Re: [galaxy-user] (no subject)
Hello Giuseppe, Please try two things: 1. At the top of the history panel is a small double arrow refresh icon. Click this to see if it updates the view. If not, click on the very top Galaxy masthead icon. This should not be necessary any longer, but try it anyway. 2. Double check that the dataset or datasets were permanently deleted, not just deleted. Using the history menu choose Include Deleted Datasets. The description in the deleted datasets will either note that they are permanently deleted or if you need to do another step (a link is provided). 3. The history menu also has an option to Purge Deleted Datasets all in one go - but be very certain before using this. Any dataset that has status deleted will be permanently deleted and no longer recoverable. A dataset that is just in deleted status can be either recovered or permanently deleted. This is a two step process to help users avoid mistakes - the change is forever. More about delete vs perm delete is in our wiki here: https://wiki.galaxyproject.org/Learn/ManagingDatasets#Delete_vs_Delete_Permanently Thanks! Jen Galaxy team ps. Please note this mailing list is being retired at the end of the week. Please post new question to Galaxy Biostar. https://wiki.galaxyproject.org/Support#Biostar On 6/2/14 8:54 AM, Ianiri, Giuseppe wrote: Hi, I uploaded some file that resulted to be too big and my history showed that that was not more space available. Now I deleted few file, and I should have 80 GB available, but my history shows still that I have no more space available for analysis. Can anyone from the Galaxy team check this for me? Giuseppe ___ The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/ Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User List is being replaced by the Galaxy Biostar User Support Forum at https://biostar.usegalaxy.org/ Posts to this list will be disabled in May 2014. In the meantime, you are encouraged to post all new questions to Galaxy Biostar. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] (no subject)
set delivery on ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] (no subject)
Hi Maria, This message indicates that an error occurred on the cluster node processing the job. Normally these are not linked to inputs or tools and the general solution is to re-run the job. Please give this a try today - it is possible the error was linked to recent transient server issues. If you continue to have problems after the re-run today, please submit a bug report from the error dataset, leaving inputs and outputs undeleted: http://wiki.galaxyproject.org/Support#Reporting_tool_errors Best, Jen Galaxy team On 9/11/13 12:38 PM, Maria Hoffman wrote: Hello, I am fairly new to galaxy and I am trying to use bowtie2 to map my reads against a custom genome (specifically a ribosomal RNA fasta file). I have formatted the file as suggested in the Galaxywiki ect and I am still getting the following message: Job output not returned by PBS: the output datasets were deleted while the job was running, the job was manually dequeued or there was a cluster error. Any help would me much appreciated! Maria ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] (no subject)
Hello, I am fairly new to galaxy and I am trying to use bowtie2 to map my reads against a custom genome (specifically a ribosomal RNA fasta file). I have formatted the file as suggested in the Galaxywiki ect and I am still getting the following message: Job output not returned by PBS: the output datasets were deleted while the job was running, the job was manually dequeued or there was a cluster error. Any help would me much appreciated! Maria ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] (no subject)
___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] (no subject)
Hi, I have worked so far on the free web-based version of Galaxy; now I have installed Bio-Linux 7, and there is Galaxy in there as well. However, I cannot access to my data (stored on the web version of Galaxy) using Galaxy on Bio Linux. If it is possible, does anyone know how to do it? Thanks, Giuseppe Ianiri ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] (no subject)
Cuffmerge does some additional steps that Cuffcompare does not; specifically, Cuffmerge attempts to remove assembly artifacts: http://cufflinks.cbcb.umd.edu/manual.html#cuffmerge It's likely that the (presumed) artifacts removed by Cuffmerge account for the differences that you're seeing. Best, J. On Apr 5, 2013, at 8:33 AM, Davide Degli Esposti wrote: Dear Galaxy team, I have a question about RNA analysis with the cufflinks package. I have some bam files to analyze from a SOLiD platform. Some previous tests show that these bam/sam files are different from those coming from Tophat and cufflinks cannot assemble them using a reference annotation (XS attribute lacking in spliced alignments). (see https://main.g2.bx.psu.edu/u/davide-degliesposti/h/rna-seqtest-datasetscufflinks). An apparent solution is to include the reference annotation in the cuffmerge (see https://main.g2.bx.psu.edu/u/davide-degliesposti/h/rna-seqtest-datasetsapril-20132) or cuffcompare (see https://main.g2.bx.psu.edu/u/davide-degliesposti/h/rna-seqtest-datasetsjan-2013-1) steps. Doing like this allowed me to run cuffdiff on my datasets without apparent technical errors. However, when I compare the list of differentially expressed transcripts (DETs), these results extremely different: using cuffcompare, I got 390 DETs and using cuffmerge I got 770 DETs, but just 60 genes are shared between the two lists. The parameters used in cuffdiff (FDR, Min Alignement counts, etc.) are the same for the two analyses. Do you have any explanation about that? I expected that cuffcompare and cuffmerge did not lead to outputs quantitatively different. Where may the source of this difference be? I thank you for your cooperation Davide --- Davide Degli Esposti, PhD Epigenetic (EGE) Group International Agency for Research on Cancer Tel. +33 4 72738036 Fax. +33 4 72738322 150, cours Albert Thomas 69372 Lyon Cedex 08 France This message and its attachments are strictly confidential. If you are not the intended recipient of this message, please immediately notify the sender and delete it. Since its integrity cannot be guaranteed, its content cannot involve the sender's responsibility. Any misuse, any disclosure or publication of its content, either whole or partial, is prohibited, exception made of formally approved use. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] (no subject)
Security warning: DO NOT CLICK on the link in this thread. Eric Guo - it is likely that your original sending hotmail email account has been compromised. We have removed it from the galaxy-u...@bx.psu.edu mailing list to prevent further unmoderated posts until the problem is cleared. Contacting your local system administrator for help is one place to start. Anyone who did click on the link already should do the same, as this is usually how such viruses spread, although much depends on OS and other factors. Good luck! Jen Galaxy team -- Jennifer Hillman-Jackson Galaxy Support and Training http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
Hi, I am performing online tophat on 5 different samples which I want to compare for gene expression. Is there any simple way, after the end of tophat for all of them, with which I can have an excel table with the 5 samples and their hits? Something similar to this Vevis1 Vevis2 Vevis3 Vevis4 Vevis5 uc010kuo.1 128.8503 136.60553 146.7073 91.23218 120.325 AK311687 TRA2A Homo sapiens transformer 2 alpha homolog (Drosophila) (TRA2A), mRNA. Regards Kristis Vevis, PhD Student Cell Biology UCL Institute of Ophthalmology 11-43 Bath Street London EC1V 9EL, UK 020 7608 4067 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
Kristis, This data is available further downstream in an RNA-seq analysis pipeline, specifically, as output from the Cuffdiff tool. Take a look at the page for more details: https://main.g2.bx.psu.edu/rna-seq Best, J. On Nov 9, 2012, at 3:42 AM, Vevis, Christis wrote: Hi, I am performing online tophat on 5 different samples which I want to compare for gene expression. Is there any simple way, after the end of tophat for all of them, with which I can have an excel table with the 5 samples and their hits? Something similar to this Vevis1 Vevis2 Vevis3 Vevis4 Vevis5 uc010kuo.1 128.8503 136.60553 146.7073 91.23218 120.325 AK311687 TRA2A Homo sapiens transformer 2 alpha homolog (Drosophila) (TRA2A), mRNA. Regards Kristis Vevis, PhD Student Cell Biology UCL Institute of Ophthalmology 11-43 Bath Street London EC1V 9EL, UK 020 7608 4067 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
I am new to the NGS analysis. I need help to solve this problem.
As shown in my previous emial/question shown below, I have some paired-end
datasets at FASTQ format, and I have problem to split each of these datasets
into two datasets (one forward and one reverse).
Jennifer instructed me to assign the datatype to be fastqsanger first and then
run 'Manipulate FASTQ'.
I have two questions:
1) Now that the datasets were already split into forward and reverse reads when
extracted in FASTQ format from the SRA, can I use them just as single end data?
2) If I do need to split each dataset into two datasets, how should I choose
the settings when I run Manipulte FASTQ?
Thanks.
Jianguang
/
On 8/10/12 7:21 AM, Du, Jianguang wrote:
I have problem to split a paired-end FASTQ dataset into two separate
datasets. In order to explain the problem clearly, I list the detail of
what I did with my dataset:
Step 1) My aim is to compare datasets for the differential alternative
splicing. I downloaded paired-end datasets at FASTQ format from SRA of
NCBI as original data.
Below is part of my paired-end FASTQ dataset that I downloaed from SRA
of NCBI, Does this dataset look OK?
@SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
GCTGAGTGAGGGTGTGTTTGGAGTTTG
+SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
I28II;II*2/5:++,(..*943F@I.('+.35'
@SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
AAAGATGTTAGTGATACGGAAAGGATATCTC
+SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
9+*9+7@?F1206,IGI+D122/0++-.+6/@?
Step 2) Then I performed FASTQ groomer at setting as follows:
a) Input FASTQ quality scores type: Illumina 1.3-1.7
b)Advanced Options: Hide Advanced Options.
Did I choose the right setting for FASTQ groomer? Should I use Advanced
Options? If yes, what is the setting for Advances Options?
Below is part of groomed dataset:
@SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
GCTGAGTGAGGGTGTGTTTGGAGTTTG
+SRR192532.1.1 HWI-EAS269:1:4:655:110.1 length=35
*!!**!**'!*
@SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
AAAGATGTTAGTGATACGGAAAGGATATCTC
+SRR192532.1.2 HWI-EAS269:1:4:655:110.2 length=35
'!*(*!%
Does the groomed data look right? Is number represnting the member of a
pair correct? Here they are .1 and .2, should they be /1 and /2?
Step 3) Then I ran FASTQ splitter with the groomed files. There is not
setting for the splitter. I chose the right groomed file and then click
Excute. Below is the description of the splitted dataset:
empty
format:fastqsanger, database:hg19
Info: Split 0 of 15277248 reads (0.00%).
Please help me dela with this problem.
Thanks.
Jianguang Du
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
Hi Megan, I ran a few tests and found that changing the file suffix to .txt when using the autodetect upload type function speed up the loading process considerably. As the final result is an identical Galaxy dataset to what is produced with using the existing suffix, this is something I would recommend that you try next time. For my test, I took one of your files and change the suffix directly, no other changes were made to the content, as it was already a tab-delimited text file. I didn't continue with the testing to specify the datatype at upload (tabular would be the correct choice), but this is a change that may also speed up import slightly, although the .txt suffix change was dramatic alone and the upload was quick (I ran a side-by-side comparison of an original and .txt-suffix modified file). The general reason behind this is that Galaxy will interpret data to detect and confirm datatypes during upload to create associated metadata needed for tool use. Detection is a convenience option that comes at a cost (compute resource and time). If you can provide this information instead, the detection portion of the process can be avoided, confirmation and metadata creation can be started directly, and the result is a quicker upload. Hopefully this helps for next time, Jen Galaxy team On 5/22/12 8:49 AM, Estorninho, Megan wrote: Yes I am still experiencing problems. My files are only around 80-120MB and are taking hours to load if at all. Thanks for your help, Megan Sent from my iPhone On 22 May 2012, at 14:38, Jennifer Jacksonj...@bx.psu.edu wrote: Hello Megan, Are you still experiencing problems now? Galaxy may have been busy immediately following the resolution of the cluster problem, although your problem does appear to be unrelated. It sounds like you are uploading file through a browser. A better choice would be to use FTP. This is required for datasets approaching or exceeding 2G in size. Files that are 2G, really any file over ~ 500MB, can also benefit from FTP upload. An FTP client tracks the progress of an upload and can resume an interrupted transfer. http://wiki.g2.bx.psu.edu/FTPUpload Hopefully this helps, Jen Galaxy team On 5/21/12 10:21 AM, Estorninho, Megan wrote: I have been unable to upload data files into Galaxy Main since Friday 18th May 2012. Today is my fourth day of attempting uploads. Refreshing and leaving the files to upload overnight does not work. Although Jennifer has stated the bug has been fixed at 5.30pm today I am still unable to upload data files. I thought I may be exceeding maximum file capacity but I am well below at only 1.8Gb. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
I have been unable to upload data files into Galaxy Main since Friday 18th May 2012. Today is my fourth day of attempting uploads. Refreshing and leaving the files to upload overnight does not work. Although Jennifer has stated the bug has been fixed at 5.30pm today I am still unable to upload data files. I thought I may be exceeding maximum file capacity but I am well below at only 1.8Gb. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
Hello Megan, Are you still experiencing problems now? Galaxy may have been busy immediately following the resolution of the cluster problem, although your problem does appear to be unrelated. It sounds like you are uploading file through a browser. A better choice would be to use FTP. This is required for datasets approaching or exceeding 2G in size. Files that are 2G, really any file over ~ 500MB, can also benefit from FTP upload. An FTP client tracks the progress of an upload and can resume an interrupted transfer. http://wiki.g2.bx.psu.edu/FTPUpload Hopefully this helps, Jen Galaxy team On 5/21/12 10:21 AM, Estorninho, Megan wrote: I have been unable to upload data files into Galaxy Main since Friday 18th May 2012. Today is my fourth day of attempting uploads. Refreshing and leaving the files to upload overnight does not work. Although Jennifer has stated the bug has been fixed at 5.30pm today I am still unable to upload data files. I thought I may be exceeding maximum file capacity but I am well below at only 1.8Gb. ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
Hi, I have hit a brick wall when trying to convert wig files from the GEO to bigwig files. Each time I try (and I have tried many times since October), I get the same error. For example, here is a downloaded wig file, that I assigned to the mouse mm8 genome, and the error I got when I tried to convert it to a bigwig file. The dataset came from Bing Ren's lab, and its GEO record is here: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM560344 The wig file was uploaded to Galaxy Dec. 8, 2011, and I assigned mm8 rather than mm9 based on the GEO record: 49: GSM560344_03112009_313D2AAXX_B7.wi ~960,000 lines format: wig, database: mm8 Info: uploaded wig file display at UCSC main The details for this upload are as follows: Tool: Upload File Name: GSM560344_03112009_313D2AAXX_B7.wi Created:Dec 08, 2011 Filesize: 12.1 Mb Dbkey: mm8 Format: wig Tool Version: Tool Standard Output: stdout Tool Standard Error:stderr Input Parameter Value File Format auto Genome Conditional (files_metadata)32 Inheritance Chain GSM560344_03112009_313D2AAXX_B7.wi The wig-to-bigWig conversion on data 49 (using the wig to bigwig conversion tool in the convert formats toolbox) was run on March 21, 2012 and gave the following error: 77: Wig-to-bigWig on data 49 0 bytes An error occurred running this job:line 152351 of stdin: chromosome chr13 has 120614378 bases, but item ends at 120614600 line 298005 of stdin: chromosome chr17 has 95177420 bases, but item ends at 95177625 line 325066 of stdin: chromosome chr16 has 98252459 bases, but item ends at 9825252 The details for this operation are as follows: Tool: Wig-to-bigWig Name: Wig-to-bigWig on data 49 Created:Mar 21, 2012 Filesize: 0 bytes Dbkey: mm8 Format: bigwig Tool Version: Tool Standard Output: stdout Tool Standard Error:stderr Input Parameter Value Convert 49: GSM560344_03112009_313D2AAXX_B7.wi Conditional (settings) 1 Items to bundle in r-tree 256 Data points bundled at lowest level 1024 Clip chromosome positions True Do not use compression True Inheritance Chain Wig-to-bigWig on data 49 I gather that the chromosome ends are not being snipped off, even though I toggle this option on the galaxy conversion tool. And I know it's doing something, because if I toggle that option off, I get an error that includes broken pipe and simply aborts. I apologize for knowing so little about the bioinformatics involved here. And I'm sure I've overlooked something that is likely obvious to others and/or failed to provide some critical bit of info in this email. But any help would be greatly appreciated. Thanks, Mike ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
Hi, I read on Readme for MACS that: For the experiment with several replicates, it is recommended to concatenate several ChIP-seq treatment files into a single file. Now, I have illumina ChipSeq data: two files for IP samples and two files for Control samples. Is It right to use Concatenate datasets (text manipulation) and then use MACS for the peaks calling? Thank you so much. Giuseppe ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
Dear All How can I de-subscribe from the mailing list? Any help would be appreciated Kind Regards M. J ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
-- Y.P.V.S.Raja Raghava Rao Research Scholar Dr.K.Sreenivasulu Lab Dept.of Animal Sciences School of Life Sciences University of Hyderabad ypvs...@gmail.com 9989733698 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] (no subject)
Hi Jeremy, I tried to run cufflinks to assemble transcripts after running Tophat against my own reference. This error was encountered. What was wrong? How to fix it? Error running cufflinks. [21:01:14] Inspecting reads and determining fragment length distribution. Processed 11130 loci. Warning: Using default Gaussian distribution due to insufficient paired-end reads in open ranges. It is recommended that correct paramaters (--frag-len-mean and --frag-len-std-dev) be provided. Map Properties: Total Map Mass: 224153.00 Read Type: 50bp single-end Fragment Length Distribution: Truncated Gaussian (default) Default Mean: 200 Default Std Dev: 80 [21:01:18] Assembling transcripts and estimating abundances. Processed 11130 loci. [21:01:22] Loading reference annotation and sequence. No fasta index found for ref.fa. Rebuilding, please wait.. Error: sequence lines in a FASTA record must have the same length! Thanks Jiannong ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
Hello Tarek, If you want to reduce the number of identical reads, then please see the tool FASTA manipulation - Collapse sequences. Converting formats would be necessary, the tool Tabular-to-FASTA can perform this operation. Best, Jen Galaxy team On 8/2/11 3:57 PM, tarek addwebi wrote: On 8/2/11 3:57 PM, tarek addwebi wrote: Hi Dear Is there anybody whom I can share my data with? I have an important question that I tried to answer, but I could not. Please see the attachment first, and let us see the first read in the first row. I need to know how many times I have this read in the whole data. Do I have to count all reads manually to know the number of this read? It would take a long time to count 11 million reads. Thank you ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support Hi Dear Is there anybody whom I can share my data with? I have an important question that I tried to answer, but I could not. Please see the attachment first, and let us see the first read in the first row. I need to know how many times I have this read in the whole data. Do I have to count all reads manually to know the number of this read? It would take a long time to count 11 million reads. Thank you ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
Aaron, As far as I remember MIRAisn't MIRA taking into account the low/high quality bases anyway? So no need to filter there right? Only filtering needed is for contaminating sequences.(incl adapters and such). You can/have to check the MIRA website to be sure though. The high qual segments I have used as in the metagenomics example but indeed you loose the exact qual infobut that is already above the provided threshold (default above 20 in Sanger quality score range). Alex Van: galaxy-user-boun...@lists.bx.psu.edu [mailto:galaxy-user-boun...@lists.bx.psu.edu] Namens Aaron Jex Verzonden: dinsdag 24 mei 2011 1:40 Aan: galaxy-u...@bx.psu.edu Onderwerp: [galaxy-user] (no subject) Hi, Can't seem to find an answer to this on your wiki site and it's not in the tutorial. I would like to filter my 454 reads for high quality regions, rename the resulting sequence fragments AND relink the new reads (fragments) to the original quality data so that I can take these filtered reads and assembly them using MIRA. Is there a way to do this with Galaxy? So basically all I want to do is take the new read fragments I get from converting the tabular file to the fasta file as shown in your metagenomics tutorial, and generate a corresponding qual file for these 'new' reads. Best regards, Aaron Aaron Jex, BSc, PhD Senior Research Officer, Department of Veterinary Science, The University of Melbourne, 250 Princes Highway, Werribee, Victoria, 3030 tel: +61 3 9731 2294 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] (no subject)
On Tue, May 24, 2011 at 12:40 AM, Aaron Jex a...@unimelb.edu.au wrote: Hi, Can’t seem to find an answer to this on your wiki site and it’s not in the tutorial. I would like to filter my 454 reads for high quality regions, rename the resulting sequence fragments AND relink the new reads (fragments) to the original quality data so that I can take these filtered reads and assembly them using MIRA. Is there a way to do this with Galaxy? See Alex's answer. So basically all I want to do is take the new read fragments I get from converting the tabular file to the fasta file as shown in your metagenomics tutorial, and generate a corresponding qual file for these ‘new’ reads. When working in Galaxy, I use the SFF converter tool to make FASTQ rather than FASTA and QUAL. MIRA will also read in FASTQ, and I find that is easier to work with for filtering and trimming than a matched FASTA and QUAL file. Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
