAIL PROTECTED]@/ -- dllmap dll=sqlite target=@SQLITE@/ -- dllmap dll=sqlite3 target=@SQLITE3@/ -- dllmap dll=libX11 target=@X11@/ -- dllmap dll=libcairo-2.dll target=libcairo.so.2/ -+ dllmap dll=MonoPosixHelper target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=sqlite target=@FINKPREFIX@/lib/@SQLITE@/ -+ dllmap dll=sqlite3 target=@FINKPREFIX@/lib/@SQLITE3@/ -+ dllmap dll=libX11 target=/usr/X11R6/lib/@X11@/ -+ dllmap dll=libcairo-2.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=libgtk-win32-2.0-0.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=glib-2.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gnomevfs-2 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gtksourceview-1.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ - /configuration --- mono-1.1.13/mono/metadata/Makefile.in 2006-01-06 14:26:24.0 -0500 +++ mono-1.1.13-new/mono/metadata/Makefile.in 2006-01-11 07:53:19.0 -0500 @@ -68,7 +68,7 @@ @@ -73,3 +42,12 @@ full_name = g_module_build_path (., file_name); mono_trace (G_LOG_LEVEL_INFO, MONO_TRACE_DLLIMPORT, DllImport loading library: '%s'., full_name); +--- mono-1.1.13.6/data/config.in 2006-03-24 13:00:15.0 -0500 mono-1.1.13.6-new/data/config.in 2006-03-28 22:47:43.0 -0500 +@@ -12,5 +12,5 @@ + dllmap dll=sqlite target=@SQLITE@/ + dllmap dll=sqlite3 target=@SQLITE3@/ + dllmap dll=libX11 target=@X11@/ +- dllmap dll=libcairo-2.dll target=libcairo.so.2/ ++ dllmap dll=libcairo-2.dll target=[EMAIL PROTECTED]@/ + /configuration --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
experimental/rangerrick/10.3/main/finkinfo/languages mono.info,1.20,1.21 mono.patch,1.14,1.15
Update of /cvsroot/fink/experimental/rangerrick/10.3/main/finkinfo/languages In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/10.3/main/finkinfo/languages Modified Files: mono.info mono.patch Log Message: new upstream Index: mono.info === RCS file: /cvsroot/fink/experimental/rangerrick/10.3/main/finkinfo/languages/mono.info,v retrieving revision 1.20 retrieving revision 1.21 diff -u -d -r1.20 -r1.21 --- mono.info 16 Mar 2006 21:01:37 - 1.20 +++ mono.info 29 Mar 2006 12:53:11 - 1.21 @@ -1,5 +1,5 @@ Package: mono -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 11 Description: .NET-compatible CIL engine Type: java(1.4) @@ -16,7 +16,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.com/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: a8c58b1d0722771745c228adbb27f3c1 +Source-MD5: 330cc66c6a44525950daf10c4f17c10e PatchScript: sed -e 's,@FINKPREFIX@,%p,g' %a/%n.patch | patch -p1 SetCPPFLAGS: -I%p/include Index: mono.patch === RCS file: /cvsroot/fink/experimental/rangerrick/10.3/main/finkinfo/languages/mono.patch,v retrieving revision 1.14 retrieving revision 1.15 diff -u -d -r1.14 -r1.15 --- mono.patch 20 Mar 2006 22:40:00 - 1.14 +++ mono.patch 29 Mar 2006 12:53:11 - 1.15 @@ -1,4 +1,3 @@ - --- mono-1.1.13/configure 2006-01-06 14:26:30.0 -0500 +++ mono-1.1.13-new/configure 2006-01-11 07:53:18.0 -0500 @@ -35519,7 +35519,7 @@ @@ -10,36 +9,6 @@ ;; *-*-*netbsd*) LIBC=libc.so.12 mono-1.1.13/data/config.in 2006-01-06 11:55:07.0 -0500 -+++ mono-1.1.13-new/data/config.in 2006-01-11 07:56:43.0 -0500 -@@ -2,15 +2,19 @@ - dllmap dll=cygwin1.dll target=@LIBC@ / - dllmap dll=libc target=@LIBC@ / - dllmap dll=intl target=@INTL@ / -- dllmap dll=libxslt.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=libmySQL.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=odbc32.dll target=[EMAIL PROTECTED]@ / -+ dllmap dll=libxslt.dll target=@FINKPREIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=libmySQL.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=odbc32.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / - dllmap dll=oci target=clntsh / - dllmap dll=db2cli target=[EMAIL PROTECTED]@/ - dllmap dll=msvcrt target=@LIBC@/ -- dllmap dll=MonoPosixHelper target=[EMAIL PROTECTED]@/ -- dllmap dll=sqlite target=@SQLITE@/ -- dllmap dll=sqlite3 target=@SQLITE3@/ -- dllmap dll=libX11 target=@X11@/ -- dllmap dll=libcairo-2.dll target=libcairo.so.2/ -+ dllmap dll=MonoPosixHelper target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=sqlite target=@FINKPREFIX@/lib/@SQLITE@/ -+ dllmap dll=sqlite3 target=@FINKPREFIX@/lib/@SQLITE3@/ -+ dllmap dll=libX11 target=/usr/X11R6/lib/@X11@/ -+ dllmap dll=libcairo-2.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=libgtk-win32-2.0-0.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=glib-2.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gnomevfs-2 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gtksourceview-1.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ - /configuration --- mono-1.1.13/mono/metadata/Makefile.in 2006-01-06 14:26:24.0 -0500 +++ mono-1.1.13-new/mono/metadata/Makefile.in 2006-01-11 07:53:19.0 -0500 @@ -68,7 +68,7 @@ @@ -73,3 +42,12 @@ full_name = g_module_build_path (., file_name); mono_trace (G_LOG_LEVEL_INFO, MONO_TRACE_DLLIMPORT, DllImport loading library: '%s'., full_name); +--- mono-1.1.13.6/data/config.in 2006-03-24 13:00:15.0 -0500 mono-1.1.13.6-new/data/config.in 2006-03-28 22:47:43.0 -0500 +@@ -12,5 +12,5 @@ + dllmap dll=sqlite target=@SQLITE@/ + dllmap dll=sqlite3 target=@SQLITE3@/ + dllmap dll=libX11 target=@X11@/ +- dllmap dll=libcairo-2.dll target=libcairo.so.2/ ++ dllmap dll=libcairo-2.dll target=[EMAIL PROTECTED]@/ + /configuration --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
experimental/rangerrick/common/main/finkinfo/languages mono.info,1.43,1.44 mono.patch,1.24,1.25
Update of /cvsroot/fink/experimental/rangerrick/common/main/finkinfo/languages In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/common/main/finkinfo/languages Modified Files: mono.info mono.patch Log Message: new upstream Index: mono.info === RCS file: /cvsroot/fink/experimental/rangerrick/common/main/finkinfo/languages/mono.info,v retrieving revision 1.43 retrieving revision 1.44 diff -u -d -r1.43 -r1.44 --- mono.info 16 Mar 2006 21:01:42 - 1.43 +++ mono.info 29 Mar 2006 12:53:12 - 1.44 @@ -1,5 +1,5 @@ Package: mono -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 1 CustomMirror: @@ -8,7 +8,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.com/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: a8c58b1d0722771745c228adbb27f3c1 +Source-MD5: 330cc66c6a44525950daf10c4f17c10e PatchScript: sed -e 's,@FINKPREFIX@,%p,g' %a/%n.patch | patch -p1 DocFiles: AUTHORS COPYING* ChangeLog NEWS README Depends: cairo-shlibs (= 1.0.0-1), glib2-shlibs (= 2.4.6-7), libgettext3-shlibs, system-java14, macosx (= 10.4.3-1) Index: mono.patch === RCS file: /cvsroot/fink/experimental/rangerrick/common/main/finkinfo/languages/mono.patch,v retrieving revision 1.24 retrieving revision 1.25 diff -u -d -r1.24 -r1.25 --- mono.patch 12 Jan 2006 21:27:01 - 1.24 +++ mono.patch 29 Mar 2006 12:53:12 - 1.25 @@ -1,4 +1,3 @@ -diff -uNr mono-1.1.13/configure mono-1.1.13-new/configure --- mono-1.1.13/configure 2006-01-06 14:26:30.0 -0500 +++ mono-1.1.13-new/configure 2006-01-11 07:53:18.0 -0500 @@ -35519,7 +35519,7 @@ @@ -10,38 +9,6 @@ ;; *-*-*netbsd*) LIBC=libc.so.12 -diff -uNr mono-1.1.13/data/config.in mono-1.1.13-new/data/config.in mono-1.1.13/data/config.in 2006-01-06 11:55:07.0 -0500 -+++ mono-1.1.13-new/data/config.in 2006-01-11 07:56:43.0 -0500 -@@ -2,15 +2,19 @@ - dllmap dll=cygwin1.dll target=@LIBC@ / - dllmap dll=libc target=@LIBC@ / - dllmap dll=intl target=@INTL@ / -- dllmap dll=libxslt.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=libmySQL.dll target=[EMAIL PROTECTED]@ / -- dllmap dll=odbc32.dll target=[EMAIL PROTECTED]@ / -+ dllmap dll=libxslt.dll target=@FINKPREIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=libmySQL.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / -+ dllmap dll=odbc32.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@ / - dllmap dll=oci target=clntsh / - dllmap dll=db2cli target=[EMAIL PROTECTED]@/ - dllmap dll=msvcrt target=@LIBC@/ -- dllmap dll=MonoPosixHelper target=[EMAIL PROTECTED]@/ -- dllmap dll=sqlite target=@SQLITE@/ -- dllmap dll=sqlite3 target=@SQLITE3@/ -- dllmap dll=libX11 target=@X11@/ -- dllmap dll=libcairo-2.dll target=libcairo.so.2/ -+ dllmap dll=MonoPosixHelper target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=sqlite target=@FINKPREFIX@/lib/@SQLITE@/ -+ dllmap dll=sqlite3 target=@FINKPREFIX@/lib/@SQLITE3@/ -+ dllmap dll=libX11 target=/usr/X11R6/lib/@X11@/ -+ dllmap dll=libcairo-2.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=libgtk-win32-2.0-0.dll target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=glib-2.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gnomevfs-2 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ -+ dllmap dll=gtksourceview-1.0 target=@FINKPREFIX@/lib/[EMAIL PROTECTED]@/ - /configuration -diff -uNr mono-1.1.13/mono/metadata/Makefile.in mono-1.1.13-new/mono/metadata/Makefile.in --- mono-1.1.13/mono/metadata/Makefile.in 2006-01-06 14:26:24.0 -0500 +++ mono-1.1.13-new/mono/metadata/Makefile.in 2006-01-11 07:53:19.0 -0500 @@ -68,7 +68,7 @@ @@ -53,7 +20,6 @@ am_libmonoruntime_la_OBJECTS = reflection.lo object.lo icall.lo \ decimal.lo boehm-gc.lo null-gc.lo gc.lo marshal.lo monitor.lo \ threads.lo threadpool.lo file-io.lo socket-io.lo exception.lo \ -diff -uNr mono-1.1.13/mono/metadata/loader.c mono-1.1.13-new/mono/metadata/loader.c --- mono-1.1.13/mono/metadata/loader.c 2005-12-15 08:13:11.0 -0500 +++ mono-1.1.13-new/mono/metadata/loader.c 2006-01-11 07:53:19.0 -0500 @@ -940,6 +940,19 @@ @@ -76,3 +42,12 @@ full_name = g_module_build_path (., file_name); mono_trace (G_LOG_LEVEL_INFO, MONO_TRACE_DLLIMPORT, DllImport loading library: '%s'., full_name); +--- mono-1.1.13.6/data/config.in 2006-03-24 13:00:15.0 -0500 mono-1.1.13.6-new/data/config.in 2006-03-28 22:47:43.0 -0500 +@@ -12,5 +12,5 @@ + dllmap dll=sqlite target=@SQLITE@/ + dllmap dll=sqlite3 target=@SQLITE3@/ + dllmap dll=libX11 target=@X11@/ +- dllmap
experimental/rangerrick/10.4-transitional/main/finkinfo/libs libgdiplus.info,1.4,1.5
Update of /cvsroot/fink/experimental/rangerrick/10.4-transitional/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/10.4-transitional/main/finkinfo/libs Modified Files: libgdiplus.info Log Message: new upstream Index: libgdiplus.info === RCS file: /cvsroot/fink/experimental/rangerrick/10.4-transitional/main/finkinfo/libs/libgdiplus.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- libgdiplus.info 16 Mar 2006 22:31:28 - 1.4 +++ libgdiplus.info 29 Mar 2006 12:53:12 - 1.5 @@ -1,5 +1,5 @@ Package: libgdiplus -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 21 Description: System.Drawing implementation for Mono License: OSI-Approved @@ -14,7 +14,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.org/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: 3ea5e3ee01f1f43459e2c2d0b52ece1a +Source-MD5: 9177164efa8dfe8f625c240945d6a379 PatchScript: perl -pi -e 's,-Werror,,' src/Makefile.in patch -p1 %a/%n.patch --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
experimental/rangerrick/10.4/main/finkinfo/libs libgdiplus.info,1.18,1.19
Update of /cvsroot/fink/experimental/rangerrick/10.4/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/10.4/main/finkinfo/libs Modified Files: libgdiplus.info Log Message: new upstream Index: libgdiplus.info === RCS file: /cvsroot/fink/experimental/rangerrick/10.4/main/finkinfo/libs/libgdiplus.info,v retrieving revision 1.18 retrieving revision 1.19 diff -u -d -r1.18 -r1.19 --- libgdiplus.info 16 Mar 2006 22:31:28 - 1.18 +++ libgdiplus.info 29 Mar 2006 12:53:11 - 1.19 @@ -1,5 +1,5 @@ Package: libgdiplus -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 1021 Description: System.Drawing implementation for Mono License: OSI-Approved @@ -14,7 +14,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.org/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: 3ea5e3ee01f1f43459e2c2d0b52ece1a +Source-MD5: 9177164efa8dfe8f625c240945d6a379 PatchScript: perl -pi -e 's,-Werror,,' src/Makefile.in patch -p1 %a/%n.patch --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
experimental/rangerrick/common/main/finkinfo/libs libgpod0.info,NONE,1.1 libgpod0.patch,NONE,1.1 libgdiplus.info,1.34,1.35
Update of /cvsroot/fink/experimental/rangerrick/common/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5659/common/main/finkinfo/libs Modified Files: libgdiplus.info Added Files: libgpod0.info libgpod0.patch Log Message: new upstream --- NEW FILE: libgpod0.info --- Package: libgpod0 Version: 0.3.2 Revision: 1 Depends: %N-shlibs (= %v-%r) Source: mirror:sourceforge:gtkpod/libgpod-%v.tar.gz Source-MD5: c9c41625347a33efd9441c4e71fdd04e Patch: %n.patch ConfigureParams: --mandir=%p/share/man --disable-dependency-tracking InstallScript: #!/bin/sh -ex make install DESTDIR=%d SplitOff: Package: %N-shlibs Description: Shared libraries for libgpod Files: lib/libgpod.*.dylib Shlibs: %p/lib/libgpod.0.dylib 303.0.0 libgpod0-shlibs (= 0.3.2-1) DocFiles: AUTHORS COPYING ChangeLog INSTALL NEWS README TODO Description: Library for accessing iPod iles Maintainer: Benjamin Reed [EMAIL PROTECTED] Homepage: http://www.gtkpod.org/libgpod.html License: LGPL DescDetail: libgpod is a shared library to access the contents of an iPod. This library is based on code used in the gtkpod project. libgpod supports playlists, smart playlists, playcounts, ratings and podcasts. Support for cover art and photos is currently being tested. --- NEW FILE: libgpod0.patch --- diff -uNr libgpod-0.3.2/src/itdb_itunesdb.c libgpod-0.3.2-patch/src/itdb_itunesdb.c --- libgpod-0.3.2/src/itdb_itunesdb.c 2006-02-19 05:14:33.0 -0500 +++ libgpod-0.3.2-patch/src/itdb_itunesdb.c 2006-03-25 13:05:31.0 -0500 @@ -3861,15 +3861,8 @@ return result; } - -/* Do the actual writing to the iTunesSD */ -/* If @filename cannot be NULL */ -gboolean itdb_shuffle_write_file (Itdb_iTunesDB *itdb, - const gchar *filename, GError **error) +gboolean haystack (gchar *filetype, gchar **desclist) { -auto gboolean haystack (gchar *filetype, gchar **desclist); -gboolean haystack (gchar *filetype, gchar **desclist) -{ gchar **dlp; if (!filetype || !desclist) return FALSE; for (dlp=desclist; *dlp; ++dlp) @@ -3877,8 +3870,14 @@ if (strstr (filetype, *dlp)) return TRUE; } return FALSE; -} +} + +/* Do the actual writing to the iTunesSD */ +/* If @filename cannot be NULL */ +gboolean itdb_shuffle_write_file (Itdb_iTunesDB *itdb, + const gchar *filename, GError **error) +{ FExport *fexp; GList *gl; WContents *cts; diff -uNr libgpod-0.3.2/src/itdb_track.c libgpod-0.3.2-patch/src/itdb_track.c --- libgpod-0.3.2/src/itdb_track.c 2005-12-04 05:26:40.0 -0500 +++ libgpod-0.3.2-patch/src/itdb_track.c2006-03-25 13:05:31.0 -0500 @@ -56,20 +56,11 @@ return track; } +extern gboolean haystack (gchar *filetype, gchar **desclist); + /* Attempt to set some of the unknowns to reasonable defaults */ static void itdb_track_set_defaults (Itdb_Track *tr) { -auto gboolean haystack (gchar *filetype, gchar **desclist); -gboolean haystack (gchar *filetype, gchar **desclist) -{ - gchar **dlp; - if (!filetype || !desclist) return FALSE; - for (dlp=desclist; *dlp; ++dlp) - { - if (strstr (filetype, *dlp)) return TRUE; - } - return FALSE; -} gchar *mp3_desc[] = {MPEG, MP3, mpeg, mp3, NULL}; gchar *mp4_desc[] = {AAC, MP4, aac, mp4, NULL}; Index: libgdiplus.info === RCS file: /cvsroot/fink/experimental/rangerrick/common/main/finkinfo/libs/libgdiplus.info,v retrieving revision 1.34 retrieving revision 1.35 diff -u -d -r1.34 -r1.35 --- libgdiplus.info 16 Mar 2006 22:31:28 - 1.34 +++ libgdiplus.info 29 Mar 2006 12:53:12 - 1.35 @@ -1,5 +1,5 @@ Package: libgdiplus -Version: 1.1.13.4 +Version: 1.1.13.6 Revision: 1 CustomMirror: @@ -8,7 +8,7 @@ nam-CA: http://www.southofheaven.net/befunk Source: http://www.go-mono.org/sources/%n-1.1/%n-%v.tar.gz -Source-MD5: 3ea5e3ee01f1f43459e2c2d0b52ece1a +Source-MD5: 9177164efa8dfe8f625c240945d6a379 PatchScript: perl -pi -e 's,-Werror,,' src/Makefile.in patch -p1 %a/%n.patch --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/sci coot.info,1.8,1.9
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv10521 Modified Files: coot.info Log Message: coot version change,fixed Index: coot.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/coot.info,v retrieving revision 1.8 retrieving revision 1.9 diff -u -d -r1.8 -r1.9 --- coot.info 29 Mar 2006 05:39:53 - 1.8 +++ coot.info 29 Mar 2006 13:00:38 - 1.9 @@ -51,6 +51,7 @@ CC=/usr/bin/gcc \ py_path=%p/bin/python \ ./configure %c +rm src/coot_wrap_python.cc # make --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/graphics qcad.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/graphics In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv8256/10.4/unstable/main/finkinfo/graphics Modified Files: qcad.info Log Message: Match GCC ABI to the tree Index: qcad.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/graphics/qcad.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- qcad.info 6 Feb 2006 15:50:08 - 1.3 +++ qcad.info 29 Mar 2006 16:20:42 - 1.4 @@ -1,10 +1,10 @@ Package: qcad Version: 2.0.1.3-1 -Revision: 1002 +Revision: 1003 Maintainer: Jeremy Higgs [EMAIL PROTECTED] BuildDepends: libjpeg, libpng3, qt3 (= 3.3.5-1023), x11-dev Depends: qt3-shlibs (= 3.3.5-1023), libpng3-shlibs -GCC: 3.3 +GCC: 4.0 Source: http://www.ribbonsoft.com/archives/%n/%n-%v.src.tar.gz Source-MD5: 480c0a67e37ed57d14e67d2977db8cff Patch: %n.patch --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/graphics qcad.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/graphics In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv8256/10.4-transitional/unstable/main/finkinfo/graphics Modified Files: qcad.info Log Message: Match GCC ABI to the tree Index: qcad.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/graphics/qcad.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- qcad.info 6 Feb 2006 15:50:08 - 1.3 +++ qcad.info 29 Mar 2006 16:20:42 - 1.4 @@ -1,10 +1,10 @@ Package: qcad Version: 2.0.1.3-1 -Revision: 2 +Revision: 3 Maintainer: Jeremy Higgs [EMAIL PROTECTED] BuildDepends: libjpeg, libpng3, qt3, x11-dev Depends: qt3-shlibs, libpng3-shlibs -GCC: 4.0 +GCC: 3.3 Source: http://www.ribbonsoft.com/archives/%n/%n-%v.src.tar.gz Source-MD5: 480c0a67e37ed57d14e67d2977db8cff Patch: %n.patch --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/graphics qcad.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/graphics In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv25908/10.4/unstable/main/finkinfo/graphics Modified Files: qcad.info Log Message: Doesn't build with c++4. Not sure this is enough hackery to force 3.3... Index: qcad.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/graphics/qcad.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- qcad.info 29 Mar 2006 16:20:42 - 1.4 +++ qcad.info 29 Mar 2006 16:50:16 - 1.5 @@ -1,10 +1,11 @@ Package: qcad Version: 2.0.1.3-1 -Revision: 1003 +Revision: 1004 +Architecture: powerpc Maintainer: Jeremy Higgs [EMAIL PROTECTED] -BuildDepends: libjpeg, libpng3, qt3 (= 3.3.5-1023), x11-dev +BuildDepends: libjpeg, libpng3, qt3 (= 3.3.5-1023), x11-dev, gcc3.3 Depends: qt3-shlibs (= 3.3.5-1023), libpng3-shlibs -GCC: 4.0 +GCC: 3.3 Source: http://www.ribbonsoft.com/archives/%n/%n-%v.src.tar.gz Source-MD5: 480c0a67e37ed57d14e67d2977db8cff Patch: %n.patch @@ -47,6 +48,10 @@ DescPackaging: Customised CompileScript and InstallScripts to compile and install properly. + + This version is compiled with g++-3.3, even in the 10.4 tree. If it is + ever updated to a more recent compiler, any packages which depend on + this one must be updated at the same time. License: GPL Homepage: http://www.ribbonsoft.com/qcad.html --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/games sdl-mixer.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv29305 Modified Files: sdl-mixer.info Log Message: Using %N in Patch isn't working right now...switched to %n Index: sdl-mixer.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/games/sdl-mixer.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- sdl-mixer.info 11 Mar 2006 23:48:19 - 1.3 +++ sdl-mixer.info 29 Mar 2006 16:55:55 - 1.4 @@ -1,7 +1,7 @@ Package: sdl-mixer Version: 1.2.6 Revision: 1013 -Patch: %N.patch +Patch: %n.patch Maintainer: Max Horn [EMAIL PROTECTED] Depends: %N-shlibs (= %v-%r) Conflicts: %N-bin ( 1.2.5-1) --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
fink/perlmod/Fink ChangeLog,1.1312,1.1313 Config.pm,1.78,1.79
Update of /cvsroot/fink/fink/perlmod/Fink In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv17031 Modified Files: ChangeLog Config.pm Log Message: Avoid circular dependency Index: Config.pm === RCS file: /cvsroot/fink/fink/perlmod/Fink/Config.pm,v retrieving revision 1.78 retrieving revision 1.79 diff -u -d -r1.78 -r1.79 --- Config.pm 29 Mar 2006 00:08:07 - 1.78 +++ Config.pm 29 Mar 2006 17:30:50 - 1.79 @@ -25,7 +25,6 @@ use Fink::Base; use Fink::Command qw(cp); use Fink::Services qw(get_arch read_properties get_options $VALIDATE_HELP); -use Fink::FinkVersion qw(default_binary_version); use strict; @@ -775,11 +774,12 @@ { sub bindist_check_distro { my ($self) = @_; + require Fink::FinkVersion; my $err = ERR; Fink does not yet support an official set of binary packages for your current distribution. ERR - return exists default_binary_version($self-param('Distribution')) ? 0 : $err; + return defined Fink::FinkVersion::default_binary_version($self-param('Distribution')) ? 0 : $err; } } Index: ChangeLog === RCS file: /cvsroot/fink/fink/perlmod/Fink/ChangeLog,v retrieving revision 1.1312 retrieving revision 1.1313 diff -u -d -r1.1312 -r1.1313 --- ChangeLog 28 Mar 2006 23:55:55 - 1.1312 +++ ChangeLog 29 Mar 2006 17:30:49 - 1.1313 @@ -1,3 +1,7 @@ +2006-03-29 Dave Morrison [EMAIL PROTECTED] + + * Config.pm: Avoid circular dependency + 2006-03-28 Dave Morrison [EMAIL PROTECTED] * Config.pm: Use FinkVersion::default_binary_version to determine --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
fink/perlmod/Fink Finally.pm,1.4,1.5
Update of /cvsroot/fink/fink/perlmod/Fink In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv1229/perlmod/Fink Modified Files: Finally.pm Log Message: Typo Index: Finally.pm === RCS file: /cvsroot/fink/fink/perlmod/Fink/Finally.pm,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- Finally.pm 23 Mar 2006 23:11:43 - 1.4 +++ Finally.pm 29 Mar 2006 17:57:10 - 1.5 @@ -37,7 +37,7 @@ directly. A Fink::Finally object will not run in a fork (causing two runs). It will also -not run twice in normal circustances. Finally, it ensures that $@ and $? are +not run twice in normal circumstances. Finally, it ensures that $@ and $? are not changed. Circular references should never include a Fink::Finally object. This will cause --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/text dvipdfmx.info,1.4,1.5 dvipdfmx.patch,1.2,1.3
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/text In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv29660/10.4/unstable/main/finkinfo/text Modified Files: dvipdfmx.info dvipdfmx.patch Log Message: Added libpaper support. Index: dvipdfmx.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/text/dvipdfmx.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- dvipdfmx.info 22 Mar 2006 17:55:22 - 1.4 +++ dvipdfmx.info 29 Mar 2006 18:28:14 - 1.5 @@ -1,22 +1,21 @@ Package: dvipdfmx Version: 20050627 -Revision: 6 -Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript -BuildDepends: libkpathsea4, libpng3, fink (= 0.24.12) +Revision: 7 +Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript, libpaper1-shlibs +BuildDepends: libkpathsea4, libpng3, libpaper1-dev, fink (= 0.24.12) Source: http://project.ktug.or.kr/dvipdfmx/snapshot/release/%n-%v.tar.gz Source-MD5: 5a02f615401052f67b13a250c6bbe9ec PatchFile: %n.patch -PatchFile-MD5: 205e3f5aa9e1ac9751f437b2045bed33 -ConfigureParams: --prefix=%i --with-kpathsea=%p --with-png=%p --with-zlib=%p +PatchFile-MD5: a62da62f12f535798200bfa110a38249 +ConfigureParams: --with-kpathsea=%p --with-png=%p --with-zlib=/usr --with-paper=%p InstallScript: - make install prefix=%i - - mkdir -p %i/share/texmf/fonts/cmap/dvipdfm - mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm/ - mkdir -p %i/share/texmf/fonts/map/dvipdfm - mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm/ + make install DESTDIR=%d - mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/dvipdfm/ + mkdir -p %i/share/texmf/fonts/cmap/dvipdfm + mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm + mkdir -p %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/fonts/map/dvipdfm DocFiles: AUTHORS COPYING ChangeLog INSTALL NEWS README TODO ConfFiles: %p/share/texmf/dvipdfm/config/dvipdfmx.cfg @@ -32,7 +31,7 @@ if test -d $res ; then ln -s $res . fi - [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr + [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf PreRmScript: rm -f %p/share/texmf/dvipdfm/Resource @@ -40,10 +39,10 @@ rm -f %p/share/texmf/fonts/cmap/dvipdfm/Resource rm -f %p/share/texmf/fonts/cmap/dvipdfm/fonts -PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr +PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf DescPackaging: - %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also changed cid-x.map - to dvipdfmx-20050307 version because there are no font entries in 20050627. + %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also reverts cid-x.map + back to %n-20050307 version because there are no font entries in 20050627. Description: DVI to PDF converter with multi-byte character support License: GPL Index: dvipdfmx.patch === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/text/dvipdfmx.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- dvipdfmx.patch 6 Mar 2006 19:28:10 - 1.2 +++ dvipdfmx.patch 29 Mar 2006 18:28:14 - 1.3 @@ -155,3 +155,14 @@ +%% http://ftp.netscape.com/pub/communicator/extras/fonts/windows/ReadMe.htm + [EMAIL PROTECTED]@ unicode cyberbit +--- dvipdfmx-20050627/data/Makefile.in.orig2005-06-27 20:57:15.0 +0900 dvipdfmx-20050627/data/Makefile.in 2006-03-30 02:09:50.0 +0900 +@@ -293,7 +293,7 @@ + + install-pkgdataDATA: $(pkgdata_DATA) + @$(NORMAL_INSTALL) +- $(mkinstalldirs) $(pkgdatadir) ++ $(mkinstalldirs) $(DESTDIR)$(pkgdatadir) + @list='$(pkgdata_DATA)'; for adir in $$list; do \ + $(mkinstalldirs) $(DESTDIR)$(pkgdatadir)/$$adir; \ + for p in $$adir/*; do \ --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/text dvipdfmx.info,1.8,1.9 dvipdfmx.patch,1.3,1.4
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/text In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv29660/10.3/unstable/main/finkinfo/text Modified Files: dvipdfmx.info dvipdfmx.patch Log Message: Added libpaper support. Index: dvipdfmx.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/text/dvipdfmx.info,v retrieving revision 1.8 retrieving revision 1.9 diff -u -d -r1.8 -r1.9 --- dvipdfmx.info 22 Mar 2006 17:51:21 - 1.8 +++ dvipdfmx.info 29 Mar 2006 18:28:13 - 1.9 @@ -1,22 +1,21 @@ Package: dvipdfmx Version: 20050627 -Revision: 6 -Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript -BuildDepends: libkpathsea4, libpng3, fink (= 0.24.12) +Revision: 7 +Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript, libpaper1-shlibs +BuildDepends: libkpathsea4, libpng3, libpaper1-dev, fink (= 0.24.12) Source: http://project.ktug.or.kr/dvipdfmx/snapshot/release/%n-%v.tar.gz Source-MD5: 5a02f615401052f67b13a250c6bbe9ec PatchFile: %n.patch -PatchFile-MD5: 205e3f5aa9e1ac9751f437b2045bed33 -ConfigureParams: --prefix=%i --with-kpathsea=%p --with-png=%p --with-zlib=%p +PatchFile-MD5: a62da62f12f535798200bfa110a38249 +ConfigureParams: --with-kpathsea=%p --with-png=%p --with-zlib=/usr --with-paper=%p InstallScript: - make install prefix=%i - - mkdir -p %i/share/texmf/fonts/cmap/dvipdfm - mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm/ - mkdir -p %i/share/texmf/fonts/map/dvipdfm - mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm/ + make install DESTDIR=%d - mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/dvipdfm/ + mkdir -p %i/share/texmf/fonts/cmap/dvipdfm + mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm + mkdir -p %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/fonts/map/dvipdfm DocFiles: AUTHORS COPYING ChangeLog INSTALL NEWS README TODO ConfFiles: %p/share/texmf/dvipdfm/config/dvipdfmx.cfg @@ -32,7 +31,7 @@ if test -d $res ; then ln -s $res . fi - [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr + [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf PreRmScript: rm -f %p/share/texmf/dvipdfm/Resource @@ -40,10 +39,10 @@ rm -f %p/share/texmf/fonts/cmap/dvipdfm/Resource rm -f %p/share/texmf/fonts/cmap/dvipdfm/fonts -PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr +PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf DescPackaging: - %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also changed cid-x.map - to dvipdfmx-20050307 version because there are no font entries in 20050627. + %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also reverts cid-x.map + back to %n-20050307 version because there are no font entries in 20050627. Description: DVI to PDF converter with multi-byte character support License: GPL Index: dvipdfmx.patch === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/text/dvipdfmx.patch,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- dvipdfmx.patch 6 Mar 2006 19:19:31 - 1.3 +++ dvipdfmx.patch 29 Mar 2006 18:28:13 - 1.4 @@ -155,3 +155,14 @@ +%% http://ftp.netscape.com/pub/communicator/extras/fonts/windows/ReadMe.htm + [EMAIL PROTECTED]@ unicode cyberbit +--- dvipdfmx-20050627/data/Makefile.in.orig2005-06-27 20:57:15.0 +0900 dvipdfmx-20050627/data/Makefile.in 2006-03-30 02:09:50.0 +0900 +@@ -293,7 +293,7 @@ + + install-pkgdataDATA: $(pkgdata_DATA) + @$(NORMAL_INSTALL) +- $(mkinstalldirs) $(pkgdatadir) ++ $(mkinstalldirs) $(DESTDIR)$(pkgdatadir) + @list='$(pkgdata_DATA)'; for adir in $$list; do \ + $(mkinstalldirs) $(DESTDIR)$(pkgdatadir)/$$adir; \ + for p in $$adir/*; do \ --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/text dvipdfmx.info,1.5,1.6 dvipdfmx.patch,1.2,1.3
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/text In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv29660/10.4-transitional/unstable/main/finkinfo/text Modified Files: dvipdfmx.info dvipdfmx.patch Log Message: Added libpaper support. Index: dvipdfmx.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/text/dvipdfmx.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- dvipdfmx.info 22 Mar 2006 17:53:11 - 1.5 +++ dvipdfmx.info 29 Mar 2006 18:28:14 - 1.6 @@ -1,22 +1,21 @@ Package: dvipdfmx Version: 20050627 -Revision: 6 -Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript -BuildDepends: libkpathsea4, libpng3, fink (= 0.24.12) +Revision: 7 +Depends: ptex3-base, libkpathsea4-shlibs, libpng3-shlibs, ghostscript-nox | ghostscript, libpaper1-shlibs +BuildDepends: libkpathsea4, libpng3, libpaper1-dev, fink (= 0.24.12) Source: http://project.ktug.or.kr/dvipdfmx/snapshot/release/%n-%v.tar.gz Source-MD5: 5a02f615401052f67b13a250c6bbe9ec PatchFile: %n.patch -PatchFile-MD5: 205e3f5aa9e1ac9751f437b2045bed33 -ConfigureParams: --prefix=%i --with-kpathsea=%p --with-png=%p --with-zlib=%p +PatchFile-MD5: a62da62f12f535798200bfa110a38249 +ConfigureParams: --with-kpathsea=%p --with-png=%p --with-zlib=/usr --with-paper=%p InstallScript: - make install prefix=%i - - mkdir -p %i/share/texmf/fonts/cmap/dvipdfm - mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm/ - mkdir -p %i/share/texmf/fonts/map/dvipdfm - mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm/ + make install DESTDIR=%d - mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/dvipdfm/ + mkdir -p %i/share/texmf/fonts/cmap/dvipdfm + mv %i/share/texmf/dvipdfm/CMap %i/share/texmf/fonts/cmap/dvipdfm + mkdir -p %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/cid-x.map %i/share/texmf/fonts/map/dvipdfm + mv %i/share/texmf/dvipdfm/config/glyphlist.txt %i/share/texmf/fonts/map/dvipdfm DocFiles: AUTHORS COPYING ChangeLog INSTALL NEWS README TODO ConfFiles: %p/share/texmf/dvipdfm/config/dvipdfmx.cfg @@ -32,7 +31,7 @@ if test -d $res ; then ln -s $res . fi - [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr + [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf PreRmScript: rm -f %p/share/texmf/dvipdfm/Resource @@ -40,10 +39,10 @@ rm -f %p/share/texmf/fonts/cmap/dvipdfm/Resource rm -f %p/share/texmf/fonts/cmap/dvipdfm/fonts -PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr +PostRmScript: [ -x %p/bin/mktexlsr ] %p/bin/mktexlsr %p/share/texmf DescPackaging: - %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also changed cid-x.map - to dvipdfmx-20050307 version because there are no font entries in 20050627. + %n.patch modifies dvipdfmx.cfg to use NeverEmbed. It also reverts cid-x.map + back to %n-20050307 version because there are no font entries in 20050627. Description: DVI to PDF converter with multi-byte character support License: GPL Index: dvipdfmx.patch === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/text/dvipdfmx.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- dvipdfmx.patch 6 Mar 2006 19:24:45 - 1.2 +++ dvipdfmx.patch 29 Mar 2006 18:28:14 - 1.3 @@ -155,3 +155,14 @@ +%% http://ftp.netscape.com/pub/communicator/extras/fonts/windows/ReadMe.htm + [EMAIL PROTECTED]@ unicode cyberbit +--- dvipdfmx-20050627/data/Makefile.in.orig2005-06-27 20:57:15.0 +0900 dvipdfmx-20050627/data/Makefile.in 2006-03-30 02:09:50.0 +0900 +@@ -293,7 +293,7 @@ + + install-pkgdataDATA: $(pkgdata_DATA) + @$(NORMAL_INSTALL) +- $(mkinstalldirs) $(pkgdatadir) ++ $(mkinstalldirs) $(DESTDIR)$(pkgdatadir) + @list='$(pkgdata_DATA)'; for adir in $$list; do \ + $(mkinstalldirs) $(DESTDIR)$(pkgdatadir)/$$adir; \ + for p in $$adir/*; do \ --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/gnome meld.info,1.2,1.3
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv2534/gnome Modified Files: meld.info Log Message: fix broken versioned dep Index: meld.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/meld.info,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- meld.info 28 Jan 2006 22:10:33 - 1.2 +++ meld.info 29 Mar 2006 22:02:03 - 1.3 @@ -28,7 +28,7 @@ Homepage: http://meld.sourceforge.net/ License: GPL Maintainer: Daniel Macks [EMAIL PROTECTED] -Depends: x11, python23(= 1:2.4.2-1004), gnome-python2-py23, pyorbit2-py23, pygtk2-py23, scrollkeeper +Depends: x11, python23(= 1:2.3.5-1124), gnome-python2-py23, pyorbit2-py23, pygtk2-py23, scrollkeeper BuildDepends: x11-dev, pygtk2-py23-dev, gettext-bin, gettext-tools, intltool Source: mirror:gnome:sources/%n/1.0/%n-%v.tar.bz2 Source-MD5: ccde817f0396d39e9e40f31a3a7611f6 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/crypto/finkinfo gnutls12.info,1.1,1.3
Update of /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5678/dists/unstable/crypto/finkinfo Modified Files: gnutls12.info Log Message: distcc-friendly Index: gnutls12.info === RCS file: /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo/gnutls12.info,v retrieving revision 1.1 retrieving revision 1.3 diff -u -d -r1.1 -r1.3 --- gnutls12.info 20 Jan 2006 20:16:56 - 1.1 +++ gnutls12.info 29 Mar 2006 22:58:34 - 1.3 @@ -17,6 +17,8 @@ #Patch: %n.patch BuildDependsOnly: True SetCPPFLAGS: -no-cpp-precomp +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 ConfigureParams: --mandir=%p/share/man --infodir=%p/share/info --disable-dependency-tracking \ --with-included-lzo --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/crypto/finkinfo gnutls12.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4-transitional/unstable/crypto/finkinfo In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5678/10.4-transitional/unstable/crypto/finkinfo Modified Files: gnutls12.info Log Message: distcc-friendly Index: gnutls12.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/crypto/finkinfo/gnutls12.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- gnutls12.info 14 Mar 2006 16:07:20 - 1.3 +++ gnutls12.info 29 Mar 2006 22:58:34 - 1.4 @@ -17,6 +17,8 @@ #Patch: %n.patch BuildDependsOnly: True SetCPPFLAGS: -no-cpp-precomp +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 ConfigureParams: --mandir=%p/share/man --infodir=%p/share/info --disable-dependency-tracking \ --with-included-lzo --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/crypto/finkinfo gnutls12.info,1.1,1.2
Update of /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5678/10.4/unstable/crypto/finkinfo Modified Files: gnutls12.info Log Message: distcc-friendly Index: gnutls12.info === RCS file: /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo/gnutls12.info,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- gnutls12.info 20 Jan 2006 20:16:56 - 1.1 +++ gnutls12.info 29 Mar 2006 22:58:34 - 1.2 @@ -17,6 +17,8 @@ #Patch: %n.patch BuildDependsOnly: True SetCPPFLAGS: -no-cpp-precomp +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 ConfigureParams: --mandir=%p/share/man --infodir=%p/share/info --disable-dependency-tracking \ --with-included-lzo --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/crypto/finkinfo gnutls12.info,1.3,1.4
Update of /cvsroot/fink/dists/10.3/unstable/crypto/finkinfo In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv5678/10.3/unstable/crypto/finkinfo Modified Files: gnutls12.info Log Message: distcc-friendly Index: gnutls12.info === RCS file: /cvsroot/fink/dists/10.3/unstable/crypto/finkinfo/gnutls12.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- gnutls12.info 14 Mar 2006 16:07:19 - 1.3 +++ gnutls12.info 29 Mar 2006 22:58:34 - 1.4 @@ -17,6 +17,8 @@ #Patch: %n.patch BuildDependsOnly: True SetCPPFLAGS: -no-cpp-precomp +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 ConfigureParams: --mandir=%p/share/man --infodir=%p/share/info --disable-dependency-tracking \ --with-included-lzo --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
fink ChangeLog,1.417,1.418 postinstall.pl.in,1.36,1.37
Update of /cvsroot/fink/fink In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv7168 Modified Files: ChangeLog postinstall.pl.in Log Message: make scanpackages run on postinstall, when it's the first time the user is running with AutoScanpackages Index: postinstall.pl.in === RCS file: /cvsroot/fink/fink/postinstall.pl.in,v retrieving revision 1.36 retrieving revision 1.37 diff -u -d -r1.36 -r1.37 --- postinstall.pl.in 3 Jan 2006 20:14:46 - 1.36 +++ postinstall.pl.in 29 Mar 2006 23:00:43 - 1.37 @@ -30,7 +30,7 @@ use lib @PREFIX@/lib/perl5; use Fink::Bootstrap qw(check_host); -use Fink::Services qw(read_config execute); +use Fink::Services qw(read_config execute apt_available); use Fink::CLI qw(print_breaking prompt_boolean); use Fink::Config qw($config); @@ -237,6 +237,26 @@ } +# If a user upgrades to a new fink with AutoScanpackages, we'd rather do the +# first (uncached, long) scan in postinst than at the end of the user's next +# build. +sub pre_scanpackages { + my $autoscan = !$config-has_param(AutoScanpackages) + || $config-param_boolean(AutoScanpackages); + return 0 unless $autoscan apt_available; + + require Fink::Scanpackages; + my $cache = Fink::Scanpackages-default_cache; + return 0 if -e $cache; # we already ran scanpackages at some point + + print STDERR Caching your binary packages...this may take a while.\n; + + # Don't use the PDB, we don't want to trigger an index now + require Fink::Engine; + Fink::Engine::scanpackages({ pdb = 0 }); + return 1; +} +pre_scanpackages(); if ($configNeedsUpdate) { print_breaking(\nThis fink version introduces new settings stored in the . Index: ChangeLog === RCS file: /cvsroot/fink/fink/ChangeLog,v retrieving revision 1.417 retrieving revision 1.418 diff -u -d -r1.417 -r1.418 --- ChangeLog 28 Mar 2006 20:01:27 - 1.417 +++ ChangeLog 29 Mar 2006 23:00:43 - 1.418 @@ -1,3 +1,9 @@ +2006-03-29 Dave Vasilevsky [EMAIL PROTECTED] + + * postinstall.pl.in: If AutoScanpackages is about to be turned on for the + first time, pre-scan the user's debs rather than surprising them at the + end of the next build. + 2006-03-28 Daniel Macks [EMAIL PROTECTED] * bootstrap.pl: FinkVersion.pm::default_binary_version now returns --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
fink/perlmod/Fink ChangeLog,1.1313,1.1314 Engine.pm,1.370,1.371 PkgVersion.pm,1.545,1.546 Scanpackages.pm,1.9,1.10
Update of /cvsroot/fink/fink/perlmod/Fink In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv7168/perlmod/Fink Modified Files: ChangeLog Engine.pm PkgVersion.pm Scanpackages.pm Log Message: make scanpackages run on postinstall, when it's the first time the user is running with AutoScanpackages Index: Scanpackages.pm === RCS file: /cvsroot/fink/fink/perlmod/Fink/Scanpackages.pm,v retrieving revision 1.9 retrieving revision 1.10 diff -u -d -r1.9 -r1.10 --- Scanpackages.pm 21 Mar 2006 21:05:35 - 1.9 +++ Scanpackages.pm 29 Mar 2006 23:00:45 - 1.10 @@ -73,6 +73,8 @@ Fink::Scanpackages-scan_dists($options, @dirs); Fink::Scanpackages-scan_fink(%options); + my $path = Fink::Scanpackages-default_cache; + =head1 METHODS =over 4 @@ -312,6 +314,22 @@ @dists); } +=item default_cache + + my $path = Fink::Scanpackages-default_cache; + +Get the path to the file that is used by default for caching result of +scan_fink. + +=cut + +sub default_cache { + my ($self) = @_; + + $self-_ensure_fink; + return $Fink::Config::basepath . /var/lib/fink/scanpackages.db; +} + # Initialize the object sub initialize { my ($self, %opts) = @_; @@ -353,15 +371,16 @@ # Make sure Fink is configured # # $sp-_ensure_fink; +# Fink::Scanpackages-_ensure_fink; sub _ensure_fink { my ($self) = @_; - unless ($self-{_fink_loaded}) { + unless (ref($self) $self-{_fink_loaded}) { require Fink::Config; # Make sure fink has a config _use_fink() unless defined $Fink::Config::config; - $self-{_fink_loaded} = 1; + $self-{_fink_loaded} = 1 if ref($self); } } Index: PkgVersion.pm === RCS file: /cvsroot/fink/fink/perlmod/Fink/PkgVersion.pm,v retrieving revision 1.545 retrieving revision 1.546 diff -u -d -r1.545 -r1.546 --- PkgVersion.pm 24 Mar 2006 23:23:32 - 1.545 +++ PkgVersion.pm 29 Mar 2006 23:00:45 - 1.546 @@ -5039,7 +5039,7 @@ if ($autoscan apt_available) { require Fink::Engine; # yuck - Fink::Engine::scanpackages(0, keys %built_trees); + Fink::Engine::scanpackages({}, [ keys %built_trees ]); Fink::Engine::aptget_update(); } %built_trees = (); Index: Engine.pm === RCS file: /cvsroot/fink/fink/perlmod/Fink/Engine.pm,v retrieving revision 1.370 retrieving revision 1.371 diff -u -d -r1.370 -r1.371 --- Engine.pm 28 Mar 2006 20:47:52 - 1.370 +++ Engine.pm 29 Mar 2006 23:00:44 - 1.371 @@ -659,33 +659,40 @@ =cut sub cmd_scanpackages { - scanpackages(0, @_); + scanpackages({}, [EMAIL PROTECTED]); aptget_update; } =item scanpackages - scanpackages $quiet, @trees; + scanpackages $opts, [EMAIL PROTECTED]; Update the apt-get package database in the given trees. =cut sub scanpackages { - my ($quiet, @treelist) = @_; + my $opts = shift || { }; + my $trees = shift || [ ]; + # Don't scan restrictive if it's unwanted + if (!exists $opts-{restrictive} +$config-has_param('ScanRestrictivePackages') +!$config-param_boolean('ScanRestrictivePackages')) { + $opts-{restrictive} = 0; + } + # Use lowest verbosity - $quiet = $config-verbosity_level if $quiet $config-verbosity_level; - print STDERR Updating the list of locally available binary packages.\n - unless $quiet 1; # very quiet! + if (!exists $opts-{verbosity}) { + my $v = $config-verbosity_level; + $v = 1 if $v 1; # Only allow 1 if given as an explicit option + $opts-{verbosity} = $v; + } + + print STDERR Updating the list of locally available binary packages.\n; # Run scanpackages - my $restrictive = !$config-has_param('ScanRestrictivePackages') - || $config-param_boolean('ScanRestrictivePackages'); - Fink::Scanpackages-scan_fink({ - verbosity = !$quiet, - restrictive = $restrictive - }, @treelist); + Fink::Scanpackages-scan_fink($opts, @$trees); } ### package-related commands @@ -1275,7 +1282,7 @@ print Skipping scanpackages and in dryrun mode\n; } else { if (apt_available) { - scanpackages(1); + scanpackages({ verbosity = 0 }); aptget_update(1); } } Index:
dists/10.3/unstable/main/finkinfo/libs libusb.info,1.13,1.14
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.3/unstable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs/libusb.info,v retrieving revision 1.13 retrieving revision 1.14 diff -u -d -r1.13 -r1.14 --- libusb.info 21 Mar 2006 04:06:33 - 1.13 +++ libusb.info 29 Mar 2006 23:08:27 - 1.14 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 3.3 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh -e # cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/stable/main/finkinfo/libs libusb.info,1.2,1.3
Update of /cvsroot/fink/dists/10.3/stable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.3/stable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.3/stable/main/finkinfo/libs/libusb.info,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- libusb.info 26 May 2005 02:34:50 - 1.2 +++ libusb.info 29 Mar 2006 23:08:27 - 1.3 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 3.3 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/stable/main/finkinfo/libs libusb.info,1.2,1.3
Update of /cvsroot/fink/dists/10.4-transitional/stable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.4-transitional/stable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.4-transitional/stable/main/finkinfo/libs/libusb.info,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- libusb.info 26 May 2005 02:32:10 - 1.2 +++ libusb.info 29 Mar 2006 23:08:27 - 1.3 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 3.3 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/libs libusb.info,1.6,1.7
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.4-transitional/unstable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs/libusb.info,v retrieving revision 1.6 retrieving revision 1.7 diff -u -d -r1.6 -r1.7 --- libusb.info 19 Mar 2006 05:55:58 - 1.6 +++ libusb.info 29 Mar 2006 23:08:27 - 1.7 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 3.3 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh -e # cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/stable/main/finkinfo/libs libusb.info,1.1,1.2
Update of /cvsroot/fink/dists/10.4/stable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.4/stable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.4/stable/main/finkinfo/libs/libusb.info,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- libusb.info 27 Jan 2006 18:30:37 - 1.1 +++ libusb.info 29 Mar 2006 23:08:27 - 1.2 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 4.0 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/libs libusb.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv11821/10.4/unstable/main/finkinfo/libs Modified Files: libusb.info Log Message: distcc-friendly Index: libusb.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs/libusb.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- libusb.info 21 Mar 2006 04:06:34 - 1.3 +++ libusb.info 29 Mar 2006 23:08:27 - 1.4 @@ -9,6 +9,8 @@ Depends: %N-shlibs (= %v-%r) GCC: 4.0 SetLDFLAGS: -Wl,-framework -Wl,CoreFoundation -Wl,-framework -Wl,IOKit +NoSetMAKEFLAGS: true +SetMAKEFLAGS: -j1 CompileScript: #!/bin/sh -e # cp %p/share/libtool/ltmain.sh . --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/gnome gcalctool.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv28580/10.4/unstable/main/finkinfo/gnome Modified Files: gcalctool.info Log Message: new version Index: gcalctool.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/gcalctool.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- gcalctool.info 20 Feb 2006 22:06:55 - 1.4 +++ gcalctool.info 29 Mar 2006 23:35:36 - 1.5 @@ -1,10 +1,10 @@ Package: gcalctool -Version: 5.7.29 +Version: 5.7.32 Revision: 1001 Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), libgettext3-shlibs, glib2 (= 2.6.6-), gnome-vfs2-ssl (= 2.6.0-1) | gnome-vfs2 (= 2.6.0-1), gtk+2 (= 2.4.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libgnomeui2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, scrollkeeper, x11, gnome-keyring-shlibs, libjpeg-shlibs BuildDepends: audiofile, glib2-dev (= 2.6.6-), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.4.0-1), libjpeg, libgnomecanvas2-dev (= 2.6.0-1), orbit2-dev (= 2.10.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.6.0-1) | gnome-vfs2-dev (= 2.6.0-1), libxml2 (= 2.6.7-1), libbonobo2-dev (= 2.6.0-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), libgnomeui2-dev (= 2.6.0-1), pkgconfig, intltool, popt, libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, libart2 (= 2.3.16-1), scrollkeeper (= 0.3.12-2), esound (= 0.2.34-1), gnome-keyring-dev (= 0.4.3-1), x11-dev Source: mirror:gnome:sources/%n/5.7/%n-%v.tar.bz2 -Source-MD5: f9d4cb8177abfbd17e53908bad65404e +Source-MD5: c0712ee651c74104cdcc3205f4c57881 Patch: %n.patch PatchScript: perl -pi.bak -e s/-scrollkeeper-update/#-scrollkeeper-update/g help/*/Makefile.in SetCPPFLAGS: -no-cpp-precomp @@ -27,9 +27,6 @@ DocFiles: AUTHORS COPYING ChangeLog* po/ChangeLog:ChangeLog.po MAINTAINERS NEWS README TODO Description: GNOME calculator widget DescPort: - Remember to ranlib the .a archive before trying to link against it. - See: http://bugzilla.gnome.org/show_bug.cgi?id=314540 - No --disable-scrollkeeper support. See: http://bugzilla.gnome.org/show_bug.cgi?id=323949 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/gnome gcalctool.info,1.17,1.18
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv28580/10.3/unstable/main/finkinfo/gnome Modified Files: gcalctool.info Log Message: new version Index: gcalctool.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome/gcalctool.info,v retrieving revision 1.17 retrieving revision 1.18 diff -u -d -r1.17 -r1.18 --- gcalctool.info 20 Feb 2006 22:06:54 - 1.17 +++ gcalctool.info 29 Mar 2006 23:35:36 - 1.18 @@ -1,10 +1,10 @@ Package: gcalctool -Version: 5.7.29 +Version: 5.7.32 Revision: 1 Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.6.0-1) | gnome-vfs2 (= 2.6.0-1), gtk+2 (= 2.4.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libgnomeui2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, scrollkeeper, x11, gnome-keyring-shlibs, libjpeg-shlibs BuildDepends: audiofile, glib2-dev (= 2.4.0-1), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.4.0-1), libjpeg, libgnomecanvas2-dev (= 2.6.0-1), orbit2-dev (= 2.10.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.6.0-1) | gnome-vfs2-dev (= 2.6.0-1), libxml2 (= 2.6.7-1), libbonobo2-dev (= 2.6.0-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), libgnomeui2-dev (= 2.6.0-1), pkgconfig, intltool, popt, libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, libart2 (= 2.3.16-1), scrollkeeper (= 0.3.12-2), esound (= 0.2.34-1), gnome-keyring-dev (= 0.4.3-1), x11-dev Source: mirror:gnome:sources/%n/5.7/%n-%v.tar.bz2 -Source-MD5: f9d4cb8177abfbd17e53908bad65404e +Source-MD5: c0712ee651c74104cdcc3205f4c57881 Patch: %n.patch PatchScript: perl -pi.bak -e s/-scrollkeeper-update/#-scrollkeeper-update/g help/*/Makefile.in SetCPPFLAGS: -no-cpp-precomp @@ -27,9 +27,6 @@ DocFiles: AUTHORS COPYING ChangeLog* po/ChangeLog:ChangeLog.po MAINTAINERS NEWS README TODO Description: GNOME calculator widget DescPort: - Remember to ranlib the .a archive before trying to link against it. - See: http://bugzilla.gnome.org/show_bug.cgi?id=314540 - No --disable-scrollkeeper support. See: http://bugzilla.gnome.org/show_bug.cgi?id=323949 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/gnome gcalctool.info,1.11,1.12
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv28580/10.4-transitional/unstable/main/finkinfo/gnome Modified Files: gcalctool.info Log Message: new version Index: gcalctool.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome/gcalctool.info,v retrieving revision 1.11 retrieving revision 1.12 diff -u -d -r1.11 -r1.12 --- gcalctool.info 20 Feb 2006 22:06:55 - 1.11 +++ gcalctool.info 29 Mar 2006 23:35:36 - 1.12 @@ -1,10 +1,10 @@ Package: gcalctool -Version: 5.7.29 +Version: 5.7.32 Revision: 1 Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.6.0-1) | gnome-vfs2 (= 2.6.0-1), gtk+2 (= 2.4.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libgnomeui2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, scrollkeeper, x11, gnome-keyring-shlibs, libjpeg-shlibs BuildDepends: audiofile, glib2-dev (= 2.4.0-1), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.4.0-1), libjpeg, libgnomecanvas2-dev (= 2.6.0-1), orbit2-dev (= 2.10.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.6.0-1) | gnome-vfs2-dev (= 2.6.0-1), libxml2 (= 2.6.7-1), libbonobo2-dev (= 2.6.0-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), libgnomeui2-dev (= 2.6.0-1), pkgconfig, intltool, popt, libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, libart2 (= 2.3.16-1), scrollkeeper (= 0.3.12-2), esound (= 0.2.34-1), gnome-keyring-dev (= 0.4.3-1), x11-dev Source: mirror:gnome:sources/%n/5.7/%n-%v.tar.bz2 -Source-MD5: f9d4cb8177abfbd17e53908bad65404e +Source-MD5: c0712ee651c74104cdcc3205f4c57881 Patch: %n.patch PatchScript: perl -pi.bak -e s/-scrollkeeper-update/#-scrollkeeper-update/g help/*/Makefile.in SetCPPFLAGS: -no-cpp-precomp @@ -27,9 +27,6 @@ DocFiles: AUTHORS COPYING ChangeLog* po/ChangeLog:ChangeLog.po MAINTAINERS NEWS README TODO Description: GNOME calculator widget DescPort: - Remember to ranlib the .a archive before trying to link against it. - See: http://bugzilla.gnome.org/show_bug.cgi?id=314540 - No --disable-scrollkeeper support. See: http://bugzilla.gnome.org/show_bug.cgi?id=323949 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/libs/perlmods glib-pm.info,1.5,1.6
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv10398/10.3/unstable/main/finkinfo/libs/perlmods Modified Files: glib-pm.info Log Message: new verison (okayed w/maintainer) Index: glib-pm.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs/perlmods/glib-pm.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- glib-pm.info10 Mar 2006 05:12:26 - 1.5 +++ glib-pm.info29 Mar 2006 23:57:10 - 1.6 @@ -1,6 +1,6 @@ Info2: Package: glib-pm%type_pkg[perl] -Version: 1.105 +Version: 1.120 Revision: 1 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -19,7 +19,7 @@ Replaces: glib-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Glib-%v.tar.gz -Source-MD5: b3ab8094fb83d0931e4042f2f6704342 +Source-MD5: 639d22451339e07844e6be3b5e345959 ### # cannot be used with perl 5.8.0 Type: perl (5.8.1 5.8.6) --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods glib-pm.info,1.5,1.6
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv10398/10.4-transitional/unstable/main/finkinfo/libs/perlmods Modified Files: glib-pm.info Log Message: new verison (okayed w/maintainer) Index: glib-pm.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods/glib-pm.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- glib-pm.info10 Mar 2006 05:12:27 - 1.5 +++ glib-pm.info29 Mar 2006 23:57:12 - 1.6 @@ -1,6 +1,6 @@ Info2: Package: glib-pm%type_pkg[perl] -Version: 1.105 +Version: 1.120 Revision: 1 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -19,7 +19,7 @@ Replaces: glib-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Glib-%v.tar.gz -Source-MD5: b3ab8094fb83d0931e4042f2f6704342 +Source-MD5: 639d22451339e07844e6be3b5e345959 ### # cannot be used with perl 5.8.0 Type: perl (5.8.1 5.8.6) --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/libs/perlmods glib-pm.info,1.5,1.6
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv10398/10.4/unstable/main/finkinfo/libs/perlmods Modified Files: glib-pm.info Log Message: new verison (okayed w/maintainer) Index: glib-pm.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs/perlmods/glib-pm.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- glib-pm.info10 Mar 2006 05:12:27 - 1.5 +++ glib-pm.info29 Mar 2006 23:57:12 - 1.6 @@ -1,6 +1,6 @@ Info2: Package: glib-pm%type_pkg[perl] -Version: 1.105 +Version: 1.120 Revision: 1001 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -19,7 +19,7 @@ Replaces: glib-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Glib-%v.tar.gz -Source-MD5: b3ab8094fb83d0931e4042f2f6704342 +Source-MD5: 639d22451339e07844e6be3b5e345959 ### # cannot be used with perl 5.8.0 Type: perl (5.8.1 5.8.6) --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/crypto/finkinfo firefox.info,1.2,1.3 mozilla.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv12452/10.4/unstable/crypto/finkinfo Modified Files: firefox.info mozilla.info Log Message: No ffox or moz on intel at this time:( Index: firefox.info === RCS file: /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo/firefox.info,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- firefox.info15 Mar 2006 07:21:23 - 1.2 +++ firefox.info30 Mar 2006 00:00:23 - 1.3 @@ -1,6 +1,7 @@ Package: firefox Version: 1.0.7 Revision: 1008 +Architecture: powerpc Description: Lightweight browser from mozilla.org License: OSI-Approved Maintainer: Hanspeter Niederstrasser [EMAIL PROTECTED] @@ -149,4 +150,7 @@ ac_add_options --enable-macos-target=10.3 in patch file (.mozconfig) is for the minimum OS version that this will compile in. + +Not functional on intel. See: +https://sourceforge.net/tracker/index.php?func=detailaid=1459616group_id=17203atid=117203 Index: mozilla.info === RCS file: /cvsroot/fink/dists/10.4/unstable/crypto/finkinfo/mozilla.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- mozilla.info3 Feb 2006 16:41:49 - 1.4 +++ mozilla.info30 Mar 2006 00:00:24 - 1.5 @@ -1,6 +1,7 @@ Package: mozilla Version: 1.7.5 Revision: 1106 +Architecture: powerpc GCC: 4.0 Source: mirror:custom:mozilla/releases/%n%v/source/%n-source-%v.tar.bz2 Source-MD5: e5994f3e801cd834966367c6a12f8aeb @@ -332,6 +333,9 @@ - uses gtk+2 toolkit. - pass exact install directory to the linker - forces to see local ldap headers. + +Not functional on intel. See: +https://sourceforge.net/tracker/index.php?func=detailaid=1459616group_id=17203atid=117203 License: OSI-Approved Maintainer: None fink-devel@lists.sourceforge.net --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/libs/perlmods gtk2-pm.info,1.4,1.5
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv15150/10.3/unstable/main/finkinfo/libs/perlmods Modified Files: gtk2-pm.info Log Message: new version (okayed with maintainer) Index: gtk2-pm.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/libs/perlmods/gtk2-pm.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- gtk2-pm.info17 Feb 2006 01:41:12 - 1.4 +++ gtk2-pm.info30 Mar 2006 00:47:04 - 1.5 @@ -1,6 +1,6 @@ Info2: Package: gtk2-pm%type_pkg[perl] -Version: 1.104 +Version: 1.120 Revision: 1 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -23,7 +23,7 @@ Replaces: gtk2-perl-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Gtk2-%v.tar.gz -Source-MD5: 89bb024113a12f233094dd32ac0be462 +Source-MD5: 3d0eef4271bd624b284f9a23f4bdbb96 ### Type: perl (5.8.1 5.8.6) UpdatePOD: true --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/libs/perlmods gtk2-pm.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv15150/10.4/unstable/main/finkinfo/libs/perlmods Modified Files: gtk2-pm.info Log Message: new version (okayed with maintainer) Index: gtk2-pm.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/libs/perlmods/gtk2-pm.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- gtk2-pm.info17 Feb 2006 01:39:16 - 1.4 +++ gtk2-pm.info30 Mar 2006 00:47:05 - 1.5 @@ -1,6 +1,6 @@ Info2: Package: gtk2-pm%type_pkg[perl] -Version: 1.104 +Version: 1.120 Revision: 1001 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -23,7 +23,7 @@ Replaces: gtk2-perl-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Gtk2-%v.tar.gz -Source-MD5: 89bb024113a12f233094dd32ac0be462 +Source-MD5: 3d0eef4271bd624b284f9a23f4bdbb96 ### Type: perl (5.8.1 5.8.6) UpdatePOD: true --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods gtk2-pm.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv15150/10.4-transitional/unstable/main/finkinfo/libs/perlmods Modified Files: gtk2-pm.info Log Message: new version (okayed with maintainer) Index: gtk2-pm.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/libs/perlmods/gtk2-pm.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- gtk2-pm.info17 Feb 2006 01:40:19 - 1.4 +++ gtk2-pm.info30 Mar 2006 00:47:04 - 1.5 @@ -1,6 +1,6 @@ Info2: Package: gtk2-pm%type_pkg[perl] -Version: 1.104 +Version: 1.120 Revision: 1 Architecture: (%type_pkg[perl] = 581) powerpc, (%type_pkg[perl] = 584) powerpc ### @@ -23,7 +23,7 @@ Replaces: gtk2-perl-pm ### Source: mirror:cpan:authors/id/T/TS/TSCH/Gtk2-%v.tar.gz -Source-MD5: 89bb024113a12f233094dd32ac0be462 +Source-MD5: 3d0eef4271bd624b284f9a23f4bdbb96 ### Type: perl (5.8.1 5.8.6) UpdatePOD: true --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/gnome libgnomeui2.info,1.4,1.5
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv31396/gnome Modified Files: libgnomeui2.info Log Message: put libgnome.so in shlibs Index: libgnomeui2.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/libgnomeui2.info,v retrieving revision 1.4 retrieving revision 1.5 diff -u -d -r1.4 -r1.5 --- libgnomeui2.info7 Feb 2006 17:46:14 - 1.4 +++ libgnomeui2.info30 Mar 2006 00:22:05 - 1.5 @@ -1,6 +1,6 @@ Package: libgnomeui2 Version: 2.12.1 -Revision: 1001 +Revision: 1002 Depends: %N-shlibs (= %v-%r), atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-bin (= 0.2.34-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.6.6-), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs Conflicts: gnome-libs ( 1.4.1.6) BuildDepends: glib2-dev (= 2.6.6-), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.6.0-1), gtk+2 (= 2.6.0-1), orbit2-dev (= 2.10.0-1), libxml2 (= 2.6.7-1), libglade2 (= 2.3.6-1), libbonobo2-dev (= 2.6.0-1), libart2 (= 2.3.16-1), libgnomecanvas2-dev (= 2.6.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.7.3-1) | gnome-vfs2-dev (= 2.7.3-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), esound (= 0.2.34), audiofile (= 0.2.5), pkgconfig, gtk-doc (= 1.2-1), popt, gnome-keyring-dev (= 0.4.3-1), libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, x11-dev, libjpeg @@ -25,7 +25,7 @@ SplitOff: Package: %N-shlibs Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.6.6-), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs, x11 - Files: lib/libgnomeui-2.*.dylib + Files: lib/libgnomeui-2.*.dylib lib/libglade/2.0/libgnome.so Shlibs: %p/lib/libgnomeui-2.0.dylib 1201.0.0 %n (= 2.12.0-1) RunTimeVars: GNOME_DISABLE_CRASH_DIALOG: 1 DocFiles: AUTHORS COPYING* ChangeLog libgnomeui/ChangeLog:ChangeLog.libgnomeui po/ChangeLog:ChangeLog.po NEWS README --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/games wesnoth.info,1.8,1.9
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv19767/10.3/unstable/main/finkinfo/games Modified Files: wesnoth.info Log Message: dep-fix (more to come!) Index: wesnoth.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/games/wesnoth.info,v retrieving revision 1.8 retrieving revision 1.9 diff -u -d -r1.8 -r1.9 --- wesnoth.info17 Jul 2005 09:30:49 - 1.8 +++ wesnoth.info30 Mar 2006 00:54:40 - 1.9 @@ -1,11 +1,11 @@ Package: wesnoth Version: 0.8.8 -Revision: 1 +Revision: 2 GCC: 3.3 Source-MD5: 54a580a721ea19b8006cedb2766fe6ba Source: http://www.wesnoth.org/files/%n-%v.tar.gz -BuildDepends: sdl, sdl-mixer, sdl-image, sdl-ttf, sdl-net -Depends: sdl-mixer-shlibs, sdl-shlibs, sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs +BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net +Depends: sdl-mixer-shlibs, sdl-shlibs (= 1.2.7-1), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs Description: Fantasy turn-based strategy game DescDetail: Battle for Wesnoth is a fantasy turn-based strategy game. --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/games wesnoth.info,1.2,1.3
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv19767/10.4-transitional/unstable/main/finkinfo/games Modified Files: wesnoth.info Log Message: dep-fix (more to come!) Index: wesnoth.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/games/wesnoth.info,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- wesnoth.info22 Jun 2005 12:23:12 - 1.2 +++ wesnoth.info30 Mar 2006 00:54:40 - 1.3 @@ -1,11 +1,11 @@ Package: wesnoth Version: 0.8.8 -Revision: 1 +Revision: 2 GCC: 3.3 Source-MD5: 54a580a721ea19b8006cedb2766fe6ba Source: http://www.wesnoth.org/files/%n-%v.tar.gz -BuildDepends: sdl, sdl-mixer, sdl-image, sdl-ttf, sdl-net -Depends: sdl-mixer-shlibs, sdl-shlibs, sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs +BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net +Depends: sdl-mixer-shlibs, sdl-shlibs (= 1.2.7-1), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs Description: Fantasy turn-based strategy game DescDetail: Battle for Wesnoth is a fantasy turn-based strategy game. --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/gnome libgnomeui2.info,1.12,1.13
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv18000/10.4-transitional/unstable/main/finkinfo/gnome Modified Files: libgnomeui2.info Log Message: Move libgnome.so %N-%N-shlibs, remembering to Replaces for clean upgrade Index: libgnomeui2.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome/libgnomeui2.info,v retrieving revision 1.12 retrieving revision 1.13 diff -u -d -r1.12 -r1.13 --- libgnomeui2.info7 Feb 2006 17:46:14 - 1.12 +++ libgnomeui2.info30 Mar 2006 01:49:18 - 1.13 @@ -1,6 +1,6 @@ Package: libgnomeui2 Version: 2.12.1 -Revision: 1 +Revision: 2 Depends: %N-shlibs (= %v-%r), atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-bin (= 0.2.34-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs Conflicts: gnome-libs ( 1.4.1.6) BuildDepends: glib2-dev (= 2.4.0-1), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.6.0-1), gtk+2 (= 2.6.0-1), orbit2-dev (= 2.10.0-1), libxml2 (= 2.6.7-1), libglade2 (= 2.3.6-1), libbonobo2-dev (= 2.6.0-1), libart2 (= 2.3.16-1), libgnomecanvas2-dev (= 2.6.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.7.3-1) | gnome-vfs2-dev (= 2.7.3-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), esound (= 0.2.34), audiofile (= 0.2.5), pkgconfig, gtk-doc (= 1.2-1), popt, gnome-keyring-dev (= 0.4.3-1), libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, x11-dev, libjpeg @@ -25,7 +25,8 @@ SplitOff: Package: %N-shlibs Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs, x11 - Files: lib/libgnomeui-2.*.dylib + Replaces: %N ( 2.12.1-2) + Files: lib/libgnomeui-2.*.dylib lib/libglade/2.0/libgnome.so Shlibs: %p/lib/libgnomeui-2.0.dylib 1201.0.0 %n (= 2.12.0-1) RunTimeVars: GNOME_DISABLE_CRASH_DIALOG: 1 DocFiles: AUTHORS COPYING* ChangeLog libgnomeui/ChangeLog:ChangeLog.libgnomeui po/ChangeLog:ChangeLog.po NEWS README --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/gnome libgnomeui2.info,1.5,1.6
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv18000/10.4/unstable/main/finkinfo/gnome Modified Files: libgnomeui2.info Log Message: Move libgnome.so %N-%N-shlibs, remembering to Replaces for clean upgrade Index: libgnomeui2.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/libgnomeui2.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- libgnomeui2.info30 Mar 2006 00:22:05 - 1.5 +++ libgnomeui2.info30 Mar 2006 01:49:18 - 1.6 @@ -1,6 +1,6 @@ Package: libgnomeui2 Version: 2.12.1 -Revision: 1002 +Revision: 1003 Depends: %N-shlibs (= %v-%r), atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-bin (= 0.2.34-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.6.6-), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs Conflicts: gnome-libs ( 1.4.1.6) BuildDepends: glib2-dev (= 2.6.6-), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.6.0-1), gtk+2 (= 2.6.0-1), orbit2-dev (= 2.10.0-1), libxml2 (= 2.6.7-1), libglade2 (= 2.3.6-1), libbonobo2-dev (= 2.6.0-1), libart2 (= 2.3.16-1), libgnomecanvas2-dev (= 2.6.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.7.3-1) | gnome-vfs2-dev (= 2.7.3-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), esound (= 0.2.34), audiofile (= 0.2.5), pkgconfig, gtk-doc (= 1.2-1), popt, gnome-keyring-dev (= 0.4.3-1), libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, x11-dev, libjpeg @@ -25,6 +25,7 @@ SplitOff: Package: %N-shlibs Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.6.6-), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs, x11 + Replaces: %N ( 2.12.1-1002) Files: lib/libgnomeui-2.*.dylib lib/libglade/2.0/libgnome.so Shlibs: %p/lib/libgnomeui-2.0.dylib 1201.0.0 %n (= 2.12.0-1) RunTimeVars: GNOME_DISABLE_CRASH_DIALOG: 1 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/gnome libgnomeui2.info,1.20,1.21
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv18000/10.3/unstable/main/finkinfo/gnome Modified Files: libgnomeui2.info Log Message: Move libgnome.so %N-%N-shlibs, remembering to Replaces for clean upgrade Index: libgnomeui2.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome/libgnomeui2.info,v retrieving revision 1.20 retrieving revision 1.21 diff -u -d -r1.20 -r1.21 --- libgnomeui2.info7 Feb 2006 17:46:13 - 1.20 +++ libgnomeui2.info30 Mar 2006 01:49:17 - 1.21 @@ -1,6 +1,6 @@ Package: libgnomeui2 Version: 2.12.1 -Revision: 1 +Revision: 2 Depends: %N-shlibs (= %v-%r), atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-bin (= 0.2.34-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs Conflicts: gnome-libs ( 1.4.1.6) BuildDepends: glib2-dev (= 2.4.0-1), atk1 (= 1.6.0-1), pango1-xft2-dev (= 1.4.0-1), gtk+2-dev (= 2.6.0-1), gtk+2 (= 2.6.0-1), orbit2-dev (= 2.10.0-1), libxml2 (= 2.6.7-1), libglade2 (= 2.3.6-1), libbonobo2-dev (= 2.6.0-1), libart2 (= 2.3.16-1), libgnomecanvas2-dev (= 2.6.0-1), gconf2-dev (= 2.6.0-1), gnome-vfs2-ssl-dev (= 2.7.3-1) | gnome-vfs2-dev (= 2.7.3-1), libgnome2-dev (= 2.6.0-1), libbonoboui2-dev (= 2.6.0-1), esound (= 0.2.34), audiofile (= 0.2.5), pkgconfig, gtk-doc (= 1.2-1), popt, gnome-keyring-dev (= 0.4.3-1), libgettext3-dev, gettext-bin, gettext-tools, libiconv-dev, x11-dev, libjpeg @@ -25,7 +25,8 @@ SplitOff: Package: %N-shlibs Depends: atk1-shlibs (= 1.6.0-1), audiofile-shlibs (= 0.2.5-1), esound-shlibs (= 0.2.34-1), gconf2 (= 2.6.0-1), gnome-keyring, libgettext3-shlibs, glib2 (= 2.4.0-1), gnome-vfs2-ssl (= 2.7.3-1) | gnome-vfs2 (= 2.7.3-1), gtk+2 (= 2.6.0-1), libart2-shlibs (= 2.3.16-1), libbonobo2 (= 2.6.0-1), libbonoboui2 (= 2.6.0-1), libglade2-shlibs (= 2.3.6-1), libgnome2 (= 2.6.0-1), libgnomecanvas2 (= 2.6.0-1), libiconv, libxml2-shlibs (= 2.6.7-1), orbit2 (= 2.10.0-1), pango1-xft2 (= 1.4.0-1), popt-shlibs, libjpeg-shlibs, x11 - Files: lib/libgnomeui-2.*.dylib + Replaces: %N ( 2.12.1-2) + Files: lib/libgnomeui-2.*.dylib lib/libglade/2.0/libgnome.so Shlibs: %p/lib/libgnomeui-2.0.dylib 1201.0.0 %n (= 2.12.0-1) RunTimeVars: GNOME_DISABLE_CRASH_DIALOG: 1 DocFiles: AUTHORS COPYING* ChangeLog libgnomeui/ChangeLog:ChangeLog.libgnomeui po/ChangeLog:ChangeLog.po NEWS README --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/games wesnoth.patch,NONE,1.1 wesnoth.info,1.1,1.2
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv31832 Modified Files: wesnoth.info Added Files: wesnoth.patch Log Message: Fix dependencies and building on headless machines --- NEW FILE: wesnoth.patch --- diff -Nurd -x'*~' wesnoth-0.8.8.orig/configure wesnoth-0.8.8/configure --- wesnoth-0.8.8.orig/configure2004-12-05 05:53:41.0 -0500 +++ wesnoth-0.8.8/configure 2006-03-29 20:38:30.0 -0500 @@ -13497,10 +13497,7 @@ # -if test -n $LDPREFIX -a -r /usr/lib/libSDL.la -then SDL_LIBS=/usr/lib/libSDL.la -else SDL_LIBS=`$SDL_CONFIG --libs` -fi +SDL_LIBS=`$SDL_CONFIG --libs` OLD_LIBS=$LIBS LIBS=$LIBS $SDL_LIBS @@ -13573,10 +13570,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_image_IMG_Load 5 echo ${ECHO_T}$ac_cv_lib_SDL_image_IMG_Load 6 if test $ac_cv_lib_SDL_image_IMG_Load = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_image.la -then SDL_IMAGE_LIBS=/usr/lib/libSDL_image.la -else SDL_IMAGE_LIBS=-lSDL_image -fi +SDL_IMAGE_LIBS=-lSDL_image else { { echo $as_me:$LINENO: error: *** SDL_image lib not found! Get SDL_image from http://www.libsdl.org/projects/SDL_image/index.html; 5 @@ -13650,10 +13644,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_mixer_Mix_OpenAudio 5 echo ${ECHO_T}$ac_cv_lib_SDL_mixer_Mix_OpenAudio 6 if test $ac_cv_lib_SDL_mixer_Mix_OpenAudio = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_mixer.la -then SDL_MIXER_LIBS=/usr/lib/libSDL_mixer.la -else SDL_MIXER_LIBS=-lSDL_mixer -fi +SDL_MIXER_LIBS=-lSDL_mixer else { { echo $as_me:$LINENO: error: *** SDL_mixer lib not found! Get SDL_mixer from http://www.libsdl.org/projects/SDL_mixer/index.html; 5 @@ -13727,10 +13718,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_net_SDLNet_Init 5 echo ${ECHO_T}$ac_cv_lib_SDL_net_SDLNet_Init 6 if test $ac_cv_lib_SDL_net_SDLNet_Init = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_net.la -then SDL_NET_LIBS=/usr/lib/libSDL_net.la -else SDL_NET_LIBS=-lSDL_net -fi +SDL_NET_LIBS=-lSDL_net else { { echo $as_me:$LINENO: error: *** SDL_net lib not found! Get SDL_net from http://www.libsdl.org/projects/SDL_net/index.html; 5 @@ -13742,10 +13730,7 @@ #AC_CHECK_LIB([SDL_ttf], # [TTF_OpenFont], -# [if test -n $LDPREFIX -a -r /usr/lib/libSDL_ttf.la -#then SDL_TTF_LIBS=/usr/lib/libSDL_ttf.la -#else SDL_TTF_LIBS=-lSDL_ttf -#fi], +# [SDL_TTF_LIBS=-lSDL_ttf], # [AC_MSG_ERROR([*** SDL_ttf lib not found! Get SDL_ttf from #http://www.libsdl.org/projects/SDL_ttf/index.html])]) @@ -16176,12 +16161,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else @@ -16257,12 +16237,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else Index: wesnoth.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/games/wesnoth.info,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- wesnoth.info16 Feb 2006 15:26:24 - 1.1 +++ wesnoth.info30 Mar 2006 02:13:02 - 1.2 @@ -1,11 +1,21 @@ Package: wesnoth Version: 0.8.8 -Revision: 1001 +Revision: 1002 GCC: 4.0 Source-MD5: 54a580a721ea19b8006cedb2766fe6ba Source: http://www.wesnoth.org/files/%n-%v.tar.gz -BuildDepends: sdl (= 1.2.9-1001), sdl-mixer (= 1.2.6-1012), sdl-image, sdl-ttf, sdl-net -Depends: sdl-mixer-shlibs (= 1.2.6-1012), sdl-shlibs (= 1.2.9-1001), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs +BuildDepends: sdl (= 1.2.9-1001), sdl-mixer (= 1.2.6-1012), sdl-image, sdl-ttf, sdl-net, libgettext3-dev, gettext-tools, libiconv-dev, x11-dev, libpng3 +Depends: sdl-shlibs (= 1.2.9-1001), sdl-mixer-shlibs (= 1.2.6-1012), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs, libgettext3-shlibs, libiconv, x11, libpng3-shlibs +Patch: %n.patch +ConfigureParams: --mandir=%p/share/man --disable-dependency-tracking --disable-sdltest +InstallScript: make install DESTDIR=%d +DescPackaging: + dmacks: Make sure we don't see any system libSDL* that may exist and + don't try tests that require Aqua GUI (via running SDL programs) + + gnome and kde aren't enabled; the results of the checks for them + aren't used, so don't care if they fail...no need for dependencies + Description:
dists/10.4-transitional/unstable/main/finkinfo/games wesnoth.patch,NONE,1.1 wesnoth.info,1.3,1.4
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv2099/10.4-transitional/unstable/main/finkinfo/games Modified Files: wesnoth.info Added Files: wesnoth.patch Log Message: backport dep-fixes and headless-build tweak --- NEW FILE: wesnoth.patch --- diff -Nurd -x'*~' wesnoth-0.8.8.orig/configure wesnoth-0.8.8/configure --- wesnoth-0.8.8.orig/configure2004-12-05 05:53:41.0 -0500 +++ wesnoth-0.8.8/configure 2006-03-29 20:38:30.0 -0500 @@ -13497,10 +13497,7 @@ # -if test -n $LDPREFIX -a -r /usr/lib/libSDL.la -then SDL_LIBS=/usr/lib/libSDL.la -else SDL_LIBS=`$SDL_CONFIG --libs` -fi +SDL_LIBS=`$SDL_CONFIG --libs` OLD_LIBS=$LIBS LIBS=$LIBS $SDL_LIBS @@ -13573,10 +13570,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_image_IMG_Load 5 echo ${ECHO_T}$ac_cv_lib_SDL_image_IMG_Load 6 if test $ac_cv_lib_SDL_image_IMG_Load = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_image.la -then SDL_IMAGE_LIBS=/usr/lib/libSDL_image.la -else SDL_IMAGE_LIBS=-lSDL_image -fi +SDL_IMAGE_LIBS=-lSDL_image else { { echo $as_me:$LINENO: error: *** SDL_image lib not found! Get SDL_image from http://www.libsdl.org/projects/SDL_image/index.html; 5 @@ -13650,10 +13644,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_mixer_Mix_OpenAudio 5 echo ${ECHO_T}$ac_cv_lib_SDL_mixer_Mix_OpenAudio 6 if test $ac_cv_lib_SDL_mixer_Mix_OpenAudio = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_mixer.la -then SDL_MIXER_LIBS=/usr/lib/libSDL_mixer.la -else SDL_MIXER_LIBS=-lSDL_mixer -fi +SDL_MIXER_LIBS=-lSDL_mixer else { { echo $as_me:$LINENO: error: *** SDL_mixer lib not found! Get SDL_mixer from http://www.libsdl.org/projects/SDL_mixer/index.html; 5 @@ -13727,10 +13718,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_net_SDLNet_Init 5 echo ${ECHO_T}$ac_cv_lib_SDL_net_SDLNet_Init 6 if test $ac_cv_lib_SDL_net_SDLNet_Init = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_net.la -then SDL_NET_LIBS=/usr/lib/libSDL_net.la -else SDL_NET_LIBS=-lSDL_net -fi +SDL_NET_LIBS=-lSDL_net else { { echo $as_me:$LINENO: error: *** SDL_net lib not found! Get SDL_net from http://www.libsdl.org/projects/SDL_net/index.html; 5 @@ -13742,10 +13730,7 @@ #AC_CHECK_LIB([SDL_ttf], # [TTF_OpenFont], -# [if test -n $LDPREFIX -a -r /usr/lib/libSDL_ttf.la -#then SDL_TTF_LIBS=/usr/lib/libSDL_ttf.la -#else SDL_TTF_LIBS=-lSDL_ttf -#fi], +# [SDL_TTF_LIBS=-lSDL_ttf], # [AC_MSG_ERROR([*** SDL_ttf lib not found! Get SDL_ttf from #http://www.libsdl.org/projects/SDL_ttf/index.html])]) @@ -16176,12 +16161,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else @@ -16257,12 +16237,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else Index: wesnoth.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/games/wesnoth.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- wesnoth.info30 Mar 2006 00:54:40 - 1.3 +++ wesnoth.info30 Mar 2006 02:17:33 - 1.4 @@ -1,11 +1,21 @@ Package: wesnoth Version: 0.8.8 -Revision: 2 +Revision: 3 GCC: 3.3 Source-MD5: 54a580a721ea19b8006cedb2766fe6ba Source: http://www.wesnoth.org/files/%n-%v.tar.gz -BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net -Depends: sdl-mixer-shlibs, sdl-shlibs (= 1.2.7-1), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs +BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net, libgettext3-dev, gettext-tools, libiconv-dev, x11-dev, libpng3 +Depends: sdl-shlibs (= 1.2.7-1), sdl-mixer-shlibs, sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs, libgettext3-shlibs, libiconv, x11, libpng3-shlibs +Patch: %n.patch +ConfigureParams: --mandir=%p/share/man --disable-dependency-tracking --disable-sdltest +InstallScript: make install DESTDIR=%d +DescPackaging: + dmacks: Make sure we don't see any system libSDL* that may exist and + don't try tests that require Aqua GUI (via running SDL programs) + + gnome and kde aren't enabled; the results of the checks for them + aren't used, so don't care if they fail...no need for dependencies + Description: Fantasy
dists/10.3/unstable/main/finkinfo/games wesnoth.patch,NONE,1.1 wesnoth.info,1.9,1.10
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/games In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv2099/10.3/unstable/main/finkinfo/games Modified Files: wesnoth.info Added Files: wesnoth.patch Log Message: backport dep-fixes and headless-build tweak --- NEW FILE: wesnoth.patch --- diff -Nurd -x'*~' wesnoth-0.8.8.orig/configure wesnoth-0.8.8/configure --- wesnoth-0.8.8.orig/configure2004-12-05 05:53:41.0 -0500 +++ wesnoth-0.8.8/configure 2006-03-29 20:38:30.0 -0500 @@ -13497,10 +13497,7 @@ # -if test -n $LDPREFIX -a -r /usr/lib/libSDL.la -then SDL_LIBS=/usr/lib/libSDL.la -else SDL_LIBS=`$SDL_CONFIG --libs` -fi +SDL_LIBS=`$SDL_CONFIG --libs` OLD_LIBS=$LIBS LIBS=$LIBS $SDL_LIBS @@ -13573,10 +13570,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_image_IMG_Load 5 echo ${ECHO_T}$ac_cv_lib_SDL_image_IMG_Load 6 if test $ac_cv_lib_SDL_image_IMG_Load = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_image.la -then SDL_IMAGE_LIBS=/usr/lib/libSDL_image.la -else SDL_IMAGE_LIBS=-lSDL_image -fi +SDL_IMAGE_LIBS=-lSDL_image else { { echo $as_me:$LINENO: error: *** SDL_image lib not found! Get SDL_image from http://www.libsdl.org/projects/SDL_image/index.html; 5 @@ -13650,10 +13644,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_mixer_Mix_OpenAudio 5 echo ${ECHO_T}$ac_cv_lib_SDL_mixer_Mix_OpenAudio 6 if test $ac_cv_lib_SDL_mixer_Mix_OpenAudio = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_mixer.la -then SDL_MIXER_LIBS=/usr/lib/libSDL_mixer.la -else SDL_MIXER_LIBS=-lSDL_mixer -fi +SDL_MIXER_LIBS=-lSDL_mixer else { { echo $as_me:$LINENO: error: *** SDL_mixer lib not found! Get SDL_mixer from http://www.libsdl.org/projects/SDL_mixer/index.html; 5 @@ -13727,10 +13718,7 @@ echo $as_me:$LINENO: result: $ac_cv_lib_SDL_net_SDLNet_Init 5 echo ${ECHO_T}$ac_cv_lib_SDL_net_SDLNet_Init 6 if test $ac_cv_lib_SDL_net_SDLNet_Init = yes; then - if test -n $LDPREFIX -a -r /usr/lib/libSDL_net.la -then SDL_NET_LIBS=/usr/lib/libSDL_net.la -else SDL_NET_LIBS=-lSDL_net -fi +SDL_NET_LIBS=-lSDL_net else { { echo $as_me:$LINENO: error: *** SDL_net lib not found! Get SDL_net from http://www.libsdl.org/projects/SDL_net/index.html; 5 @@ -13742,10 +13730,7 @@ #AC_CHECK_LIB([SDL_ttf], # [TTF_OpenFont], -# [if test -n $LDPREFIX -a -r /usr/lib/libSDL_ttf.la -#then SDL_TTF_LIBS=/usr/lib/libSDL_ttf.la -#else SDL_TTF_LIBS=-lSDL_ttf -#fi], +# [SDL_TTF_LIBS=-lSDL_ttf], # [AC_MSG_ERROR([*** SDL_ttf lib not found! Get SDL_ttf from #http://www.libsdl.org/projects/SDL_ttf/index.html])]) @@ -16176,12 +16161,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else @@ -16257,12 +16237,7 @@ (eval $ac_link) 25 ac_status=$? echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); } { ac_try='./conftest$ac_exeext' - { (eval echo $as_me:$LINENO: \$ac_try\) 5 - (eval $ac_try) 25 - ac_status=$? - echo $as_me:$LINENO: \$? = $ac_status 5 - (exit $ac_status); }; }; then + (exit $ac_status); }; then echo $as_me:$LINENO: result: yes 5 echo ${ECHO_T}yes 6 else Index: wesnoth.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/games/wesnoth.info,v retrieving revision 1.9 retrieving revision 1.10 diff -u -d -r1.9 -r1.10 --- wesnoth.info30 Mar 2006 00:54:40 - 1.9 +++ wesnoth.info30 Mar 2006 02:17:32 - 1.10 @@ -1,11 +1,21 @@ Package: wesnoth Version: 0.8.8 -Revision: 2 +Revision: 3 GCC: 3.3 Source-MD5: 54a580a721ea19b8006cedb2766fe6ba Source: http://www.wesnoth.org/files/%n-%v.tar.gz -BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net -Depends: sdl-mixer-shlibs, sdl-shlibs (= 1.2.7-1), sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs +BuildDepends: sdl (= 1.2.7-1), sdl-mixer, sdl-image, sdl-ttf, sdl-net, libgettext3-dev, gettext-tools, libiconv-dev, x11-dev, libpng3 +Depends: sdl-shlibs (= 1.2.7-1), sdl-mixer-shlibs, sdl-image-shlibs, sdl-ttf-shlibs, sdl-net-shlibs, libgettext3-shlibs, libiconv, x11, libpng3-shlibs +Patch: %n.patch +ConfigureParams: --mandir=%p/share/man --disable-dependency-tracking --disable-sdltest +InstallScript: make install DESTDIR=%d +DescPackaging: + dmacks: Make sure we don't see any system libSDL* that may exist and + don't try tests that require Aqua GUI (via running SDL programs) + + gnome and kde aren't enabled; the results of the checks for them + aren't used, so don't care if they fail...no need for dependencies + Description: Fantasy turn-based strategy game DescDetail:
dists/10.4-transitional/unstable/main/finkinfo/languages ghc.info,1.5,1.6
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/languages In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv17234 Modified Files: ghc.info Log Message: Backport docbook-xsl dep fix from 10.4 Index: ghc.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/languages/ghc.info,v retrieving revision 1.5 retrieving revision 1.6 diff -u -d -r1.5 -r1.6 --- ghc.info4 Jan 2006 01:24:29 - 1.5 +++ ghc.info30 Mar 2006 02:42:43 - 1.6 @@ -2,7 +2,7 @@ Version: 6.4.1 Revision: 2 Depends: readline5-shlibs, gmp-shlibs (= 4.1.4-1), libmpfr1-shlibs -BuildDepends: readline5, gmp (= 4.1.4-1), libmpfr1, docbook-dtd, docbook-dsssl-nwalsh +BuildDepends: readline5, gmp (= 4.1.4-1), libmpfr1, docbook-xsl Source: http://www.haskell.org/ghc/dist/%v/%n-%v-src.tar.bz2 Source-MD5: fd289bc7c3afa272ff831a71a50b5b00 SourceDirectory: %n-%v --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/sci ccp4.info,1.10,1.11 ccp4.patch,1.7,1.8
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/sci In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv16011 Modified Files: ccp4.info ccp4.patch Log Message: ccp4 patch upgrade Index: ccp4.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/sci/ccp4.info,v retrieving revision 1.10 retrieving revision 1.11 diff -u -d -r1.10 -r1.11 --- ccp4.info 23 Feb 2006 19:38:06 - 1.10 +++ ccp4.info 30 Mar 2006 03:36:27 - 1.11 @@ -1,6 +1,6 @@ Package: ccp4 Version: 6.0 -Revision: 1 +Revision: 3 GCC: 3.3 Source: ftp://ftp.%n.ac.uk/%n/%v.0/packed/%n-%v.0-core-src.tar.gz Source2: ftp://ftp.%n.ac.uk/%n/%v.0/packed/phaser-1.3.2-cctbx-src.tar.gz @@ -279,7 +279,7 @@ License agreement is part of configure file -- print out form and mail in, additional comments at http://chemistry.ucsc.edu/~wgscott/xtal/ccp4.html CCP4 files will be installed under /sw/share/xtal/ccp4-6.0 -This revision includes all available CCP4 patches as of December 1, 2005. +This revision includes all available CCP4 patches as of March 27, 2006. and new bash and zsh command completions specific to ccp4. DocFiles: README CHANGES COPYING PROBLEMS INSTALL INSTALL.html INSTALL.ps ccp4i_installation.html academic_software_licence.pdf academic_software_licence.ps.gz academic_software_licence.rtf Index: ccp4.patch === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/sci/ccp4.patch,v retrieving revision 1.7 retrieving revision 1.8 diff -u -d -r1.7 -r1.8 --- ccp4.patch 23 Feb 2006 19:38:06 - 1.7 +++ ccp4.patch 30 Mar 2006 03:36:28 - 1.8 @@ -192,6 +192,18 @@ } #d_index_title Interaction with Netscape +diff -ruN ccp4-6.0-orig/ccp4i/templates/molrep.com ccp4-6.0/ccp4i/templates/molrep.com +--- ccp4-6.0-orig/ccp4i/templates/molrep.com 2005-11-07 08:52:31.0 -0800 ccp4-6.0/ccp4i/templates/molrep.com2006-03-22 14:25:46.0 -0800 +@@ -136,7 +136,7 @@ + {[IfSet $FUNCTION] ![StringSame $FUNCTION A]} FUN $FUNCTION + ENDIF + +-{[IfSet $MODEL_CORRECTION] ![StringSame $MODEL_CORRECTION N] } SURF $MODEL_CORRECTION ++1 SURF $MODEL_CORRECTION + + IF { $NMONOMERS 0 } + { [IfSet $NMONOMERS] } NMON $NMONOMERS diff -ruN ccp4-6.0-orig/configure ccp4-6.0/configure --- ccp4-6.0-orig/configure2006-02-08 08:28:03.0 -0800 +++ ccp4-6.0/configure 2006-02-21 07:54:22.0 -0800 @@ -700,13 +712,907 @@ + diff -ruN ccp4-6.0-orig/lib/cctbx/cctbx_install_script.csh ccp4-6.0/lib/cctbx/cctbx_install_script.csh --- ccp4-6.0-orig/lib/cctbx/cctbx_install_script.csh 2005-11-08 09:06:57.0 -0800 -+++ ccp4-6.0/lib/cctbx/cctbx_install_script.csh2006-02-21 08:13:32.0 -0800 -@@ -29,7 +29,7 @@ - set build_mode=release ccp4-6.0/lib/cctbx/cctbx_install_script.csh2006-02-26 08:36:24.0 -0800 +@@ -1,232 +1,5 @@ +-#! /bin/csh -f ++#! /bin/sh -ef - if (`uname` == Darwin) then +-set install_root=$cwd +-set bundle=cctbx +-set sources=$cwd/${bundle}_sources +-set build=$cwd/${bundle}_build +-set prefer_usr_bin_python=0 ++echo Skipping final build of cctbx ++echo Install fink's cctbx package if you need this + +-unalias cat +-unalias cd +-unalias grep +-unalias ls +-unalias mkdir +- +-unsetenv PYTHONHOME +- +-if (-f $sources/TAG) then +- echo Build tag: +- cat $sources/TAG +-endif +- +-if (-d $sources/boost) then +- set have_sources=1 +-else +- set have_sources=0 +-endif +- +-set python_exe=None +-set build_mode=release +- +-if (`uname` == Darwin) then - set python_exe=/Library/Frameworks/Python.framework/Versions/2.3/bin/python +- if (! -x $python_exe) then +-set python_exe=/System$python_exe +- endif +- $python_exe -V +- if ($status != 0) then +-echo Under Mac OS 10 Python 2.3 must be pre-installed. +-echo Please refer to the following web page for more information: +-echo http://cci.lbl.gov/cctbx_build/mac_os_x_notes.html; +-exit 1 +- endif +-endif +- +-if ($have_sources == 0) then +- +- if (-d $build/python) then +-set python_exe=$build/python/bin/python +- endif +- if ($prefer_usr_bin_python) then +-if ($python_exe == None -x /usr/bin/python) then +- /usr/bin/python -V | head -1 +- if ($status == 0) then +-set python_exe=/usr/bin/python +- endif +-endif +- endif +- if ($python_exe == None) then +-python -V | head -1 +-if ($status == 0) then +- set python_exe=python +-endif +- endif +- if (! $prefer_usr_bin_python) then +-if ($python_exe == None -x /usr/bin/python) then +- /usr/bin/python -V | head -1 +- if ($status == 0) then +-set python_exe=/usr/bin/python +- endif +-endif +- endif +- +-else +- +- if ($#argv == 0) then +-echo -n Please enter the number of available CPU's [1]: +-set
dists/10.4/unstable/main/finkinfo/sci ncbitools.info,1.1,1.2 ncbitools.patch,1.1,1.2
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv17712 Modified Files: ncbitools.info ncbitools.patch Log Message: Fix for gcc4 and also fix for intel Index: ncbitools.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/ncbitools.info,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- ncbitools.info 20 Jan 2006 20:30:40 - 1.1 +++ ncbitools.info 30 Mar 2006 06:32:45 - 1.2 @@ -1,18 +1,15 @@ Package: ncbitools Version: 2.2.6 -Revision: 3 -Architecture: powerpc +Revision: 1003 Source: ftp://ftp.ncbi.nlm.nih.gov/toolbox/ncbi_tools/old/20030421/ncbi.tar.gz SourceRename: %n-%v.tar.gz NoSourceDirectory: true Source2: mirror:sourceforge:fink/vector.Z Source-MD5: 96208e10f92b2163f5dcc3c5cf74dd44 Source2-MD5: 331aa865cc6267d5b0b5e92e669ce5a2 -BuildDepends: gcc3.3 Patch: %n.patch PatchScript: perl -pi -e 's/(FSLockRange|FSUnlockRange)/MF_\1/g' `grep -lri lockrange .` - perl -pi -e 's/ cc / gcc-3.3 /' ncbi/platform/darwin.ncbi.mk RuntimeVars: BLASTDB: /data/blastdb @@ -85,9 +82,15 @@ dmacks un-nested some function declarations, removed local versions of functions now available in Carbon, and renamed some functions that were added to Carbon in 10.4 but are not certain to be the same - as the local ones of the same name. There are still some - static-follows-non-static problems on gcc4, which is why we force - use of the gcc-3.3 compiler. + as the local ones of the same name. + + dmacks removed some extern'ed prototypes from some .h since all the + .c that use them already have their own prototype of it that is + static instead of extern (gcc4 requirement). + + dmacks: intel is little-endian, so must hack GetKeys in vbwndws.c + but I don't know what keysym is wanted. So we'll just put in a + sleep() for now. Maintainer: Richard Graul [EMAIL PROTECTED] Homepage: http://www.ncbi.nlm.nih.gov/BLAST/ Index: ncbitools.patch === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/ncbitools.patch,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- ncbitools.patch 20 Jan 2006 20:30:40 - 1.1 +++ ncbitools.patch 30 Mar 2006 06:32:46 - 1.2 @@ -119,6 +119,30 @@ +CAGGAAACAGCTATGACCATGATTACGAATTCGAAGCTTAAGGCCTCCATGGATCCCGGGTCGACGCGTA +CGATATCGATGTCTAGATCTCCAGTACTAGTCTCGAGCTCTGCAGGGCCCGCGGTACCATGCATACTGGC +CGTCGACAACGTCGTGACTGGGC +diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salsap.h ncbitools-2.2.6/ncbi/api/salsap.h +--- ncbitools-2.2.6.orig/ncbi/api/salsap.h 1999-11-24 16:24:28.0 -0500 ncbitools-2.2.6/ncbi/api/salsap.h 2006-03-30 00:55:23.0 -0500 +@@ -86,7 +86,7 @@ + + NLM_EXTERN Pointer LIBCALL FindSeqAlignInSeqEntry (SeqEntryPtr sep, Uint1 choice); + +-NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1 choice); ++//NLM_EXTERN SeqAlignPtr LIBCALL is_salp_in_sap (SeqAnnotPtr sap, Uint1 choice); + + NLM_EXTERN Boolean LIBCALL is_dim1seqalign (SeqAlignPtr salp); + +diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/api/salutil.h ncbitools-2.2.6/ncbi/api/salutil.h +--- ncbitools-2.2.6.orig/ncbi/api/salutil.h1999-09-06 20:19:24.0 -0400 ncbitools-2.2.6/ncbi/api/salutil.h 2006-03-30 00:56:29.0 -0500 +@@ -120,7 +120,7 @@ + NLM_EXTERN SeqIdPtr ValNodeSeqIdListDup (ValNodePtr id_list); + NLM_EXTERN CharPtr PNTR SeqIdListToCharArray (SeqIdPtr id_list, Int2 n); + +-NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre, SeqIdPtr sip, SeqIdPtr next); ++//NLM_EXTERN SeqIdPtr SeqIdReplaceID (SeqIdPtr head, SeqIdPtr pre, SeqIdPtr sip, SeqIdPtr next); + NLM_EXTERN BioseqPtrBioseqReplaceID (BioseqPtr bsp, SeqIdPtr newsip); + NLM_EXTERN SeqEntryPtr SeqEntryReplaceSeqID (SeqEntryPtr source_sep, SeqIdPtr sip); + /* diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c ncbitools-2.2.6/ncbi/corelib/ncbimisc.c --- ncbitools-2.2.6.orig/ncbi/corelib/ncbimisc.c 2002-11-06 16:25:10.0 -0500 +++ ncbitools-2.2.6/ncbi/corelib/ncbimisc.c2005-12-29 12:01:28.0 -0500 @@ -173,3 +197,23 @@ host_basic_info_data_t hinfo; mach_msg_type_number_t hinfo_count = HOST_BASIC_INFO_COUNT; kern_return_t rc; +diff -Nurd -x'*~' ncbitools-2.2.6.orig/ncbi/vibrant/vibwndws.c ncbitools-2.2.6/ncbi/vibrant/vibwndws.c +--- ncbitools-2.2.6.orig/ncbi/vibrant/vibwndws.c 2003-04-09 14:16:53.0 -0400 ncbitools-2.2.6/ncbi/vibrant/vibwndws.c2006-03-30 00:28:36.0 -0500 +@@ -6328,12 +6328,16 @@ + */ + /* #ifdef OS_MAC */ + #ifdef WIN_MAC ++#if TARGET_RT_LITTLE_ENDIAN ++ sleep(5); ++#else + KeyMap keys; + + GetKeys (keys); + if ((keys [1] 1) != 0) { +
dists/10.4/unstable/main/finkinfo/sci wwwblast.info,1.1,1.2 wwwblast.patch,1.1,1.2
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv17263 Modified Files: wwwblast.info wwwblast.patch Log Message: Make this thing actually able to compile (API additions vs version in external package it linked:( Index: wwwblast.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/wwwblast.info,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- wwwblast.info 20 Jan 2006 20:30:41 - 1.1 +++ wwwblast.info 30 Mar 2006 07:29:00 - 1.2 @@ -1,11 +1,18 @@ Package: wwwblast Version: 2.2.9 -Revision: 1 +Revision: 2 Source: ftp://ftp.ncbi.nih.gov/toolbox/ncbi_tools/old/20040505/ncbi.tar.gz SourceRename: %n-%v.tar.gz Source-MD5: fd88e28e0d7323346731a8169c696b6d SourceDirectory: ncbi/network/wwwblast Patch: %n.patch +PatchScript: + #!/bin/sh -ev + cd Src + ln -s ../../../api/txalign.c . + ln -s ../../../tools/xmlblast.c . + ln -s ../../../desktop/salogif.c . + Depends: ncbitools CompileScript: cp -p Src/Makefile Src/Makefile.old @@ -178,5 +185,11 @@ For more information, see: http://www.ncbi.nlm.nih.gov/BLAST/ +DescPort: + dmacks: This package includes a newer ncbitools than fink's + ncbitools package and makes use of new APIs in it. So we build + those specific parts of the local ncbitools that have the new + functions that wwwblast needs. + Maintainer: Richard Graul [EMAIL PROTECTED] Homepage: http://www.ncbi.nlm.nih.gov/BLAST/ Index: wwwblast.patch === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/sci/wwwblast.patch,v retrieving revision 1.1 retrieving revision 1.2 diff -u -d -r1.1 -r1.2 --- wwwblast.patch 20 Jan 2006 20:30:41 - 1.1 +++ wwwblast.patch 30 Mar 2006 07:29:00 - 1.2 @@ -1,5 +1,6 @@ wwwblast/Src/Makefile Fri Nov 21 13:10:56 2003 -+++ wwwblast/Src/Makefile Sun May 30 17:04:36 2004 +diff -Nurd -x'*~' wwwblast.orig/Src/Makefile wwwblast/Src/Makefile +--- wwwblast.orig/Src/Makefile 2003-11-21 16:10:56.0 -0500 wwwblast/Src/Makefile 2006-03-30 02:13:58.0 -0500 @@ -1,12 +1,12 @@ # Set the NCBI variable to your local path to the NCBI toolkit! #NCBI = @@ -29,15 +30,25 @@ # CC=cc -@@ -46,7 +46,7 @@ +@@ -46,15 +46,15 @@ LIBS = $(NCBI_LIBDIR) DEBUG_FLAG = -O # For MacOS, use the following line: -#DEBUG_FLAG = -O2 -g +DEBUG_FLAG = -O2 -g - OBJ_FILES = wwwbutl.c $(LIBS)/ncbithr.o +-OBJ_FILES = wwwbutl.c $(LIBS)/ncbithr.o ++OBJ_FILES = wwwbutl.c $(LIBS)/ncbithr.o txalign.o xmlblast.o salogif.o + + # Defines: + # NCBI_CLIENT_SERVER - full NCBI Client/server including BLAST search + # NCBI_ENTREZ_CLIENT - Client server for gi/accession lookups +-INCDIR = -I. -I$(NCBI_INCDIR) ++INCDIR = -I. -I../../../api -I../../../tools -I../../../desktop -I$(NCBI_INCDIR) + + # Additional include path for internal NCBI BLAST 2 sequences only. + # Comment out for standalone @@ -63,17 +63,17 @@ CFLAGS = -c $(DEBUG_FLAG) $(INCDIR) @@ -59,8 +70,21 @@ # For full NCBI Client-server model #CFLAGS += -DNCBI_CLIENT_SERVER wwwblast/index.htmlTue Aug 6 12:03:51 2002 -+++ wwwblast/index.htmlMon May 31 08:43:18 2004 +diff -Nurd -x'*~' wwwblast.orig/Src/viewgif.c wwwblast/Src/viewgif.c +--- wwwblast.orig/Src/viewgif.c2003-07-15 13:42:19.0 -0400 wwwblast/Src/viewgif.c 2006-03-30 02:17:38.0 -0500 +@@ -1,6 +1,8 @@ + #include signal.h + #include fcntl.h + #include stdio.h ++#include stdlib.h ++#include string.h + + static void SigAlrmHandler(int); + static void SigTermHandler(int); +diff -Nurd -x'*~' wwwblast.orig/index.html wwwblast/index.html +--- wwwblast.orig/index.html 2002-08-06 15:03:51.0 -0400 wwwblast/index.html2006-03-30 01:59:16.0 -0500 @@ -9,20 +9,15 @@ UL --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.3/unstable/main/finkinfo/gnome libgdome0.info,1.3,1.4 libgdome0.patch,1.2,1.3
Update of /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv27313/10.3/unstable/main/finkinfo/gnome Modified Files: libgdome0.info libgdome0.patch Log Message: Don't require glib(1) for this glib(2) package. Index: libgdome0.info === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome/libgdome0.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- libgdome0.info 8 Mar 2006 22:56:27 - 1.3 +++ libgdome0.info 30 Mar 2006 07:45:53 - 1.4 @@ -34,7 +34,9 @@ over instead of trying to patch it. Make sure to find pkg-config before trying to use it, and clarify - diagnostics about what glib is being checked. + diagnostics about what glib is being checked. Rip out glib1 detection + (configure is regenerated from configure.in, and keeping it would mean + we'd need BuildDepends:glib in order to get AM_PATH_GLIB) Don't put a .c's private variable in its .h file. Index: libgdome0.patch === RCS file: /cvsroot/fink/dists/10.3/unstable/main/finkinfo/gnome/libgdome0.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- libgdome0.patch 17 Mar 2006 15:21:18 - 1.2 +++ libgdome0.patch 30 Mar 2006 07:45:53 - 1.3 @@ -1,23 +1,33 @@ diff -Nurd -x'*~' gdome2-0.8.1.orig/configure.in gdome2-0.8.1/configure.in --- gdome2-0.8.1.orig/configure.in 2003-10-05 10:39:27.0 -0400 -+++ gdome2-0.8.1/configure.in 2006-03-03 18:04:11.0 -0500 -@@ -62,6 +62,7 @@ - [ --enable-glib-1=[no] Specify if you want to use glib 1], - GLIB_1=yes - ) gdome2-0.8.1/configure.in 2006-03-30 02:37:37.0 -0500 +@@ -57,24 +57,12 @@ + dnl find glib + dnl + +-GLIB_1=no +-AC_ARG_ENABLE(glib-1, +-[ --enable-glib-1=[no] Specify if you want to use glib 1], +- GLIB_1=yes +-) +PKG_PROG_PKG_CONFIG() - if test x$GLIB_1 = xyes - then -@@ -73,7 +74,7 @@ +-if test x$GLIB_1 = xyes +-then +- PKG_CHECK_MODULES(GLIB, glib) +- GLIB_REQUIRED=glib +- GLIB_MIN_VERSION=1.2.10 +-AM_PATH_GLIB($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-else PKG_CHECK_MODULES(GLIB, glib-2.0) GLIB_REQUIRED=glib-2.0 GLIB_MIN_VERSION=2.2.0 -AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-fi +AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB2 (see config.log for details).)) - fi AC_SUBST(GLIB_MIN_VERSION) AC_SUBST(GLIB_LIBS) + AC_SUBST(GLIB_REQUIRED) diff -Nurd -x'*~' gdome2-0.8.1.orig/gtk-doc/Makefile.am gdome2-0.8.1/gtk-doc/Makefile.am --- gdome2-0.8.1.orig/gtk-doc/Makefile.am 2002-04-04 01:58:04.0 -0500 +++ gdome2-0.8.1/gtk-doc/Makefile.am 2006-03-03 18:24:03.0 -0500 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4-transitional/unstable/main/finkinfo/gnome libgdome0.info,1.3,1.4 libgdome0.patch,1.2,1.3
Update of /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv27313/10.4-transitional/unstable/main/finkinfo/gnome Modified Files: libgdome0.info libgdome0.patch Log Message: Don't require glib(1) for this glib(2) package. Index: libgdome0.info === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome/libgdome0.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- libgdome0.info 8 Mar 2006 22:56:28 - 1.3 +++ libgdome0.info 30 Mar 2006 07:45:53 - 1.4 @@ -34,7 +34,9 @@ over instead of trying to patch it. Make sure to find pkg-config before trying to use it, and clarify - diagnostics about what glib is being checked. + diagnostics about what glib is being checked. Rip out glib1 detection + (configure is regenerated from configure.in, and keeping it would mean + we'd need BuildDepends:glib in order to get AM_PATH_GLIB) Don't put a .c's private variable in its .h file. Index: libgdome0.patch === RCS file: /cvsroot/fink/dists/10.4-transitional/unstable/main/finkinfo/gnome/libgdome0.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- libgdome0.patch 17 Mar 2006 15:21:18 - 1.2 +++ libgdome0.patch 30 Mar 2006 07:45:53 - 1.3 @@ -1,23 +1,33 @@ diff -Nurd -x'*~' gdome2-0.8.1.orig/configure.in gdome2-0.8.1/configure.in --- gdome2-0.8.1.orig/configure.in 2003-10-05 10:39:27.0 -0400 -+++ gdome2-0.8.1/configure.in 2006-03-03 18:04:11.0 -0500 -@@ -62,6 +62,7 @@ - [ --enable-glib-1=[no] Specify if you want to use glib 1], - GLIB_1=yes - ) gdome2-0.8.1/configure.in 2006-03-30 02:37:37.0 -0500 +@@ -57,24 +57,12 @@ + dnl find glib + dnl + +-GLIB_1=no +-AC_ARG_ENABLE(glib-1, +-[ --enable-glib-1=[no] Specify if you want to use glib 1], +- GLIB_1=yes +-) +PKG_PROG_PKG_CONFIG() - if test x$GLIB_1 = xyes - then -@@ -73,7 +74,7 @@ +-if test x$GLIB_1 = xyes +-then +- PKG_CHECK_MODULES(GLIB, glib) +- GLIB_REQUIRED=glib +- GLIB_MIN_VERSION=1.2.10 +-AM_PATH_GLIB($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-else PKG_CHECK_MODULES(GLIB, glib-2.0) GLIB_REQUIRED=glib-2.0 GLIB_MIN_VERSION=2.2.0 -AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-fi +AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB2 (see config.log for details).)) - fi AC_SUBST(GLIB_MIN_VERSION) AC_SUBST(GLIB_LIBS) + AC_SUBST(GLIB_REQUIRED) diff -Nurd -x'*~' gdome2-0.8.1.orig/gtk-doc/Makefile.am gdome2-0.8.1/gtk-doc/Makefile.am --- gdome2-0.8.1.orig/gtk-doc/Makefile.am 2002-04-04 01:58:04.0 -0500 +++ gdome2-0.8.1/gtk-doc/Makefile.am 2006-03-03 18:24:03.0 -0500 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits
dists/10.4/unstable/main/finkinfo/gnome libgdome0.info,1.3,1.4 libgdome0.patch,1.2,1.3
Update of /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome In directory sc8-pr-cvs1.sourceforge.net:/tmp/cvs-serv27313/10.4/unstable/main/finkinfo/gnome Modified Files: libgdome0.info libgdome0.patch Log Message: Don't require glib(1) for this glib(2) package. Index: libgdome0.info === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/libgdome0.info,v retrieving revision 1.3 retrieving revision 1.4 diff -u -d -r1.3 -r1.4 --- libgdome0.info 8 Mar 2006 22:56:28 - 1.3 +++ libgdome0.info 30 Mar 2006 07:45:53 - 1.4 @@ -34,7 +34,9 @@ over instead of trying to patch it. Make sure to find pkg-config before trying to use it, and clarify - diagnostics about what glib is being checked. + diagnostics about what glib is being checked. Rip out glib1 detection + (configure is regenerated from configure.in, and keeping it would mean + we'd need BuildDepends:glib in order to get AM_PATH_GLIB) Don't put a .c's private variable in its .h file. Index: libgdome0.patch === RCS file: /cvsroot/fink/dists/10.4/unstable/main/finkinfo/gnome/libgdome0.patch,v retrieving revision 1.2 retrieving revision 1.3 diff -u -d -r1.2 -r1.3 --- libgdome0.patch 17 Mar 2006 15:21:18 - 1.2 +++ libgdome0.patch 30 Mar 2006 07:45:53 - 1.3 @@ -1,23 +1,33 @@ diff -Nurd -x'*~' gdome2-0.8.1.orig/configure.in gdome2-0.8.1/configure.in --- gdome2-0.8.1.orig/configure.in 2003-10-05 10:39:27.0 -0400 -+++ gdome2-0.8.1/configure.in 2006-03-03 18:04:11.0 -0500 -@@ -62,6 +62,7 @@ - [ --enable-glib-1=[no] Specify if you want to use glib 1], - GLIB_1=yes - ) gdome2-0.8.1/configure.in 2006-03-30 02:37:37.0 -0500 +@@ -57,24 +57,12 @@ + dnl find glib + dnl + +-GLIB_1=no +-AC_ARG_ENABLE(glib-1, +-[ --enable-glib-1=[no] Specify if you want to use glib 1], +- GLIB_1=yes +-) +PKG_PROG_PKG_CONFIG() - if test x$GLIB_1 = xyes - then -@@ -73,7 +74,7 @@ +-if test x$GLIB_1 = xyes +-then +- PKG_CHECK_MODULES(GLIB, glib) +- GLIB_REQUIRED=glib +- GLIB_MIN_VERSION=1.2.10 +-AM_PATH_GLIB($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-else PKG_CHECK_MODULES(GLIB, glib-2.0) GLIB_REQUIRED=glib-2.0 GLIB_MIN_VERSION=2.2.0 -AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB (see config.log for details).)) +-fi +AM_PATH_GLIB_2_0($GLIB_MIN_VERSION,,AC_MSG_ERROR(Could not find GLIB2 (see config.log for details).)) - fi AC_SUBST(GLIB_MIN_VERSION) AC_SUBST(GLIB_LIBS) + AC_SUBST(GLIB_REQUIRED) diff -Nurd -x'*~' gdome2-0.8.1.orig/gtk-doc/Makefile.am gdome2-0.8.1/gtk-doc/Makefile.am --- gdome2-0.8.1.orig/gtk-doc/Makefile.am 2002-04-04 01:58:04.0 -0500 +++ gdome2-0.8.1/gtk-doc/Makefile.am 2006-03-03 18:24:03.0 -0500 --- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnkkid=110944bid=241720dat=121642 ___ Fink-commits mailing list Fink-commits@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/fink-commits