Re: [Tutor] PLEASE HELP
discrete, not discreet. On Fri, Apr 13, 2018 at 11:38 AM, Neil Cerutti wrote: > On 2018-04-13, David Rock wrote: > > > >> On Apr 13, 2018, at 09:24, Neil Cerutti wrote: > >> > >> On 2018-04-12, Scharrer, Brianna wrote: > >>> Applications of basic language syntax > >>> > >>> Date/time string parsing > >>> > >>> Time stamps on data are often recorded in the standard ISO date > >>> and time format as shown below > >>> 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 > >>> > >>> Write code that when given a datetime string and outputs a > >>> human readable version exactly in the format specified below. > >> > >> I disagree that the first version isn't human readable. It is > >> both human readable and stores the date/time in lexicographic > >> order, which is extremly useful for both humans and machines. > > > > Don???t nitpick the definition of ???human readable;??? it > > isn???t relevant to the assignment and just serves to confuse > > the student. Using the phrase ???human readable??? is just a > > poor choice for describing the assignment parameters: changing > > from one format to another (ISO -> ???standard English??? (for > > lack of a better description of the target format). That???s > > the only thing that matters in this context. > > It is relevant to the assignment if the student hadn't noticed > that the date was human readable. I was hoping to correct this > possible misapprehension resulting from the poor assignment > language. > > -- > Neil Cerutti > > ___ > Tutor maillist - Tutor@python.org > To unsubscribe or change subscription options: > https://mail.python.org/mailman/listinfo/tutor > -- Mayo Adams 287 Erwin Rd. Chapel Hill, NC 27514 (919)-780-3917 mayoad...@gmail.com ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] PLEASE HELP
On 2018-04-13, David Rock wrote: > >> On Apr 13, 2018, at 09:24, Neil Cerutti wrote: >> >> On 2018-04-12, Scharrer, Brianna wrote: >>> Applications of basic language syntax >>> >>> Date/time string parsing >>> >>> Time stamps on data are often recorded in the standard ISO date >>> and time format as shown below >>> 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 >>> >>> Write code that when given a datetime string and outputs a >>> human readable version exactly in the format specified below. >> >> I disagree that the first version isn't human readable. It is >> both human readable and stores the date/time in lexicographic >> order, which is extremly useful for both humans and machines. > > Don???t nitpick the definition of ???human readable;??? it > isn???t relevant to the assignment and just serves to confuse > the student. Using the phrase ???human readable??? is just a > poor choice for describing the assignment parameters: changing > from one format to another (ISO -> ???standard English??? (for > lack of a better description of the target format). That???s > the only thing that matters in this context. It is relevant to the assignment if the student hadn't noticed that the date was human readable. I was hoping to correct this possible misapprehension resulting from the poor assignment language. -- Neil Cerutti ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] PLEASE HELP
> On Apr 13, 2018, at 09:24, Neil Cerutti wrote: > > On 2018-04-12, Scharrer, Brianna wrote: >> Applications of basic language syntax >> >> Date/time string parsing >> >> Time stamps on data are often recorded in the standard ISO date >> and time format as shown below >> 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 >> >> Write code that when given a datetime string and outputs a >> human readable version exactly in the format specified below. > > I disagree that the first version isn't human readable. It is > both human readable and stores the date/time in lexicographic > order, which is extremly useful for both humans and machines. Don’t nitpick the definition of “human readable;” it isn’t relevant to the assignment and just serves to confuse the student. Using the phrase “human readable” is just a poor choice for describing the assignment parameters: changing from one format to another (ISO -> “standard English” (for lack of a better description of the target format). That’s the only thing that matters in this context. For the assignment, think about the following: How to separate the date from the time How to separate the -MM-DD into discreet variables How to convert the digit month into a Full name (e.g, convert 2 -> February) How to convert a 24-hour time into a 12-hour am/pm time How to print the bits into a specific format Tackle each part separately, and it should be fairly straightforward. Look up methods for parsing formatted strings as a place to start. — David Rock da...@graniteweb.com ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] PLEASE HELP
On 2018-04-12, Scharrer, Brianna wrote: > Applications of basic language syntax > > Date/time string parsing > > Time stamps on data are often recorded in the standard ISO date > and time format as shown below > > -mm-ddThh:mm:ss > > 2018-01-02T18:31:16 > 6:31pm on January 2, 2018 > > 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 > > Write code that when given a datetime string and outputs a > human readable version exactly in the format specified below. I disagree that the first version isn't human readable. It is both human readable and stores the date/time in lexicographic order, which is extremly useful for both humans and machines. > [Morning, Noon, Afternoon, Evening, or Night], X:XX[am or pm] on [Month as a > word] [day], [year] > > E.g. 1999-02-14T21:02:37 would be ?Night, 9:02pm on February 14, 1999? You will need to ask for clarification from your teacher for the deliniation between morning, noon, afternoon, evening and night. There's no international standard I'm aware of. > > Do not use any datetime string function, though depending on > your language they would be useful to do this in practice. They certainly would! > Hint: you?ll have to cast strings to integers in order to > perform the if statements which place [Morning, Noon?], [am or > pm] and [Month as a word] appropriately. With the exception of converting string to integer (as Alan discussed) I recommend using a dictionaries for conversion, rather than if statements, if you're allowed. -- Neil Cerutti ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] PLEASE HELP
On 12/04/18 18:24, Scharrer, Brianna wrote: What appears below seems to be an assignment of some kind. We do not do your work for you although we will offer help. But it is best if you show us your work so far, or at least describe how you intend to tackle it. In this case you are being given a string and need to convert it to a different format. It is not clear how you should expect to "be given" the input data but I assume you can read it from a user? In Python you have many string methods to help you slice/split the input into its parts. Look at the slice operations and the split method. Given the fixed lengths involved here slicing is probably easiest. The assignment suggests "casting" the string to integers but I think this is poor terminology and what is meant is that you should convert the substrings into integers (casting and conversion are very different things!). Get back to us when you have something to show us or a specific query. > Applications of basic language syntax > > Date/time string parsing > > Time stamps on data are often recorded in the standard ISO date and time > format as shown below > > -mm-ddThh:mm:ss > > 2018-01-02T18:31:16 > 6:31pm on January 2, 2018 > > 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 > > > Write code that when given a datetime string and outputs a human readable > version exactly in the format specified below. > > [Morning, Noon, Afternoon, Evening, or Night], X:XX[am or pm] on [Month as a > word] [day], [year] > > E.g. 1999-02-14T21:02:37 would be “Night, 9:02pm on February 14, 1999” > > Do not use any datetime string function, though depending on your language > they would be useful to do this in practice. > > Hint: you’ll have to cast strings to integers in order to perform the if > statements which place [Morning, Noon…], [am or pm] and [Month as a word] > appropriately. -- Alan G Author of the Learn to Program web site http://www.alan-g.me.uk/ http://www.amazon.com/author/alan_gauld Follow my photo-blog on Flickr at: http://www.flickr.com/photos/alangauldphotos ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
[Tutor] PLEASE HELP
Applications of basic language syntax Date/time string parsing Time stamps on data are often recorded in the standard ISO date and time format as shown below -mm-ddThh:mm:ss 2018-01-02T18:31:16 > 6:31pm on January 2, 2018 1999-02-14T21:02:37 > 9:02pm on February 14, 1999 Write code that when given a datetime string and outputs a human readable version exactly in the format specified below. [Morning, Noon, Afternoon, Evening, or Night], X:XX[am or pm] on [Month as a word] [day], [year] E.g. 1999-02-14T21:02:37 would be “Night, 9:02pm on February 14, 1999” Do not use any datetime string function, though depending on your language they would be useful to do this in practice. Hint: you’ll have to cast strings to integers in order to perform the if statements which place [Morning, Noon…], [am or pm] and [Month as a word] appropriately. ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me with after method
Always use REply-All or Reply-List to the tutor list.
On 17/11/16 18:34, Freedom Peacemaker wrote:
> Thank you Alan for answer but i still cant make it. I have improved my
> program but it still uses root.update() and now my app looks
> professional :) It is my first program. I am self learning Python
> since july this year but still i need a lot of knowledge. Could you
> help me improve my app with root.after?
OK, I'll try.
> And there is problem - when im closing app with X button after using
> app it shows two windows. One with messagebox i wrote, and second
> blank new tk window. I dont know where im doing mistake, or it is
> caused by root.update maybe? Maybe with using root.after problem will
> be no more.
Maybe, but I'll need to look at the code more closely.
There are a couple of things that could cause this
Having looked, I think you need to bind the window
manager close button to root.quit Take a look at
the wm_ methods in the Tkinter docs.
>
> def displayCountdown():
> lcd = "{:02d}:{:02d}".format(*divmod(t, 60))
> timeString.set(lcd)
> setTime -= 1
> if setTime > 0:
> root.after(1000,displayCountdown)
>
Where is 't' (used in the divmod) defined? Looking below I think
it should use setTime?
Otherwise it looks like it should work. All you need to do is insert
a call to displayCountdown() in your START button event handler.
> There are problems with my app but im so proud that i wrote myself
Its rare that anything is ever perfect but the buzz of getting
something to work more or less as you want it to is always good. :-)
> import sys, time, os
> import tkinter as tk
> from tkinter import *
>
You should probably only ose one of the tkinter imports.
And the first is the preferred method for production code.
> def change_1():
> B1['state'] = tk.DISABLED
> B2['state'] = tk.NORMAL
>
> def change_2():
> B1['state'] = tk.NORMAL
> B2['state'] = tk.DISABLED
>
> def change_3():
> B1['state'] = tk.DISABLED
> B2['state'] = tk.DISABLED
Add the displayCountdown() definition here
>
> def startCount():
> setTime = setMinutes.get() * 60
> strTime = str(setTime)
> timeSet = ("\""+"shutdown /s /f /t " +strTime+"\"")
> os.system(timeSet)
> change_1()
displayCountdown() # uses the after() method.
This removes the need for all of the code below.
> for t in range(setTime, -1, -1):
> lcd = "{:02d}:{:02d}".format(*divmod(t, 60))
> timeString.set(lcd)
> try:
> root.update()
> except TclError:
> messagebox.showinfo('Info', 'Closing app wont stop timer.')
> return
> time.sleep(1)
> return
>
The rest of your code is unchanged.
But note I haven't tested this! :-)
> def stopCount():
> passwd = "science"
> passwdGet = getPass.get()
> if passwd != passwdGet:
You could make this more secure.
You should probably do some reading about best [practice
for handling passwords. But for now it probably meets your needs.
> messagebox.showinfo('Wrong', 'It wasnt correct password')
> change_3()
> else:
> messagebox.showinfo('Good', 'Shutdown canceled')
> os.system("shutdown /a")
> change_2()
> return
>
> root = tk.Tk()
> setMinutes = IntVar()
> getPass = StringVar()
> timeString = StringVar()
> label_font = ('Verdana', 30)
> root.geometry('260x150+200+200')
> root.title('Timer v1.4')
> root.resizable(0, 0)
>
> L1 = tk.Label(root, text='How much time you have?')
> L1.grid(row=0, columnspan=3, sticky='WE')
>
> L2 = tk.Label(root, textvariable=timeString, font=label_font, bg='white',
> fg='orange', relief='raised', bd=3)
> L2.grid(row=1, columnspan=3, sticky='WE', padx=5, pady=5)
>
> E1 = tk.Entry(root, textvariable=setMinutes, bg='lightgreen')
> E1.grid(row=2, column=1, padx=5, pady=5)
>
> B1 = tk.Button(root, text='S T A R T', fg='green', bg='black',
> command=startCount)
> B1.grid(row=2, rowspan=2, sticky='NS', column=0, padx=5, pady=5)
>
> E2 = tk.Entry(root, textvariable=getPass, bg='red')
> E2.grid(row=3, column=1, padx=5, pady=5)
>
> B2 = tk.Button(root, text='S T O P', fg='red', bg='black',
> command=stopCount,
> state=tk.DISABLED)
> B2.grid(row=2, rowspan=2, sticky='NS', column=2, padx=5, pady=5)
>
> root.mainloop()
>
>
>
> 2016-11-17 1:03 GMT+01:00 Alan Gauld via Tutor >:
>
> On 16/11/16 18:48, Freedom Peacemaker wrote:
> > Hi, i need help. I am using Python 3.4 and I have wrote little
> app for
> > windows only ( windows 7 and higher). Its timer and my app
> working but not
> > good. Some people said that i should use after method instead of
> update()
>
> after() executes a function after a delay.
> In your case you could use it to trigger an
> immediate shutdown after the delay elapses.
> But I'm not sure that would be much better
> than doing what you are doing.
>
> The other use
Re: [Tutor] please help me with after method
On 16/11/16 18:48, Freedom Peacemaker wrote:
> Hi, i need help. I am using Python 3.4 and I have wrote little app for
> windows only ( windows 7 and higher). Its timer and my app working but not
> good. Some people said that i should use after method instead of update()
after() executes a function after a delay.
In your case you could use it to trigger an
immediate shutdown after the delay elapses.
But I'm not sure that would be much better
than doing what you are doing.
The other use of after is to avoid loops in
event handlers such as the one you have here.
This allows control to return to the GUI window.
See below...
> When you run app first enter minutes in entry then press start. If you
> first press start your pc will shutdown with no time to stop it
You can fix that by setting a default value for the time.
But you still need to write some code to cancel the shutdown
(by killing the process perhaps?)
> def startCount():
> setTime = setMinutes.get() * 60
> strTime = str(setTime)
> timeSet = ("\""+"shutdown /s /f /t " +strTime+"\"")
> os.system(timeSet)
Up to here is fine but you don't want a long running loop
inside an event handler. Although, in this case, it probably
doesn't run for long, it just counts down very quickly.
Instead you want it to count down every second or so.
So you want to call a function that displays the time
remaining then calls after() with a delay of 1 second.
The call to after should have the same function in it.
Like so:
def displayCountdown():
# display the time here
# decrement the time by 1 second
# if any time remains:
#call after(1000,displayCountdown) # 1000ms = 1s
Note that after only needs the function name, don't
include any parentheses.
> for t in range(setTime, -1, -1):
> lcd = "{:02d}:{:02d}".format(*divmod(t, 60))
> timeString.set(lcd)
> try:
> root.update()
> except TclError:
> messagebox.showinfo('Info', 'Closing app wont stop timer.')
> return
> time.sleep(1)
> return
HTH
--
Alan G
Author of the Learn to Program web site
http://www.alan-g.me.uk/
http://www.amazon.com/author/alan_gauld
Follow my photo-blog on Flickr at:
http://www.flickr.com/photos/alangauldphotos
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me with after method
Hi, i need help. I am using Python 3.4 and I have wrote little app for
windows only ( windows 7 and higher). Its timer and my app working but not
good. Some people said that i should use after method instead of update()
and nobody told me how. Ive tried many times but i dont know how do it
correctly. Please help me improve my app.
When you run app first enter minutes in entry then press start. If you
first press start your pc will shutdown with no time to stop it
my code:
from tkinter import *
import tkinter as tk
import time, os
def startCount():
setTime = setMinutes.get() * 60
strTime = str(setTime)
timeSet = ("\""+"shutdown /s /f /t " +strTime+"\"")
os.system(timeSet)
for t in range(setTime, -1, -1):
lcd = "{:02d}:{:02d}".format(*divmod(t, 60))
timeString.set(lcd)
try:
root.update()
except TclError:
messagebox.showinfo('Info', 'Closing app wont stop timer.')
return
time.sleep(1)
return
root = tk.Tk()
setMinutes = IntVar()
timeString = StringVar()
label_font = ('Verdana', 30)
root.geometry('210x120+200+200')
root.title('Timer v1.0')
root.resizable(0, 0)
L1 = tk.Label(root, text='How much time you have?')
L1.grid(row=0, columnspan=3, sticky='WE')
L2 = tk.Label(root, textvariable=timeString, font=label_font, bg='white',
fg='orange', relief='raised', bd=3)
L2.grid(row=1, columnspan=3, sticky='WE', padx=5, pady=5)
E1 = tk.Entry(root, textvariable=setMinutes).grid(row=2, column=1, padx=5,
pady=5)
B1 = tk.Button(root, text='S T A R T', fg='green', bg='black',
command=startCount)
B1.grid(row=2, rowspan=2, sticky='NS', column=0, padx=5, pady=5)
root.mainloop()
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me modify this code so that I can utilize raw_input
On 4 October 2016 at 19:11, Alan Gauld via Tutor wrote: >> """Define a function sum() and a function multiply() that sums and >> multiplies (respectively) all the numbers in a list of numbers. For >> example, sum([1, 2, 3, 4]) should return 10, and multiply([1, 2, 3, 4]) >> should return 24.""" > > > I do wish teachers would not ask students to reinvent the wheel. You may be misunderstanding the teacher's objectives here. Sometimes Python is used to introduce the concept of programming more generally rather than specifically to prepare someone for professional programming using Python. I don't know about you but I came to Python after a number of other programming languages. Now that I teach programming I can see that it's important in a first programming introduction to cover nuts and bolts type algorithmic thinking. sum() is a good example of an algorithm that most people are already used to performing on pen and paper making it a good candidate for learning to use loops and functions. > Python already has a perfectly good sum() function. Writing your own sum function helps to understand what actually happens when using the standard sum function. I do the same thing with my students in C teaching them how to make their own e.g. strlen function. I will tell them that strlen exists afterwards but I want them to understand what the null byte is and writing your own (or just looking at a) strlen implementation helps with that. Likewise simply using a function e.g. strcat without understanding its implementation can lead to segfaults so there can be a relevance in understanding the implementation even if you don't intend to reimplement something in your own code. The implications of the implementation of sum are also non-trivial which is why the stdlib contains at least 3 different sum functions. It's great that Python comes with so many functions to do common tasks. However from personal experience teaching Python as a first language can lead to the disadvantage that many students become spoilt programmers. They will learn to assume that there is a function for exactly what they want and all they ever need to do is ask a precise question in a search engine and read the first stackoverflow page. That may be the correct approach for many problems but it isn't always. A programmer should have the ability to implement basic algorithms (e.g. sum) for themselves when necessary. > And both problems become trivial if using functools.reduce() > Different people think in different ways but I reckon most people - and especially most beginners - would find a loop more straightforward than reduce. I doubt that the OP is at a stage where using reduce seems trivial. -- Oscar ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me modify this code so that I can utilize raw_input
On 04/10/16 15:04, Richard Koeman wrote: > I would like to modify this code so that instead of me calling the function > with the list as shown [1,2,3,4], the user inputs the list with raw_input. > You don't need to modify your code you just need ton write a function that reads a list from the user. Notice that this can e done by either repeatedly asking the user to input values until they are done or by reading a string containing the values and converting the string to a list of numbers. > """Define a function sum() and a function multiply() that sums and > multiplies (respectively) all the numbers in a list of numbers. For > example, sum([1, 2, 3, 4]) should return 10, and multiply([1, 2, 3, 4]) > should return 24.""" I do wish teachers would not ask students to reinvent the wheel. Python already has a perfectly good sum() function. And both problems become trivial if using functools.reduce() > > def sum(mylist = [], *args): > print mylist > sum_of_number = 0 > for i in mylist: > sum_of_number += i > print "The sum of the digits in your number is %s" %(sum_of_number) > def multiply(mylist = [], *args): > product_of_number = 1 > for i in mylist: > product_of_number = product_of_number * i > print "The product of the digits in your number is %s" > %(product_of_number) > > sum([1,2,3,4]) > multiply([1,2,3,4]) Incidentally, notice that the assignment asks you to *return* the results not print them. This is good practice, keep the printing separate from the calculation. You can then print the result, if you wish, with print( sum([]) ) hth -- Alan G Author of the Learn to Program web site http://www.alan-g.me.uk/ http://www.amazon.com/author/alan_gauld Follow my photo-blog on Flickr at: http://www.flickr.com/photos/alangauldphotos ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me modify this code so that I can utilize raw_input
I would like to modify this code so that instead of me calling the function with the list as shown [1,2,3,4], the user inputs the list with raw_input. Thanks in advance """Define a function sum() and a function multiply() that sums and multiplies (respectively) all the numbers in a list of numbers. For example, sum([1, 2, 3, 4]) should return 10, and multiply([1, 2, 3, 4]) should return 24.""" def sum(mylist = [], *args): print mylist sum_of_number = 0 for i in mylist: sum_of_number += i print "The sum of the digits in your number is %s" %(sum_of_number) def multiply(mylist = [], *args): product_of_number = 1 for i in mylist: product_of_number = product_of_number * i print "The product of the digits in your number is %s" %(product_of_number) sum([1,2,3,4]) multiply([1,2,3,4]) -- This is a staff email account managed by Simcoe Muskoka Catholic District School Board. This email and any files transmitted with it are confidential and intended solely for the use of the individual or entity to whom they are addressed. If you have received this email in error please notify the sender. ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help to build an addon for Anki
On 20/04/15 09:54, Mahesh Chiramure wrote: I liked the addon "Picture-flasher" written for anki very much and I was wondering if the same thing could be done with mp3 and/or flac files. Probably, but I (and probably most of the list) have no idea what anki is or what the addon does. This is a list for learning Python and its standard library. You could try asking on the general Python mailinglist/newsgroup where you might find someone familiar with it. If you do try that you sould try explaining what anki is, and what the addon does. ie how it 'adds on'. Better still is if you can find an anki forum, since they will understand anki, addons and probably be familiar with the PictureFlasher one you describe. -- Alan G Author of the Learn to Program web site http://www.alan-g.me.uk/ http://www.amazon.com/author/alan_gauld Follow my photo-blog on Flickr at: http://www.flickr.com/photos/alangauldphotos ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
[Tutor] Please Help to build an addon for Anki
Hi
I liked the addon "Picture-flasher" written for anki very much
and I was wondering if the same thing could be done with mp3 and/or
flac files. Means I am looking for an addon that chooses a random mp3
and/or flac file from a directory provided by me (to the addon as we
have to provide in "Picture-flasher") and plays it on successful
reviewing of a certain number of cards (as does the addon
"Picture-flasher"). As a music lover, I feel that this addon can
motivate a whole lot of music lovers out there to pay a visit to Anki
on their PC and review to listen to their favorite mp3 and/or flac
files as a reward.
I am not a programmer yet, please guide.
Hoping for a quick response.
Mahesh Chirmure
# -*- coding: utf-8 -*-
# Picture-Flasher (a plugin for Anki)
# Authors:
# Emanuel Rylke, ema-...@web.de
# D_Malik, malik6...@gmail.com
# Version 2
# License: GNU GPL, version 3 or later; http://www.gnu.org/copyleft/gpl.html
"""
A simple plugin that flashes pictures on-screen to reinforce reviews.
Before using:
- Get pictures from someplace. I downloaded pictures off reddit using the
script at https://github.com/dpbrown/RedditImageGrab
- Change all lines (in the plugin source) marked with "CHANGEME" according to
your preferences.
For more details, see the post at For more details, see the post at
http://lesswrong.com/r/discussion/lw/frc/two_anki_plugins_to_reinforce_reviewing/
"""
from anki.hooks import addHook
from aqt import mw
from random import random, choice
from aqt.qt import QSplashScreen, QPixmap, QTimer
from os import listdir
#-- begin configuration --#
pictureDirectory = "E://Family stuff//22 Feb//Personal//College//A J//"
#CHANGEME to the directory where you're storing your pictures. NB: This MUST
end with a trailing slash e.g. D://Family stuff//19 Jan//Imgs//Wallys//,
D://Family stuff//22 Feb//Imgs//Windows 7//.
flashTime = 3000 #CHANGEME to change how long pictures stay on the screen. The
number is time in milliseconds.
#flashPosition = [20, 1050] #CHANGEME if you want the picture to be shown at a
specific location. The numbers are x- and y-coordinates.
#CHANGEME: The next lines are a python dictionary associating deck names
with probabilities of pictures being shown.
#Eg, when using the deck "brainscience", you will get a picture after 30%
of cards. When using a deck without a listed name, "other" is used.
#Change this according to your decks. Decks with shorter, easier cards need
lower probabilities.
deckPicsProbabilities = {
"rocketsurgery": 0.3,
"brainscience" : 0.5,
"other": 0.1,
}
#--- end configuration ---#
pics = listdir(pictureDirectory)
def showPics():
if mw.col.decks.current()['name'] in deckPicsProbabilities:
picsProbability = deckPicsProbabilities[mw.col.decks.current()['name']]
else:
picsProbability = deckPicsProbabilities["other"]
if random() < picsProbability:
mw.splash = QSplashScreen(QPixmap(pictureDirectory + choice(pics)))
try:
mw.splash.move(flashPosition[0], flashPosition[1])
except NameError:
pass
mw.splash.show()
QTimer.singleShot(flashTime, mw.splash.close)
addHook("showQuestion", showPics)
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 03/21/2014 10:39 PM, Cameron Simpson wrote: On 21Mar2014 20:31, Mustafa Musameh wrote: Please help. I have been search the internet to understand how to write a simple program/script with python, and I did not do anything. I have a file that look like this ID 1 agtcgtacgt… ID 2 acccttcc . . . in other words, it contains several IDs each one has a sequence of 'acgt' letters I need to write a script in python where the output will be, for example, like this ID 1 a = 10%, c = 40%, g=40%, t = 10% ID 2 a = 15%, c = 35%, g=35%, t = 15% . . . (i mean the first line is the ID and the second line is the frequency of each letter ) How I can tell python to print the first line as it is and count characters starting from the second line till the beginning of the next '>' and so on You want a loop that reads lines in pairs. Example: while True: line1 = fp.readline() print line1, line2 = fp.readline() ... process the line and report ... Then to process the line, iterate over the line. Because a line is string, and a string is a sequence of characters, you can write: for c in line2: ... collect statistics about c ... ... print report ... I would collect the statistics using a dictionary to keep count of the characters. See the dict.setdefault method; it should be helpful. I think it would be easier to do that in 2 loops: * first read the file line by line, building a list of pairs (id, base-sequence) (and on the fly check the input is correct, if needed) * then traverse the sequences of bases to get numbers & percentages, and write out d ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 22Mar2014 00:04, Mark Lawrence wrote: > On 21/03/2014 21:39, Cameron Simpson wrote: > >On 21Mar2014 20:31, Mustafa Musameh wrote: > > > >I would collect the statistics using a dictionary to keep count of > >the characters. See the dict.setdefault method; it should be helpful. > > > > Delightfully old fashioned but I'd now prefer > http://docs.python.org/3/library/collections.html#collections.Counter > :) Maybe, but using a dictionary is easy and Mustafa will learn more. Cheers, -- Cameron Simpson Do not underestimate your abilities. That is your boss's job. It is your job to find ways around your boss's roadblocks. - Glen Appleby http://www.armory.com/~glena/ ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 21/03/2014 21:39, Cameron Simpson wrote: On 21Mar2014 20:31, Mustafa Musameh wrote: I would collect the statistics using a dictionary to keep count of the characters. See the dict.setdefault method; it should be helpful. Delightfully old fashioned but I'd now prefer http://docs.python.org/3/library/collections.html#collections.Counter :) -- My fellow Pythonistas, ask not what our language can do for you, ask what you can do for our language. Mark Lawrence --- This email is free from viruses and malware because avast! Antivirus protection is active. http://www.avast.com ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On Fri, Mar 21, 2014 at 08:31:07PM +1100, Mustafa Musameh wrote:
> Please help. I have been search the internet to understand how to
> write a simple program/script with python, and I did not do anything.
> I have a file that look like this
> >ID 1
> agtcgtacgt…
> >ID 2
> acccttcc
> .
> .
> .
> in other words, it contains several IDs each one has a sequence of 'acgt'
> letters
> I need to write a script in python where the output will be, for example,
> like this
> > ID 1
> a = 10%, c = 40%, g=40%, t = 10%
> >ID 2
> a = 15%, c = 35%, g=35%, t = 15%
> .
> .
> .
> (i mean the first line is the ID and the second line is the frequency of each
> letter )
> How I can tell python to print the first line as it is and count
> characters starting from the second line till the beginning of the
> next '>' and so on
This sounds like a homework exercise, and I have a policy of trying not
to do homework for people. But I will show you the features you need.
Firstly, explain what you would do if you were solving this problem in
your head. Write out the steps in English (or the language of your
choice). Don't worry about writing code yet, you're writing instructions
for a human being at this stage.
Those instructions might look like this:
Open a file (which file?).
Read two lines at a time.
The first line will look like ">ID 42". Print that line unchanged.
The second line will look line "gatacacagtatta...". Count how
many "g", "a", "t", "c" letters there are, then print the
results as percentages.
Stop when there are no more lines to be read.
Now that you know what needs to be done, you can start using Python for
it. Start off by opening a file for reading:
f = open("some file")
There are lots of ways to read the file one line at a time. Here's one
way:
for line in f:
print(line)
But you want to read it *two* lines at a time. Here is one way:
for first_line in f:
second_line = next(f, '')
print(first_line)
print(second_line)
Here's another way:
first_line = None
while first_line != '':
first_line = f.readline()
second_line = f.readline()
Now that you have the lines, what do you do with them? Printing the
first line is easy. How about the second?
second_line = "gatacattgacaaccggaataccgagta"
Now you need to do four things:
- count the total number of characters, ignoring the newline at the end
- count the number of g, a, t, c characters individually
- work out the percentages of the total
- print each character and its percentage
Here is one way to count the total number of characters:
count = 0
for c in second_line:
count += 1
Can you think of a better way? Do you think that maybe Python has a
built-in command to calculate the length of a string?
Here is one way to count the number of 'g' characters:
count_of_g = 0
for c in second_line:
count_of_g += 1
(Does this look familiar?)
Can you think of another way to count characters? Hint: strings have a
count method:
py> s = "fjejevffveejf"
py> s.count("j")
3
Now you need to calculate the percentages. Do you know how to calculate
the percentage of a total? Hint: you'll need to divide two numbers and
multiply by 100.
Finally, you need to print the results.
Putting all these parts together should give you a solution. Good luck!
Write as much code as you can, and come back with any specific questions
you may have.
--
Steven
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 21Mar2014 20:31, Mustafa Musameh wrote: > Please help. I have been search the internet to understand how to write a > simple program/script with python, and I did not do anything. > I have a file that look like this > >ID 1 > agtcgtacgt… > >ID 2 > acccttcc > . > . > . > in other words, it contains several IDs each one has a sequence of 'acgt' > letters > I need to write a script in python where the output will be, for example, > like this > > ID 1 > a = 10%, c = 40%, g=40%, t = 10% > >ID 2 > a = 15%, c = 35%, g=35%, t = 15% > . > . > . > (i mean the first line is the ID and the second line is the frequency of each > letter ) > How I can tell python to print the first line as it is and count characters > starting from the second line till the beginning of the next '>' and so on You want a loop that reads lines in pairs. Example: while True: line1 = fp.readline() print line1, line2 = fp.readline() ... process the line and report ... Then to process the line, iterate over the line. Because a line is string, and a string is a sequence of characters, you can write: for c in line2: ... collect statistics about c ... ... print report ... I would collect the statistics using a dictionary to keep count of the characters. See the dict.setdefault method; it should be helpful. Cheers, -- Cameron Simpson ... in '59 I ran out of brakes *four times* -- and I don't mean they didn't work very well, I mean I had none. Like the main oil line had sheared. You know, so that oil, you know, when you put your foot on the floor, the oil just went squirting out into the atmosphere. Things like that. You know, I'd always believed that Colin was close to genius in his design ability and everything -- if he could just get over this failing of his of making things too bloody light. I mean, Colin's idea of a Grand Prix car was it should win the race and, as it crossed the finishing line, it should collapse in a heap of bits. If it didn't do that, it was built too strongly. - Innes Ireland ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 21/03/14 09:31, Mustafa Musameh wrote: Please help. I have been search the internet to understand how to write a > simple program/script with python, and I did not do anything. There are ma y tutorials on how to write Python for every level of programmer. What is your level? If you can already program then the official tutorial on the python.org web site is a good start. https://wiki.python.org/moin/BeginnersGuide/Programmers and http://docs.python.org/2/tutorial/ or http://docs.python.org/3/tutorial/ Depending on wheher you are using Pyton v2 or v3 - there are significant differences. If you cannot already program then this project will require quite a bit of work to learn the basics before you can start to solve your problem. For that you should look at the list of tutors for non programmers(including mine as cited below). https://wiki.python.org/moin/BeginnersGuide/NonProgrammers I have a file that look like this ID 1 agtcgtacgt… ID 2 acccttcc . This looks like bioscience? If so there are standard libraries available to help with processing that. Once you understand how to write basic Python you should probably download one of those libraries. There is a page for bioscientists using Python here: http://www.onlamp.com/pub/a/python/2002/10/17/biopython.html If you try one of the tutorials and have specific questions come back here and we can try to clarify things, -- Alan G Author of the Learn to Program web site http://www.alan-g.me.uk/ http://www.flickr.com/photos/alangauldphotos ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help
On 21/03/2014 09:31, Mustafa Musameh wrote: Please help. I have been search the internet to understand how to write a simple program/script with python, and I did not do anything. I have a file that look like this ID 1 agtcgtacgt… ID 2 acccttcc . . . in other words, it contains several IDs each one has a sequence of 'acgt' letters I need to write a script in python where the output will be, for example, like this ID 1 a = 10%, c = 40%, g=40%, t = 10% ID 2 a = 15%, c = 35%, g=35%, t = 15% . . . (i mean the first line is the ID and the second line is the frequency of each letter ) How I can tell python to print the first line as it is and count characters starting from the second line till the beginning of the next '>' and so on Please help Welcome :) Start here http://docs.python.org/3/tutorial/index.html and then come back with specific questions about any problems that you may encounter. -- My fellow Pythonistas, ask not what our language can do for you, ask what you can do for our language. Mark Lawrence --- This email is free from viruses and malware because avast! Antivirus protection is active. http://www.avast.com ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
[Tutor] please help
Please help. I have been search the internet to understand how to write a simple program/script with python, and I did not do anything. I have a file that look like this >ID 1 agtcgtacgt… >ID 2 acccttcc . . . in other words, it contains several IDs each one has a sequence of 'acgt' letters I need to write a script in python where the output will be, for example, like this > ID 1 a = 10%, c = 40%, g=40%, t = 10% >ID 2 a = 15%, c = 35%, g=35%, t = 15% . . . (i mean the first line is the ID and the second line is the frequency of each letter ) How I can tell python to print the first line as it is and count characters starting from the second line till the beginning of the next '>' and so on Please help ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
[Tutor] Please help with beautifulsoup and web scraping
http://stackoverflow.com/q/18974172/2390312 ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help replace Long place-names with short place-names in many files with Python
On Sun, Sep 1, 2013 at 4:19 PM, mc UJI wrote: > Dear Pythonistas, > > I am totally new to Python. This means a know the basics. And by basics I > mean the very, very basics. > > I have a problem with which I need help. > > in short, I need to: > > a) Open many files (in a dir) with an .html extension Do you know how to do this? Its not hard. Google 'python reading all files in a directory' to get started > b) Find Long name-places (Austria) > c) Replace them by short name.places (AT) In python strings are objects and they have the replace method (look here: http://docs.python.org/2/library/string.html#string.replace) If you figure out how to read each file into a string (see above), you just run the string.replace method on it for each long-short country pair. Then write the file. Try first to write this code. If you apply yourself, it will take you maybe an hour to get something working. Then come back with your code and tell us what went wrong. > d) In the context of the xml tags ( and > ) > > At length: > > I have many xml files containing a day of speeches at the European > Parliament each file. Each file has some xml-label for the session metadata > and then the speakers (MPs) interventions. These interventions consist of my > metadata and text. I include here a sample of two speeches (Please pay > attention to xml labels and country=".*?"/> ): > > >SAMPLE OF INTERVENTIONS > > > Knapman, Roger > 19440220 > Crediton > NA > male > > > > > > > > UK Independence Party > > > on behalf of the group > > > Mr President, Mr Juncker's speech was made with > all the passion that a civil servant is likely to raise. > Mr Juncker, you say that the Stability and > Growth Pact will be your top priority, but your past statements serve to > illustrate only the inconsistencies. Whilst I acknowledge > that you played a key role in negotiating the pact's original rules, you > recently said that the credibility of the pact had been buried and that the > pact was dead. Is that still your opinion? > You also said that you have a window of > opportunity to cut a quick deal on the EU budget, including the British > rebate of some EUR 4 billion a year. Is that so, Mr > Juncker? The rebate took five years to > negotiate. If your comments are true and you can cut a > deal by June, then Mr Blair must have agreed in principle to surrender the > rebate. Is that the case? With whom in > the British Government precisely are you negotiating? Will > the British electorate know about this at the time of the British general > election, probably in May? > Finally, the UK Independence Party, and in > particular my colleague Mr Farage, has drawn attention to the criminal > activities of more than one Commissioner. More details > will follow shortly and regularly. Are you to be tainted > by association with them, or will you be expressing your concerns and the > pressing need for change? > > > > > > Angelilli, Roberta > 19650201 > Roma > NA > female > > > > > > > > Alleanza nazionale > > > on behalf of the group > > > Mr President, the Luxembourg Presidency’s > programme is packed with crucial issues for the future of Europe, including > the priorities on the economic front: the Lisbon strategy, reform of the > Stability Pact and approval of the financial perspective up to 2013. > My first point is that it will soon be time for > the mid-term review of the level of implementation of the Lisbon > strategy. To give it a greater chance of success, the > programme needs to make the individual Member States responsible for > achieving the targets that were set. To that end, I > consider the proposal to specify an individual at national level to be > responsible for putting the strategy into practice to be a very useful > idea. > Secondly, with regard to the review of the > Stability Pact, it has also been emphasised this morning that a reform is > needed which can propose a more flexible interpretation of the Pact during > times of recession, without bypassing the Maastricht criteria and without > giving up the commitment to reduce the debt. I am also > convinced that steps could be taken to exclude certain specific types of > investment from the calculation of the deficit in order to give a new boost > to Europe’s growth and competitiveness. > Thirdly, I hope that we can really succeed in > approving the financial perspective up to 2013 by June, so that the > resources can be used to the full from the very beginning of the period in > question. I especially hope that the proposals – the > Council’s and the Commission’s proposals on those important topics – are > adequately discussed in advance by Parliament which, let us recall, is the > only European institution that directly represents the sovereignty of the > people. > Lastly, I hope that a European civil protection > agenc
[Tutor] Please help replace Long place-names with short place-names in many files with Python
Dear Pythonistas, I am totally new to Python. This means a know the basics. And by basics I mean the very, very basics. I have a problem with which I need help. in short, I need to: a) Open many files (in a dir) with an .html extension b) Find Long name-places (Austria) c) Replace them by short name.places (AT) d) In the context of the xml tags ( and ) At length: I have many xml files containing a day of speeches at the European Parliament each file. Each file has some xml-label for the session metadata and then the speakers (MPs) interventions. These interventions consist of my metadata and text. I include here a sample of two speeches (Please pay attention to xml labels and ): SAMPLE OF INTERVENTIONS Knapman, Roger 19440220 Crediton NA male UK Independence Party on behalf of the group Mr President, Mr Juncker's speech was made with all the passion that a civil servant is likely to raise. Mr Juncker, you say that the Stability and Growth Pact will be your top priority, but your past statements serve to illustrate only the inconsistencies. Whilst I acknowledge that you played a key role in negotiating the pact's original rules, you recently said that the credibility of the pact had been buried and that the pact was dead. Is that still your opinion? You also said that you have a window of opportunity to cut a quick deal on the EU budget, including the British rebate of some EUR 4 billion a year. Is that so, Mr Juncker? The rebate took five years to negotiate. If your comments are true and you can cut a deal by June, then Mr Blair must have agreed in principle to surrender the rebate. Is that the case? With whom in the British Government precisely are you negotiating? Will the British electorate know about this at the time of the British general election, probably in May? Finally, the UK Independence Party, and in particular my colleague Mr Farage, has drawn attention to the criminal activities of more than one Commissioner. More details will follow shortly and regularly. Are you to be tainted by association with them, or will you be expressing your concerns and the pressing need for change? Angelilli, Roberta 19650201 Roma NA female Alleanza nazionale on behalf of the group Mr President, the Luxembourg Presidency’s programme is packed with crucial issues for the future of Europe, including the priorities on the economic front: the Lisbon strategy, reform of the Stability Pact and approval of the financial perspective up to 2013. My first point is that it will soon be time for the mid-term review of the level of implementation of the Lisbon strategy. To give it a greater chance of success, the programme needs to make the individual Member States responsible for achieving the targets that were set. To that end, I consider the proposal to specify an individual at national level to be responsible for putting the strategy into practice to be a very useful idea. Secondly, with regard to the review of the Stability Pact, it has also been emphasised this morning that a reform is needed which can propose a more flexible interpretation of the Pact during times of recession, without bypassing the Maastricht criteria and without giving up the commitment to reduce the debt. I am also convinced that steps could be taken to exclude certain specific types of investment from the calculation of the deficit in order to give a new boost to Europe’s growth and competitiveness. Thirdly, I hope that we can really succeed in approving the financial perspective up to 2013 by June, so that the resources can be used to the full from the very beginning of the period in question. I especially hope that the proposals – the Council’s and the Commission’s proposals on those important topics – are adequately discussed in advance by Parliament which, let us recall, is the only European institution that directly represents the sovereignty of the people. Lastly, I hope that a European civil protection agency will at last be set up during the Luxembourg Presidency so that natural disasters can be dealt with in an appropriate manner, with particular emphasis on prevention. END OF SAMPLE OF INTERVENTIONS * Now, as you see, label: and Have long place-names. For instance and But I would like short place-names (UK instead of United Kingdom, for instance) The long-names I have are all the members of the European Union. LIST OF LONG PLACE-NAMES AND EQUIVALENT SHORT PLACE-NAMES Austria = AT Belgium = BE Bulgaria = BG Croatia = HR Cyprus = CY Czech Republic = CS Denmark = DK Estonia = EE Finland = FI France = FR Germany = DE Greece = GR Hungary = HU Ireland = IE Italy = IT Latv
[Tutor] please help with read_until, write script
Hi, all Python Experts,
I am a Python beginner.
I am trying to script the following steps.
I have problem to match the step after 'signature check?'
'[999.daisyse.07260019]:' the value of 0726009 is dynamic, every time it will
be different, so I don't know how to do it.
For sure I have problem to match 'directory and config file? (Yes/No) [Yes]:'
and 'current configuration? (Yes/No) [Yes]:'
I use IDLE in pc to write and run the script.
Please help, thank you very much.
All the steps I want to script.
vyatta@Daisy-BGP1:~$ add sys image
http://packages.vyatta.com/vyatta-dev/daisy-se/unstable/iso/livecd_2013-07-26-0018-7e824ac_i386.iso
Trying to fetch ISO file from
http://packages.vyatta.com/vyatta-dev/daisy-se/unstable/iso/livecd_2013-07-26-0018-7e824ac_i386.iso
% Total % Received % Xferd Average Speed Time Time Time Current
Dload Upload Total Spent Left Speed
100 223M 100 223M 0 0 45.6M 0 0:00:04 0:00:04 --:--:-- 45.2M
ISO download succeeded.
Checking for digital signature file...
% Total % Received % Xferd Average Speed Time Time Time Current
Dload Upload Total Spent Left Speed
0 0 0 0 0 0 0 0 --:--:-- --:--:-- --:--:-- 0
curl: (22) The requested URL returned error: 404
Unable to fetch digital signature file.
Do you want to continue without signature check? (yes/no) [yes] yes
Checking MD5 checksums of files on the ISO image...OK.
Done!
What would you like to name this image? [999.daisyse.07260019]:
OK. This image will be named: 999.daisyse.07260019
Installing "999.daisyse.07260019" image.
Copying new release files...
Would you like to save the current configuration
directory and config file? (Yes/No) [Yes]: yes
Copying current configuration...
Would you like to save the SSH host keys from your
current configuration? (Yes/No) [Yes]: yes
Copying SSH keys...
Setting up grub configuration...
Done.
=
Here is my code.
session = telnetlib.Telnet("10.1.34.21", timeout=5)
...skip some write and read_until...
session.write('yes'+'\n')
h1=session.read_until('[999.daisyse.07260019]:')
print h1
session.write('\n')
#h20=session.read_until('(Yes/No) [Yes]:')- never match
#h20=session.read_until('[Yes]:') - never match
#h20=session.expect('(Yes/No)', '[Yes]:')- script just terminate
#h20=session.read_lazy('[Yes]:')-script just terminate
#h20=session.read_expect('.*\(Yes\/No\)')- script just terminate
h20=session.read_expect('.*\s\(Yes\/No\)')- script just terminate
print h20
===
#h20=session.read_until('(Yes/No) [Yes]:')- never match, just wait there, never
finish.
OUtput from IDLE:
[Kvyatta@Daisy-BGP1:~$
add sys image http://packages.vyatta.com/vyatta-dev/daisy-s
e/unstable/iso/livecd_2013-07-26-0018-7e824ac_i386.iso
Trying to fetch ISO file from
http://packages.vyatta.com/vyatta-dev/daisy-se/unstable/iso/livecd_2013-07-26-0018-7e824ac_i386.iso
% Total % Received % Xferd Average Speed Time Time Time Current
Dload Upload Total Spent Left Speed
0 0 0 0 0 0 0 0 --:--:-- --:--:-- --:--:-- 0
34 223M 34 77.1M 0 0 87.1M 0 0:00:02 --:--:-- 0:00:02 87.4M
60 223M 60 135M 0 0 71.6M 0 0:00:03 0:00:01 0:00:02 71.8M
69 223M 69 154M 0 0 53.4M 0 0:00:04 0:00:02 0:00:02 53.5M
70 223M 70 156M 0 0 19.2M 0 0:00:11 0:00:08 0:00:03 19.2M
100 223M 100 223M 0 0 25.2M 0 0:00:08 0:00:08 --:--:-- 25.2M
ISO download succeeded.
Checking for digital signature file...
% Total % Received % Xferd Average Speed Time Time Time Current
Dload Upload Total Spent Left Speed
0 0 0 0 0 0 0 0 --:--:-- --:--:-- --:--:-- 0
0 0 0 0 0 0 0 0 --:--:-- --:--:-- --:--:-- 0
curl: (22) The requested URL returned error: 404
Unable to fetch digital signature file.
Do you want to continue without signature check? (yes/no) [yes]
yes
Checking MD5 checksums of files on the ISO image...OK.
Done!
What would you like to name this image? [999.daisyse.07260019]:
==
#h20=session.expect('(Yes/No)', '[Yes]')- script just terminate
Do you want to continue without signature check? (yes/no) [yes]
yes
Checking MD5 checksums of files on the ISO image...OK.
Done!
What would you like to name this image? [999.daisyse.07260019]:
>>>
===___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
Greetings, : I have the following data points. : data = [1,2,0,9,0,1,4] : I like to store in an array and print the odd-indexed points, i.e. 2, 9,1 : (considering index starts at 0) : : I have written the following code which is not running: : : import math : : number_list = [1,2,0,9,0,1,4] : : number_list_1 = [] : for k in range(math.floor(float(len(number_list)/2))): : if (k< math.floor(float(len(number_list)/2))): : number_list_1[k] = number_list[k*2 + 1] : : print 'data: ', number_list_1 My first thought when I see the above is that you appear to be taking a circuitous route to the market! You must really want to get your exercise on your journey to fetch the list of [2, 9, 1]. My second observation is that the looping over a list using the technique you showed here (and in your prior mail) is something that looks more like C or Java. Looping on an list (array, or any sort of sequence) is a bit easier here in the lands of Python. You can simply: for item in list_data: # -- do something with item Since you are in the lands of Python (and welcome, by the way), the Python docs are pretty good (and not overwhelming), and include some excellent examples, so try reading about sequences and how to manipulate them at this online doc: http://docs.python.org/2/library/stdtypes.html#sequence-types-str-unicode-list-tuple-bytearray-buffer-xrange Anyway, I think you may benefit from seeing this solution a bit more Pythonically, so I have offered two different solutions. -Martin data = number_list = [1,2,0,9,0,1,4] # -- you call it 'number_list_1'; I will call it 'outlist' # outlist = [] for idx,val in enumerate(data): print idx, val if 0 == (idx % 2): # -- skip even entries; do not append continue outlist.append(val) print 'loop over enumerate() to get your data: ', outlist # -- OR, given how simple your operation on the list is, consider #learning about slicing; see the standard docs on sequences: # # http://docs.python.org/2/library/stdtypes.html#sequence-types-str-unicode-list-tuple-bytearray-buffer-xrange # print 'slice out from your original data: ', data[1::2] -- Martin A. Brown http://linux-ip.net/ ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
On Fri, Mar 22, 2013 at 6:07 PM, Arijit Ukil wrote: > I have the following data points. > data = [1,2,0,9,0,1,4] > I like to store in an array and print the odd-indexed points, i.e. 2, 9,1 > (considering index starts at 0) > > *I have written the following code which is** not **running:* > > import math > > number_list = [1,2,0,9,0,1,4] > > number_list_1 = [] > for k in range(math.floor(float(len(number_list)/2))): > if (k< math.floor(float(len(number_list)/2))): > number_list_1[k] = number_list[k*2 + 1] > > print *'data: '*, number_list_1 > > Please help > > Regards, > I would suggest that your roblems have more to do with insufficient understanding of basic constructs, and that you should work on them, "Learn Python the hard way" a book by Zed Shaw is a good one. Why do I say that? Among other things, k< math.floor(float(len(number_list)/2)) is very poor in any language. Asokan Pichai The root of all superstition is that men observe when a thing hits, but not when it misses. -- Francis Bacon ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
Please use a meaningful subject. On 22.03.2013 13:37, Arijit Ukil wrote: I have the following data points. data = [1,2,0,9,0,1,4] I like to store in an array and print the odd-indexed points, i.e. 2, 9,1 (considering index starts at 0) You can simply slice your list: >>> data = [1, 2, 0, 9, 0, 1, 4] >>> number_list = data[1::2] >>> number_list [2, 9, 1] See also http://docs.python.org/3/library/stdtypes.html#common-sequence-operations Bye, Andreas ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please Help
I have the following data points. data = [1,2,0,9,0,1,4] I like to store in an array and print the odd-indexed points, i.e. 2, 9,1 (considering index starts at 0) I have written the following code which is not running: import math number_list = [1,2,0,9,0,1,4] number_list_1 = [] for k in range(math.floor(float(len(number_list)/2))): if (k< math.floor(float(len(number_list)/2))): number_list_1[k] = number_list[k*2 + 1] print 'data: ', number_list_1 Please help Regards, Arijit Ukil Tata Consultancy Services Mailto: arijit.u...@tcs.com Website: http://www.tcs.com Experience certainty. IT Services Business Solutions Outsourcing =-=-= Notice: The information contained in this e-mail message and/or attachments to it may contain confidential or privileged information. If you are not the intended recipient, any dissemination, use, review, distribution, printing or copying of the information contained in this e-mail message and/or attachments to it are strictly prohibited. If you have received this communication in error, please notify us by reply e-mail or telephone and immediately and permanently delete the message and any attachments. Thank you ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
On 22/03/13 07:24, Arijit Ukil wrote:
f = open ("digi_2.txt", "r+")
lines = f.readlines()
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
s_data = []
for i in range(len(number_list)):
You hardly ever need to do this, its much simpler to just iterate over
the list items directly:
for number in number_list:
if number_list[i] > 5:
s_data = number_list[i]
Note that you are overwriting your list with a single value.
You need to do what you did above and use append().
*The problem is: it is printing only the last value, not all the values.
In this case '10', **not**'9,8,6,10'.*
Because you overwrote the list each time. You need to remember to append
data to lists not replace the list.
--
Alan G
Author of the Learn to Program web site
http://www.alan-g.me.uk/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
Hi Arijit,
I have modified your program a bit and it is working fine for me. Values
greater than 5 are being printed. Here is the code:
f = open ("D:\\digi_2.txt", "r+") lines = f.readlines() number_list = [] for
line in lines: print line for number in line.split(','):
#number_list.append(float(number))
number_list.append(int(number))
s_data = [] for i in number_list: print i #if number_list[i] > 5:
if(i>5):s_data.append(i)
for x in s_data:print 'Data val:', float(x)
RegardsSuhas
To: tutor@python.org
From: arijit.u...@tcs.com
Date: Fri, 22 Mar 2013 12:54:01 +0530
Subject: [Tutor] Please Help
Hi,
I have another small problem. Pls help.
I have written the following code:
f = open ("digi_2.txt", "r+")
lines = f.readlines()
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
s_data = []
for i in range(len(number_list)):
if number_list[i] >
5:
s_data =
number_list[i]
print 'Data val:', s_data
The problem is: it is printing only
the last value, not all the values. In this case '10', not
'9,8,6,10'.
Regards,
Arijit Ukil
Tata Consultancy Services
Mailto: arijit.u...@tcs.com
Website: http://www.tcs.com
Experience certainty.IT Services
Business Solutions
Outsourcing
____
From:
Amit Saha
To:
Arijit Ukil
Cc:
tutor@python.org
Date:
03/21/2013 05:30 PM
Subject:
Re: [Tutor] Please Help
Hi Arijit,
On Thu, Mar 21, 2013 at 8:42 PM, Arijit Ukil
wrote:
>
> I am new to python. I like to calculate average of the numbers by
reading
> the file 'digi_2.txt'. I have written the following code:
>
> def average(s): return sum(s) * 1.0 / len(s)
>
> f = open ("digi_2.txt", "r+")
>
> list_of_lists1 = f.readlines()
>
>
> for index in range(len(list_of_lists1)):
>
>
> tt = list_of_lists1[index]
>
> print 'Current value :', tt
>
> avg =average (tt)
>
>
> This gives an error:
>
> def average(s): return sum(s) * 1.0 / len(s)
> TypeError: unsupported operand type(s) for +: 'int' and 'str'
>
> I also attach the file i am reading.
>
>
>
> Please help to rectify.
The main issue here is that when you are reading from a file, to
Python, its all strings. And although, 'abc' + 'def' is valid, 'abc' +
5 isn't (for example). Hence, besides the fact that your average
calculation is not right, you will have to 'convert' the string to an
integer/float to do any arithmetic operation on them. (If you know C,
this is similar to typecasting). So, coming back to your program, I
will first demonstrate you a few things and then you can write the
program yourself.
If you were to break down this program into simple steps, they would be:
1. Read the lines from a file (Assume a generic case, where you have
more than one line in the file, and you have to calculate the average
for each such row)
2. Create a list of floating point numbers for each of those lines
3. And call your average function on each of these lists
You could of course do 2 & 3 together, so you create the list and call
the average function.
So, here is step 1:
with open('digi.txt','r') as f:
lines = f.readlines()
Please refer to
http://docs.python.org/2/tutorial/inputoutput.html#methods-of-file-objects
for an explanation of the advantage of using 'with'.
Now, you have *all* the lines of the file in 'lines'. Now, you want to
perform step 2 for each line in this file. Here you go:
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
(To learn more about Python lists, see
http://effbot.org/zone/python-list.htm).
It is certainly possible to
use the index of an element to access elements from a list, but this
is more Pythonic way of doing it. To understand this better, in the
variable 'line', you will have a list of numbers on a single line. For
example: 1350696461, 448.0, 538660.0, 1350696466, 448.0. Note how they
are separated by a ',' ? To get each element, we use the split( )
function, which returns a list of the individual numbers. (See:
http://docs.python.org/2/library/stdtypes.html#str.split).
And then,
we use the .append() method to create the list. Now, you have a
number_list which is a list of floating point numbers for each line.
Now, step 2 & 3 combined:
for line in lines:
[Tutor] Please Help
Hi,
I have another small problem. Pls help.
I have written the following code:
f = open ("digi_2.txt", "r+")
lines = f.readlines()
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
s_data = []
for i in range(len(number_list)):
if number_list[i] > 5:
s_data = number_list[i]
print 'Data val:', s_data
The problem is: it is printing only the last value, not all the values. In
this case '10', not '9,8,6,10'.
Regards,
Arijit Ukil
Tata Consultancy Services
Mailto: arijit.u...@tcs.com
Website: http://www.tcs.com
Experience certainty. IT Services
Business Solutions
Outsourcing
From:
Amit Saha
To:
Arijit Ukil
Cc:
tutor@python.org
Date:
03/21/2013 05:30 PM
Subject:
Re: [Tutor] Please Help
Hi Arijit,
On Thu, Mar 21, 2013 at 8:42 PM, Arijit Ukil wrote:
>
> I am new to python. I like to calculate average of the numbers by
reading
> the file 'digi_2.txt'. I have written the following code:
>
> def average(s): return sum(s) * 1.0 / len(s)
>
> f = open ("digi_2.txt", "r+")
>
> list_of_lists1 = f.readlines()
>
>
> for index in range(len(list_of_lists1)):
>
>
> tt = list_of_lists1[index]
>
> print 'Current value :', tt
>
> avg =average (tt)
>
>
> This gives an error:
>
> def average(s): return sum(s) * 1.0 / len(s)
> TypeError: unsupported operand type(s) for +: 'int' and 'str'
>
> I also attach the file i am reading.
>
>
>
> Please help to rectify.
The main issue here is that when you are reading from a file, to
Python, its all strings. And although, 'abc' + 'def' is valid, 'abc' +
5 isn't (for example). Hence, besides the fact that your average
calculation is not right, you will have to 'convert' the string to an
integer/float to do any arithmetic operation on them. (If you know C,
this is similar to typecasting). So, coming back to your program, I
will first demonstrate you a few things and then you can write the
program yourself.
If you were to break down this program into simple steps, they would be:
1. Read the lines from a file (Assume a generic case, where you have
more than one line in the file, and you have to calculate the average
for each such row)
2. Create a list of floating point numbers for each of those lines
3. And call your average function on each of these lists
You could of course do 2 & 3 together, so you create the list and call
the average function.
So, here is step 1:
with open('digi.txt','r') as f:
lines = f.readlines()
Please refer to
http://docs.python.org/2/tutorial/inputoutput.html#methods-of-file-objects
for an explanation of the advantage of using 'with'.
Now, you have *all* the lines of the file in 'lines'. Now, you want to
perform step 2 for each line in this file. Here you go:
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
(To learn more about Python lists, see
http://effbot.org/zone/python-list.htm). It is certainly possible to
use the index of an element to access elements from a list, but this
is more Pythonic way of doing it. To understand this better, in the
variable 'line', you will have a list of numbers on a single line. For
example: 1350696461, 448.0, 538660.0, 1350696466, 448.0. Note how they
are separated by a ',' ? To get each element, we use the split( )
function, which returns a list of the individual numbers. (See:
http://docs.python.org/2/library/stdtypes.html#str.split). And then,
we use the .append() method to create the list. Now, you have a
number_list which is a list of floating point numbers for each line.
Now, step 2 & 3 combined:
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
print average(number_list)
Where average( ) is defined as:
def average(num_list):
return sum(num_list)/len(num_list)
There may be a number of unknown things I may have talked about, but i
hope the links will help you learn more and write your program now.
Good Luck.
-Amit.
--
http://amitsaha.github.com/
=-=-=
Notice: The information contained in this e-mail
message and/or attachments to it may contain
confidential or privileged information. If you are
not the intended recipient, any dissemination, use,
review, distribution, printing or copying of the
information contained in this e-mail message
and/or attachments to it are strictly prohibited. If
you have received this communication in error,
please notify us by reply e-mail or telephone and
immediately and permanently delete the message
and any attachments. Thank you
1,0,9,0,8,6,0,10___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
On 03/21/2013 08:09 AM, Arijit Ukil wrote: Thanks for the help. You're welcome. You replied privately, instead of including the list, so I'm forwarding the response so everyone can see it. You also top-posted, so the context is backwards. After running your code, I am getting the following error: Traceback (most recent call last): File "C:\Documents and Settings\207564\Desktop\Imp privacy analyzer\New Folder\test\src\test.py", line 53, in ? nums.append(float(numstsrings)) TypeError: float() argument must be a string or a number Check carefully, apparently the copy/paste on your machine inserts extra letters. -- DaveA ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
Hi Arijit,
On Thu, Mar 21, 2013 at 8:42 PM, Arijit Ukil wrote:
>
> I am new to python. I like to calculate average of the numbers by reading
> the file 'digi_2.txt'. I have written the following code:
>
> def average(s): return sum(s) * 1.0 / len(s)
>
> f = open ("digi_2.txt", "r+")
>
> list_of_lists1 = f.readlines()
>
>
> for index in range(len(list_of_lists1)):
>
>
> tt = list_of_lists1[index]
>
> print 'Current value :', tt
>
> avg =average (tt)
>
>
> This gives an error:
>
> def average(s): return sum(s) * 1.0 / len(s)
> TypeError: unsupported operand type(s) for +: 'int' and 'str'
>
> I also attach the file i am reading.
>
>
>
> Please help to rectify.
The main issue here is that when you are reading from a file, to
Python, its all strings. And although, 'abc' + 'def' is valid, 'abc' +
5 isn't (for example). Hence, besides the fact that your average
calculation is not right, you will have to 'convert' the string to an
integer/float to do any arithmetic operation on them. (If you know C,
this is similar to typecasting). So, coming back to your program, I
will first demonstrate you a few things and then you can write the
program yourself.
If you were to break down this program into simple steps, they would be:
1. Read the lines from a file (Assume a generic case, where you have
more than one line in the file, and you have to calculate the average
for each such row)
2. Create a list of floating point numbers for each of those lines
3. And call your average function on each of these lists
You could of course do 2 & 3 together, so you create the list and call
the average function.
So, here is step 1:
with open('digi.txt','r') as f:
lines = f.readlines()
Please refer to
http://docs.python.org/2/tutorial/inputoutput.html#methods-of-file-objects
for an explanation of the advantage of using 'with'.
Now, you have *all* the lines of the file in 'lines'. Now, you want to
perform step 2 for each line in this file. Here you go:
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
(To learn more about Python lists, see
http://effbot.org/zone/python-list.htm). It is certainly possible to
use the index of an element to access elements from a list, but this
is more Pythonic way of doing it. To understand this better, in the
variable 'line', you will have a list of numbers on a single line. For
example: 1350696461, 448.0, 538660.0, 1350696466, 448.0. Note how they
are separated by a ',' ? To get each element, we use the split( )
function, which returns a list of the individual numbers. (See:
http://docs.python.org/2/library/stdtypes.html#str.split). And then,
we use the .append() method to create the list. Now, you have a
number_list which is a list of floating point numbers for each line.
Now, step 2 & 3 combined:
for line in lines:
number_list = []
for number in line.split(','):
number_list.append(float(number))
print average(number_list)
Where average( ) is defined as:
def average(num_list):
return sum(num_list)/len(num_list)
There may be a number of unknown things I may have talked about, but i
hope the links will help you learn more and write your program now.
Good Luck.
-Amit.
--
http://amitsaha.github.com/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
On 03/21/2013 06:42 AM, Arijit Ukil wrote:
I am new to python.
Since you're new to Python, I won't try to supply you an answer using
list comprehensions, since you've probably not learned them yet.
I like to calculate average of the numbers by reading
the file 'digi_2.txt'. I have written the following code:
def average(s): return sum(s) * 1.0 / len(s)
This function presumably expects to be passed a list (or iterable) of
ints or a list of floats as its argument. It'll fail if given a list of
strings. A comment or docstring to that effect would be useful to
remind yourself.
f = open ("digi_2.txt", "r+")
Why is there a "plus sign" in the mode string? Not necessary, since
you're just going to read the file straight through.
list_of_lists1 = f.readlines()
Not a good name, since that's not what readlines() returns. It'll
return a list of strings, each string representing one line of the file.
for index in range(len(list_of_lists1)):
Since your file is only one line long, this loop doesn't do much.
tt = list_of_lists1[index]
print 'Current value :', tt
At this point, It is the string read from the last line of the file.
The other lines are not represented in any way.
avg =average (tt)
This gives an error:
def average(s): return sum(s) * 1.0 / len(s)
TypeError: unsupported operand type(s) for +: 'int' and 'str'
I also attach the file i am reading.
You shouldn't assume everyone can read the "attached" data. Since it's
short, you should just include it in your message. It's MUCH shorter
than all the irrelevant data you included at the end of your message.
For those others who may be reading this portion of the hijacked thread,
here's the one line in digi_2.txt
1350696461, 448.0, 538660.0, 1350696466, 448.0
Now to try to solve the problem. First, you don't specify what the
numbers in the file will look like. Looking at your code, I naturally
assumed you had one value per line. Instead I see a single line with
multiple numbers separated by commas.
I'll assume that the data will always be in a single line, or that if
there are multiple lines, every line but the last will end with a comma,
and that the last one will NOT have a trailing comma. If I don't assume
something, the problem can't be solved.
Since we don't care about newlines, we can read the whole file into one
string, with the read() function.
f = open ("digi_2.txt", "r")
filedata = f.read()
f.close()
Now we have to separate the data by the commas.
numstsrings = filedata.split(",")
And now we have to convert each of these "numstring" values from a
string into a float.
nums = []
for numstring in numstrings:
nums.append(float(numstring))
Now we can call the average function, since we have a list of floats.
avg = average(nums)
Completely untested, so there may be typos in it.
--
DaveA
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please Help
Please trim unrelated text from emails.
On 21 March 2013 10:42, Arijit Ukil wrote:
> I am new to python. I like to calculate average of the numbers by reading
> the file 'digi_2.txt'. I have written the following code:
>
> def average(s): return sum(s) * 1.0 / len(s)
>
> f = open ("digi_2.txt", "r+")
>
> list_of_lists1 = f.readlines()
>
>
> for index in range(len(list_of_lists1)):
>
>
> tt = list_of_lists1[index]
>
> print 'Current value :', tt
>
> avg =average (tt)
>
>
> This gives an error:
>
> def average(s): return sum(s) * 1.0 / len(s)
> TypeError: unsupported operand type(s) for +: 'int' and 'str'
>
tt is a string as it's read from the file. int(tt) would fix the problem.
But in addition you're also not actually calculating the average.
def average(s):
return sum(s) / len(s)
# convert the list of strings to a list of floats
tt = [float(x) for x in list_of_lists1]
avg = average(tt)
--
./Sven
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please Help
I am new to python. I like to calculate average of the numbers by reading
the file 'digi_2.txt'. I have written the following code:
def average(s): return sum(s) * 1.0 / len(s)
f = open ("digi_2.txt", "r+")
list_of_lists1 = f.readlines()
for index in range(len(list_of_lists1)):
tt = list_of_lists1[index]
print 'Current value :', tt
avg =average (tt)
This gives an error:
def average(s): return sum(s) * 1.0 / len(s)
TypeError: unsupported operand type(s) for +: 'int' and 'str'
I also attach the file i am reading.
Please help to rectify.
Regards,
Arijit Ukil
Tata Consultancy Services
Mailto: arijit.u...@tcs.com
Website: http://www.tcs.com
Experience certainty. IT Services
Business Solutions
Outsourcing
From:
Alan Gauld
To:
tutor@python.org
Date:
03/21/2013 06:00 AM
Subject:
Re: [Tutor] Help
Sent by:
"Tutor"
On 20/03/13 19:57, travis jeanfrancois wrote:
> I create a function that allows the user to a create sentence by
> inputing a string and to end the sentence with a period meaning
> inputing "." .The problem is while keeps overwriting the previuos input
'While' does not do any such thing. Your code is doing that all by
itself. What while does is repeat your code until a condition
becomes false or you explicitly break out of the loop.
> Here is my code:
>
> def B1():
Try to give your functions names that describe what they do.
B1() is meaningless, readSentence() would be better.
> period = "."
> # The variable period is assigned
Its normal programming practice to put the comment above
the code not after it. Also comments should indicate why you
are doing something not what you are doing - we can see that
from the code.
> first = input("Enter the first word in your sentence ")
> next1 = input("Enter the next word in you sentence or enter period:")
> # I need store the value so when while overwrites next1 with the next
> input the previous input is stored and will print output when I call it
> later along with last one
> # I believe the solution is some how implenting this expression x = x+
> variable
You could be right. Addition works for strings as well as numbers.
Although there are other (better) options but you may not have covered
them in your class yet.
> while next1 != (period) :
You don;t need the parentheses around period.
Also nextWord might be a better name than next1.
Saving 3 characters of typing is not usually worthwhile.
> next1 = input("Enter the next word in you sentence or enter
period:")
Right, here you are overwriting next1. It's not the while's
fault - it is just repeating your code. It is you who are
overwriting the variable.
Notice that you are not using the first that you captured?
Maybe you should add next1 to first at some point? Then you
can safely overwrite next1 as much as you like?
> if next1 == (period):
Again you don;t need the parentheses around period
> next1 = next1 + period
Here, you add the period to next1 which the 'if' has
already established is now a period.
> print ("Your sentence is:",first,next1,period)
And now you print out the first word plus next1 (= 2 periods) plus a
period = 3 periods in total... preceded by the phrase "Your sentence
is:" This tells us that the sample output you posted is not from this
program... Always match the program and the output when debugging or you
will be led seriously astray!
> PS : The" #" is I just type so I can understand what each line does
The # is a comment marker. Comments are a very powerful tool that
programmers use to explain to themselves and other programmers
why they have done what they have.
When trying to debug faults like this it is often worthwhile
grabbing a pen and drawing a chart of your variables and
their values after each time round the loop.
In this case it would have looked like
iterationperiod first next1
0. I am
1. I a
2. I novice
3. I ..
If you aren't sure of the values insert a print statement
and get the program to tell you, but working it out in
your head is more likely to show you the error.
HTH,
--
Alan G
Author of the Learn to Program web site
http://www.alan-g.me.uk/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
=-=-=
Notice: The information contained in this e-mail
message and/or attachments to it may contain
confidential or privileged information. If you are
not the intended recipient, any dissemination, use,
review, d
Re: [Tutor] Please help
I saw the code; I see too many formatting errors: Line No 24 starts a function definition and the next few lines are indented by two spaces, but Line 29 is a print statement that is in line with the def; IOW it completes the function. It is very likely wrong. You are defining functions within functions; again it is very likely to be wrong. My advice, look at PEP 8 and also some sample python code in the tutorial to understand how to format code. Remember: Leading whitespace is syntactically significant HTH Asokan Pichai Religion offers hope against all the strife and misery of the world caused by religions. ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help
Maybe tomorrow I can just email you the code ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help
On 02/01/13 13:02, Jack Little wrote: I do not understand my error (it says something about an out-of-function return on line 179) You cannot use "return" unless it is inside a function. # This is okay. def test(): print "test" return "testing complete" # indented, therefore inside the function # this is not okay def test(): print "test" return "testing complete" # not indented, therefore not inside the function -- Steven ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help
Jack Little wrote: I do not understand my error (it says something about an out-of-function return on line 179) my code is at the link http://www.mediafire.com/download.php?4ga0weu4ifc6s1u ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor I'd like to help, but I'm not going to download anything from that site. Can you instead post it on gist.github.com or bpaste.com? _Ryan ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please help
I do not understand my error (it says something about an out-of-function return on line 179) my code is at the link http://www.mediafire.com/download.php?4ga0weu4ifc6s1u___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
On 17/11/11 23:12, ADRIAN KELLY wrote: i know i should use input but when i changed to raw_input In Python v3 use input() In python v2 input() is dangerous, use raw_input() instead. > ... it wouldn't recognise the word print on the next line. Show us the exact code and error. You may be missing a parenthesis, or maybe you are just expecting the wrong behaviour... It won't execute the print until after it has read your input. everything to get this working.. i am 6 hrs at one program Heh, I've got one I've been working on for over 10 years, 6 hours is nothing! :-) -- Alan G Author of the Learn to Program web site http://www.alan-g.me.uk/ ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
i know i should use input but when i changed to raw_input it wouldn't recognise
the word print on the next line. honestly i have tried everything to get this
working..i am 6 hrs at one program
Adrian Kelly
1 Bramble Close
Baylough
Athlone
County Westmeath
0879495663
From: waynejwer...@gmail.com
Date: Thu, 17 Nov 2011 16:53:59 -0600
Subject: Re: [Tutor] please help - stuck for hours
To: kellyadr...@hotmail.com
CC: tutor@python.org
On Thu, Nov 17, 2011 at 4:32 PM, ADRIAN KELLY wrote:
thanks very much, great response really really appreciated it and now i
understand. i hate to ask again but can you see why it won't print the 'enter
and amount over 50' in the right place??
Computers are unfailingly stupid machines. They will do whatever wrong thing
you tell them to do every single time.
def main():amount=0while amount<50:amount = input('how
much do you want to change:')
print 'enter an amount over €50: 'else:
total=exchange(amount)print 'Your exchange comes to: ',total
Sometimes it helps writing out the logic in steps before you translate it to
code. In this case my guess is that these are the steps you want:
1. Get a value from the user (you're still using input - stop that, it's
dangerous! input is only a good function in 3.x where it replaces raw_input)
2. If the value is less than 50, tell the user to enter an amount > 50 and
repeat step 1
3. Otherwise, exchange the amount and display that.
Right now, these are the steps that you're doing:
1. Get a value from the user
2. Display the error message
3. If the value is < 50, go to 1
4. exchange the amount
5. display the amount.
HTH,Wayne ___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
On Thu, Nov 17, 2011 at 4:32 PM, ADRIAN KELLY wrote:
>
> thanks very much, great response really really appreciated it and now i
> understand. i hate to ask again but can you see why it won't print the
> 'enter and amount over 50' in the right place??
>
Computers are unfailingly stupid machines. They will do whatever wrong
thing you tell them to do every single time.
>
> def main():
> amount=0
> while amount<50:
> amount = input('how much do you want to change:')
> print 'enter an amount over €50: '
> else:
> total=exchange(amount)
> print 'Your exchange comes to: ',total
>
Sometimes it helps writing out the logic in steps before you translate it
to code. In this case my guess is that these are the steps you want:
1. Get a value from the user (you're still using input - stop that, it's
dangerous! input is only a good function in 3.x where it replaces
raw_input)
2. If the value is less than 50, tell the user to enter an amount > 50
and repeat step 1
3. Otherwise, exchange the amount and display that.
Right now, these are the steps that you're doing:
1. Get a value from the user
2. Display the error message
3. If the value is < 50, go to 1
4. exchange the amount
5. display the amount.
HTH,
Wayne
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
thanks very much, great response really really appreciated it and now i
understand. i hate to ask again but can you see why it won't print the 'enter
and amount over 50' in the right place??
# -*- coding: cp1252 -*-def exchange(cash_in):euro=1dollar=1.35
base=50if cash_in>base:totalreturn=cash_in*dollarelse:
totalreturn=0return totalreturn
def main():amount=0while amount<50:amount = input('how much do
you want to change:')print 'enter an amount over €50: 'else:
total=exchange(amount)print 'Your exchange comes to: ',total main()
Adrian Kelly
1 Bramble Close
Baylough
Athlone
County Westmeath
0879495663
From: waynejwer...@gmail.com
Date: Thu, 17 Nov 2011 15:35:29 -0600
Subject: Re: [Tutor] please help - stuck for hours
To: kellyadr...@hotmail.com
CC: tutor@python.org
On Thu, Nov 17, 2011 at 3:19 PM, ADRIAN KELLY wrote:
i have tried everything, i am trying to build in a loop to my 2 functions which
worked fine up until my latest sorti.
please have a look if you can..
def exchange(cash_in):euro=1dollar=1.35
base=50if cash_in>base:totalreturn=cash_in*dollar
else:totalreturn=0return totalreturn
def main():
amount=""while amount<50:print 'Sorry, cannot convert an amount
under €50 '
amount = input('how much do you want to change:')else:
total=exchange(amount)print 'Your exchange comes to: ',total
main()
Traceback (most recent call last):
File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign exchange\f_ex3.py", line 27, in
main() File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign
exchange\f_ex3.py", line 19, in main
total=exchange(amount) File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign
exchange\f_ex3.py", line 7, in exchangetotalreturn=cash_in*dollar
TypeError: can't multiply sequence by non-int of type 'float'
Thank you for posting the full traceback - this last line tells you the exact
problem - you're trying to multiply a sequence by a float (in this case your
sequence is a string). The line right above that tells you the what you tried
to do: multiply `cash_in` by `dollar`.
Take a look at your code and what do you see? Well, you set `dollar = 1.35`,
and you don't change the value elsewhere so that's certainly a float. What
about cash_in? Well if you work your way backwards through the traceback you
see that it was called with the parameter "amount".
Where is amount set? Ah, on that line:
amount = input()
This line is extremely problematic. First, I see by your print statement that
you're using Python 2.x, so input is actually executing arbitrary code. What
you *want* is raw_input which returns a string and is much MUCH safer.
I don't know what your input value was, but I suspect that you did something
like '30' (with the quotes), because otherwise it would evaluate to an integer.
It's also possible that you used `amount`, which would evaluate to "" since you
already declared it. None of these things are good.
Change your initial assignment to :
amount = 0
and the input line to:
amount = float(raw_input("How much would you like to exchange? "))
This will first get a string from the user and then convert it to a float -
which I suspect you'll want, since you're dealing with monetary
values.HTH,Wayne ___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
Where do you intend the variable cash_in to come from? The system doesn't know what cash_in is beyond that you mentioned it and that makes it impossible to multiply it with dollar which is a float type. If cash_in is supposed to be an input from the user, you probably should make it an int type right away before doing the multiplication. Hope this helps. Cheers. Sent from my BlackBerry wireless device from MTN -Original Message- From: ADRIAN KELLY Sender: tutor-bounces+delegbede=dudupay@python.org Date: Thu, 17 Nov 2011 21:19:45 To: Subject: [Tutor] please help - stuck for hours ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help - stuck for hours
On Thu, Nov 17, 2011 at 3:19 PM, ADRIAN KELLY wrote:
> i have tried everything, i am trying to build in a loop to my 2 functions
> which worked fine up until my latest sorti.
>
> please have a look if you can..
>
> def exchange(cash_in):
> euro=1
> dollar=1.35
> base=50
> if cash_in>base:
> totalreturn=cash_in*dollar
> else:
> totalreturn=0
> return totalreturn
>
>
> def main():
> amount=""
> while amount<50:
> print 'Sorry, cannot convert an amount under €50 '
> amount = input('how much do you want to change:')
> else:
> total=exchange(amount)
> print 'Your exchange comes to: ',total
>
>
> main()
>
>
>
> Traceback (most recent call last):
> File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign exchange\f_ex3.py", line 27,
> in
> main()
> File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign exchange\f_ex3.py", line 19,
> in main
> total=exchange(amount)
> File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign exchange\f_ex3.py", line 7, in
> exchange
> totalreturn=cash_in*dollar
> TypeError: can't multiply sequence by non-int of type 'float'
>
Thank you for posting the full traceback - this last line tells you the
exact problem - you're trying to multiply a sequence by a float (in this
case your sequence is a string). The line right above that tells you the
what you tried to do: multiply `cash_in` by `dollar`.
Take a look at your code and what do you see? Well, you set `dollar =
1.35`, and you don't change the value elsewhere so that's certainly a
float. What about cash_in? Well if you work your way backwards through the
traceback you see that it was called with the parameter "amount".
Where is amount set? Ah, on that line:
amount = input()
This line is extremely problematic. First, I see by your print statement
that you're using Python 2.x, so input is actually executing arbitrary
code. What you *want* is raw_input which returns a string and is much MUCH
safer.
I don't know what your input value was, but I suspect that you did
something like '30' (with the quotes), because otherwise it would evaluate
to an integer. It's also possible that you used `amount`, which would
evaluate to "" since you already declared it. None of these things are good.
Change your initial assignment to :
amount = 0
and the input line to:
amount = float(raw_input("How much would you like to exchange? "))
This will first get a string from the user and then convert it to a float -
which I suspect you'll want, since you're dealing with monetary values.
HTH,
Wayne
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help - stuck for hours
i have tried everything, i am trying to build in a loop to my 2 functions which
worked fine up until my latest sorti.
please have a look if you can..
def exchange(cash_in):euro=1dollar=1.35base=50if cash_in>base:
totalreturn=cash_in*dollarelse:totalreturn=0return
totalreturn
def main():amount=""while amount<50:print 'Sorry, cannot
convert an amount under €50 'amount = input('how much do you want to
change:')else:total=exchange(amount)print 'Your exchange
comes to: ',total main()
Traceback (most recent call last): File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign
exchange\f_ex3.py", line 27, in main() File "F:\VTOS
ATHLONE\PYTHON_VTOS\foreign exchange\f_ex3.py", line 19, in main
total=exchange(amount) File "F:\VTOS ATHLONE\PYTHON_VTOS\foreign
exchange\f_ex3.py", line 7, in exchangetotalreturn=cash_in*dollarTypeError:
can't multiply sequence by non-int of type 'float'>>>
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help understanding unittest fixtures
Steven D'Aprano wrote: > D. Guandalino wrote: >> In this case is there a >> way to force just one setUp() call? > > > I don't know if this is the best way, but the first way that comes to > mind is this: > > > class C(TestCase): > initialised = False > def setUp(self): > if self.initialised: > return > # Make sure you save the flag on the class, not the instance! > self.__class__.initialised = True > ... Python 2.7 and 3.2 support setUpClass()/tearDownClass() classmethods, see http://docs.python.org/library/unittest.html#unittest.TestCase.setUpClass ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help understanding unittest fixtures
D. Guandalino wrote:
Suppose I have this TestCase class.
class C(TestCase):
def setUp():
# very time consuming and resources intensive stuffs.
pass
def test_A(self):
pass
def test_B(self):
pass
def test_C(self):
pass
The unittest docs says:
Each instance of the TestCase will only be used to run a single test
method, so a new fixture is created for each test.
Does this mean that the setUp() method, which is called to prepare the test
fixture, get called for test_A, test_B and test_C?
That's easy enough to find out:
def setUp(self):
print("calling setUp")
...
See how many times "calling setUp" is printed.
In this case is there a
way to force just one setUp() call?
I don't know if this is the best way, but the first way that comes to
mind is this:
class C(TestCase):
initialised = False
def setUp(self):
if self.initialised:
return
# Make sure you save the flag on the class, not the instance!
self.__class__.initialised = True
...
--
Steven
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please help understanding unittest fixtures
Suppose I have this TestCase class. class C(TestCase): def setUp(): # very time consuming and resources intensive stuffs. pass def test_A(self): pass def test_B(self): pass def test_C(self): pass The unittest docs says: > Each instance of the TestCase will only be used to run a single test > method, so a new fixture is created for each test. Does this mean that the setUp() method, which is called to prepare the test fixture, get called for test_A, test_B and test_C? In this case is there a way to force just one setUp() call? Thanks. ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
Start solving the problem by viewing the text around what is being returned. Look at the +- 10-100 characters from what is being returned. Where exactly on the page is the return coming from? Is this centered near where you expected it? If not, what could be causing that? If it is actually close (and not just an error that is returning something that looks close but is actually not related) to what you want then why are the boundaries for the slice not what you expect? Play around with the boundaries and see if you can get it closer. Goldstein's second email has narrowed down some of your problems, if you cannot find it. Since you are doing text matches, be careful of case. What if WAter is typed instead of Water or water (as Andre noted) is typed? Ramit Ramit Prasad | JPMorgan Chase Investment Bank | Currencies Technology 712 Main Street | Houston, TX 77002 work phone: 713 - 216 - 5423 From: tutor-bounces+ramit.prasad=jpmchase@python.org [mailto:tutor-bounces+ramit.prasad=jpmchase@python.org] On Behalf Of I. Dooba Sent: Tuesday, May 17, 2011 11:54 AM To: tutor@python.org Subject: Re: [Tutor] Please help, the program is not behaving as I want Thanks, Joel Goldstick There is no error message. But the program is returning incomplete or too many characters. For example, instead of "Halal" it will return "l Hala" or "nol" depending on the length of the word the user inputs. Since I can't predict the words the user will search for, I'm finding it difficult to tackle the problem. ___ I. Dooba Hybrid Intelligence & Digital Infrastructure Research Group Universiti Teknologi PETRONAS +6014 644 5086 ibraheem_g01...@utp.edu.my<mailto:ibraheem_g01...@utp.edu.my> This communication is for informational purposes only. It is not intended as an offer or solicitation for the purchase or sale of any financial instrument or as an official confirmation of any transaction. All market prices, data and other information are not warranted as to completeness or accuracy and are subject to change without notice. Any comments or statements made herein do not necessarily reflect those of JPMorgan Chase & Co., its subsidiaries and affiliates. This transmission may contain information that is privileged, confidential, legally privileged, and/or exempt from disclosure under applicable law. If you are not the intended recipient, you are hereby notified that any disclosure, copying, distribution, or use of the information contained herein (including any reliance thereon) is STRICTLY PROHIBITED. Although this transmission and any attachments are believed to be free of any virus or other defect that might affect any computer system into which it is received and opened, it is the responsibility of the recipient to ensure that it is virus free and no responsibility is accepted by JPMorgan Chase & Co., its subsidiaries and affiliates, as applicable, for any loss or damage arising in any way from its use. If you received this transmission in error, please immediately contact the sender and destroy the material in its entirety, whether in electronic or hard copy format. Thank you. Please refer to http://www.jpmorgan.com/pages/disclosures for disclosures relating to European legal entities.___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
On Tue, May 17, 2011 at 12:54 PM, I. Dooba wrote: > Thanks, Joel Goldstick > > There is no error message. > But the program is returning incomplete or too many characters. For > example, instead of "Halal" it will return "l Hala" > or "nol" depending on the length of the word the user inputs. > > Since I can't predict the words the user will search for, I'm finding it > difficult to tackle the problem. > ___ > I. Dooba > Hybrid Intelligence & Digital Infrastructure Research Group > Universiti Teknologi PETRONAS > +6014 644 5086 > ibraheem_g01...@utp.edu.my > > > I haven't read the book you are using, so I don't know what lessons they are trying to teach in this example. However, you should be aware that if you read the input into a variable first, then do the .find() method separately on the next line, you can later find out how long the word your user typed (google python length of string if you don't know how). Use this length value to add to the start of your index so that you can start your result at the beginning of Halal or Haram. Then at least, if the word is in your list you will get the answer you expect. > ___ > Tutor maillist - Tutor@python.org > To unsubscribe or change subscription options: > http://mail.python.org/mailman/listinfo/tutor > > -- Joel Goldstick ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
Thanks, Joel Goldstick There is no error message. But the program is returning incomplete or too many characters. For example, instead of "Halal" it will return "l Hala" or "nol" depending on the length of the word the user inputs. Since I can't predict the words the user will search for, I'm finding it difficult to tackle the problem. ___ I. Dooba Hybrid Intelligence & Digital Infrastructure Research Group Universiti Teknologi PETRONAS +6014 644 5086 ibraheem_g01...@utp.edu.my ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
On Tue, May 17, 2011 at 11:20 AM, I. Dooba wrote:
> I'm new to programming and have decided to start with Python following the
> advice of experts including Eric S. Raymond.
> So far I've learnt quite a lot from this list.
>
> However, I've the following problem.
>
> The program was designed (as part of my practice with Head First
> Programming) to check whether an ingredient is Halal or Haram.
> I've a simple table online where some ingredients are either halal or
> haram.
>
You don't have a simple table in this webpage. You should use 'View Source"
from your browser to actually see what your program is reading. What you do
have quite far down are words like this between tags:
Water Halal
Ethanol Halal
Blood Haram
Alcohol Haram
Benzoic Acid Halal
>
> For example, if the user enters "water" the program is supposed to tell him
> that it's halal;
> but it's returning ">" and other characters I don't want to see.
>
> What am I doing wrong?
>
> import urllib.request
>
> this gets access to the webpage
> page = urllib.request.urlopen("
> http://halalingredients.theparleyonline.com/";)
>
this reads the whole page into your text variable
> text = page.read().decode("utf8")
>
>
this lets you type in a word, and uses that word to see if it can find it in
the text. If it does, it returns the index where it finds the start of the
word
> halal_haram_status = text.find(input("Enter the ingredient: "))
>
if it can't find a match it will return -1
This is strange. I believe you want to add the length of the word you input
plus 1 (for the space) to the index you found above.
> begin_final_status = halal_haram_status + 3
>
This is ok since halal and haram are both 5 characters long
> end_final_status = begin_final_status + 5
> status = text[begin_final_status:end_final_status]
> print(status)
>
>
>
Be careful to type the word exactly as printed. If you the a word that is
not in your list, you might get what looks like nonsense since it will just
look to the 5 characters after the word you give it to find
> ___
> Tutor maillist - Tutor@python.org
> To unsubscribe or change subscription options:
> http://mail.python.org/mailman/listinfo/tutor
>
> Since I'm on my lunch break I thought I'd dig into this
--
Joel Goldstick
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
I am not able to check your code (I get an error message about the
usage of urllib, but that might be a difference in Python
installations); however, my first guess is that you neglected to take
case into account: The page contains the text "Water", not "water", so
if you input "water", halal_haram_status will be -1.
As another remark, find() will give the value of the _beginning_ of
the match, thus when all goes right, what is returned will contain
part of the text sought rather than "Halal" or "Haram" - you will get
"er Ha" for water, "anol " for ethanol and "k cho" for pork chops
(also, ethanol is the same as alcohol, so I guess it should be haram).
On Tue, May 17, 2011 at 5:20 PM, I. Dooba wrote:
> I'm new to programming and have decided to start with Python following the
> advice of experts including Eric S. Raymond.
> So far I've learnt quite a lot from this list.
> However, I've the following problem.
> The program was designed (as part of my practice with Head First
> Programming) to check whether an ingredient is Halal or Haram.
> I've a simple table online where some ingredients are either halal or
> haram.
> For example, if the user enters "water" the program is supposed to tell him
> that it's halal;
> but it's returning ">" and other characters I don't want to see.
> What am I doing wrong?
> import urllib.request
> page =
> urllib.request.urlopen("http://halalingredients.theparleyonline.com/";)
> text = page.read().decode("utf8")
>
> halal_haram_status = text.find(input("Enter the ingredient: "))
> begin_final_status = halal_haram_status + 3
> end_final_status = begin_final_status + 5
> status = text[begin_final_status:end_final_status]
> print(status)
>
> ___
> Tutor maillist - Tutor@python.org
> To unsubscribe or change subscription options:
> http://mail.python.org/mailman/listinfo/tutor
>
>
--
André Engels, andreeng...@gmail.com
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help, the program is not behaving as I want
On Tue, May 17, 2011 at 11:20 AM, I. Dooba wrote:
> I'm new to programming and have decided to start with Python following the
> advice of experts including Eric S. Raymond.
> So far I've learnt quite a lot from this list.
>
> However, I've the following problem.
>
> The program was designed (as part of my practice with Head First
> Programming) to check whether an ingredient is Halal or Haram.
> I've a simple table online where some ingredients are either halal or
> haram.
>
> For example, if the user enters "water" the program is supposed to tell him
> that it's halal;
> but it's returning ">" and other characters I don't want to see.
>
> What am I doing wrong?
>
> import urllib.request
>
> page = urllib.request.urlopen("
> http://halalingredients.theparleyonline.com/";)
> text = page.read().decode("utf8")
>
> halal_haram_status = text.find(input("Enter the ingredient: "))
> begin_final_status = halal_haram_status + 3
> end_final_status = begin_final_status + 5
> status = text[begin_final_status:end_final_status]
> print(status)
>
>
> __
Can you copy and paste the error message traceback that you get?
> _
> Tutor maillist - Tutor@python.org
> To unsubscribe or change subscription options:
> http://mail.python.org/mailman/listinfo/tutor
>
>
--
Joel Goldstick
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please help, the program is not behaving as I want
I'm new to programming and have decided to start with Python following the
advice of experts including Eric S. Raymond.
So far I've learnt quite a lot from this list.
However, I've the following problem.
The program was designed (as part of my practice with Head First
Programming) to check whether an ingredient is Halal or Haram.
I've a simple table online where some ingredients are either halal or
haram.
For example, if the user enters "water" the program is supposed to tell him
that it's halal;
but it's returning ">" and other characters I don't want to see.
What am I doing wrong?
import urllib.request
page = urllib.request.urlopen("http://halalingredients.theparleyonline.com/
")
text = page.read().decode("utf8")
halal_haram_status = text.find(input("Enter the ingredient: "))
begin_final_status = halal_haram_status + 3
end_final_status = begin_final_status + 5
status = text[begin_final_status:end_final_status]
print(status)
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me
Please reply on-list unless you really need to speak to me off-list. Use "reply-all" to reply to everyone. Tutor doesn't work in that you get one of us as a tutor and we help you with every problem you have. For this mailing list you e-mail us a specific problem and everyone collaborates to guide you through it. When we say "specific problem" we mean "you have coded a solution that looks to you like it would work but it doesn't and you're stuck" and then we'll help you figure out why you're stuck and what you need to do to fix the program. (P.S. Sorry for the top-post, I'm not sure how to reply in-line to a forwarded message.) -- Forwarded message -- From: invincible patriot Date: Sun, Jan 31, 2010 at 4:05 AM Subject: RE: [Tutor] please help me To: rabidpoob...@gmail.com m sorry but i am not asking u to solve these for me rather i send all the questions to u just to let u know what i want to do n now i m looking froward for ur guidance so that i can write programme for thhem i think itz fair enough to ask what should i do, but i am not asking u to solve them for me m just looking forward for some help -- From: rabidpoob...@gmail.com Date: Sat, 30 Jan 2010 19:39:05 -0600 Subject: Re: [Tutor] please help me To: invincible_patr...@hotmail.com CC: tutor@python.org [snip homework] please help me This is a tutor mailing list. Tutor means we will help you learn, not that we will write your homework assignments for you for free. That is the opposite of learning. Try all of the programs. Give us what you have tried and what didn't work, why you thought it would work, why you think it didn't work, and anything else helpful (eg. if you get an error message include the whole traceback, don't paraphrase it.) In other words, if you don't have code that you've tried and a specific problem you're having, you're not going to get a reply. We're busy people, make it easy for us to help you. -Luke -- Your E-mail and More On-the-Go. Get Windows Live Hotmail Free. Sign up now.<http://clk.atdmt.com/GBL/go/196390709/direct/01/> ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me
[snip homework] > > > please help me > > This is a tutor mailing list. Tutor means we will help you learn, not that we will write your homework assignments for you for free. That is the opposite of learning. Try all of the programs. Give us what you have tried and what didn't work, why you thought it would work, why you think it didn't work, and anything else helpful (eg. if you get an error message include the whole traceback, don't paraphrase it.) In other words, if you don't have code that you've tried and a specific problem you're having, you're not going to get a reply. We're busy people, make it easy for us to help you. -Luke ___ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me
hii am stuck in these questions can someone please help me in solving and
writing programme for these tasks
please help me
1 1.1 Write a Python program with a loop that prints out a sequence of numbers
as follows:151311...31-1
1.2 Write a small Python program that generates the list of all pairs of
characters c andits doubling 2 c, where c moves through all the letters of
the string "foobar" and prints it out.The result will look like:[(’f’, ’ff’),
(’o’, ’oo’), (’o’, ’oo’), (’b’, ’bb’), (’a’, ’aa’), (’r’, ’rr’)]Hint: use list
comprehensions.
1.3 Write a small Python program that
1. prints out the length of the
string’taumatawhakatangihangakoauauotamateaturipukakapikimaungahoronukupokaiwhenuakitanatahu’
2. prints out how many different characters this string contains
3. replaces all the non-’t’ characters in above string with dots ’.’. So, if
the word were’tattoo’, it would print ’t.tt..’.Hints:
(a) use a function to t-ify the string
(b) there are various ways to construct the string, either using the join
method or by runninga loop accumulating substrings.
(c) check also out what happens if you apply the conversion list(s) to a string
s.
2 2.1 Write a function count char(s, c) that takes a string s, and a character
c and returnshow often the character c appears in the string.For example
count_char("tattoo", "t") should return 3.
2.2 Write a Python function char_freqency(s)that returns a dictionary which,
for eachcharacter of s as a key, stores as value how often this character
appears.For example, char_frequency("tattoo") could return {’a’: 1, ’t’: 3,
’o’: 2} (the order ofkey:value pairs does not matter here).
Hint: Consider using the function count_char defined in 2.1.
2.3 Write a program that translates a given string (of arbitrary length) of DNA
bases intothe RNA strand that it will produce. For this, research which DNA
bases correspond to RNA basesand create a translation table (not an if...else
clause!) in the Python program. [4 marks]
3
3.1 consider the following list of base
sequences:ACGTACCTTACTTACCATATCGTACCTCTTACTCATThe task consists of writing a
Python program that performs a simple alignment algorithm onthese two strings
and prints out this alignment in a suitable readable form. Give a brief
commentexplaining the output format.Hints:1. Matching means the following: for
a given sequence to be matched, your program should denotewhich bases
correspond to bases in the reference sequence and which do not; in addition,
markgaps where the reference sequence contains bases which are not present in
the sample sequence.For a given sample sequence, your matching algorithm will
attempt to match as many basesas possible to those of the reference sequence.2.
This is a difficult assignment. Do not attempt it before you have solved the
others.3. For this purpose, you are allowed to research and implement publicly
documented versions ofthe Needleman-Wunsch algorithm or similar algorithms
(however, make sure that you refer-ence them properly!). Also make sure that
your program prints out the matches/mismatchesbetween the sequences. You should
demonstrate at least two different alignments by usingdifferent gap
penalties.Instead of following this hint, you can develop an alternative
solution to the matching problem,e.g. based on the Levenshtein distance.
please help me
_
Hotmail: Trusted email with Microsoft’s powerful SPAM protection.
http://clk.atdmt.com/GBL/go/196390706/direct/01/___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me
On 6/18/2009 1:30 AM suzee Eslam said... to every one help me please .. i need the code to do chatting by python in mobiles over bluetooth technology .. i need it please if any one know it send it to me as soon as possible.. thanks for all. Maybe this will get you started... http://www.mobilenin.com/mobilepythonbook/examples/057-btchat.html Emile ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me
to every one help me please .. i need the code to do chatting by python in mobiles over bluetooth technology .. i need it please if any one know it send it to me as soon as possible.. thanks for all. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
"aivars" <[EMAIL PROTECTED]> wrote Please try what sqlite3.version shows on your machine? I also have ActiveState's python (mainly for its very good doc) and I get: >>> import sqlite3 sqlite3.sqlite_version '3.3.4' Me too with Python 2.5.1 from Activestate. Alan G ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
Hello, Denis, Please try what sqlite3.version shows on your machine? Thanks aivars 2008/11/7 spir <[EMAIL PROTECTED]>: > aivars a écrit : >> >> Thanks, John, >> Yes it seems you are right. The ActiveState python version I have >> installed have sqlite 2.3.2 only. I find it strange. > > I also have ActiveState's python (mainly for its very good doc) and I get: >>> import sqlite3 sqlite3.sqlite_version > '3.3.4' > > Denis > > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
"aivars" <[EMAIL PROTECTED]> wrote Yes it seems you are right. The ActiveState python version I have installed have sqlite 2.3.2 only. I find it strange. Why? SQLite is a separate product. Python bundled the then current version in its standard distribution, but time has moved on. You have apparently installed a more recent version of SQLite. I see that on a python website there is is a new version Python26 2.6 may or may not have the same version as you but regardless you should be able to get the older version of Python to work with the newer SQLite instal;l, provided the newer version has a Python library available - which it usually has. Mark Hammonds PythonWin to get other things for windows? Or maybe I will reinstall ActiveState Python25 and install Python25 from the official website I don't thing the vanilla Python will make any difference. SQLite is bundled with Python not with ActiveState. Copying dll to c:\python25\DLLs directory did not help - it still shows version sqlite version 2.3.2. which I also do not understand why I think you might need to install more than the DLL. Check the SQLite web site for a new Ptython interface and install that version. Alan G. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
John, just to add to my previous post. after copying sqlite3.dll (3.6.2) version into Python25\DLLs directory and running import sqlite3 dir(sqlite3) >>> sqlite3.version '2.3.2' >>> sqlite3.version_info (2, 3, 2) >>> sqlite3.sqlite_version_info (3, 6, 2) >>> sqlite3.sqlite_version '3.6.2' and now my scrip happily runs with sqlite replace function. I am just curious why there are so many different version properties and why now they differ from sqlite3.version? Of course it seems Python now is running sqlite version 3.6.2 since my script accepts replace function Thanks, Aivars 2008/11/7 aivars <[EMAIL PROTECTED]>: > Thanks, John, > Yes it seems you are right. The ActiveState python version I have > installed have sqlite 2.3.2 only. I find it strange. > I see that on a python website there is is a new version Python26 > relesed. Should i go on and install Python26? I understand that I can > install pure Python from python website and after that I can install > Mark Hammonds PythonWin to get other things for windows? Or maybe I > will reinstall ActiveState Python25 and install Python25 from the > official website > > Copying dll to c:\python25\DLLs directory did not help - it still > shows version sqlite version 2.3.2. which I also do not understand why > > Re user defined function - it is one of the ways to go probably > quickest but I would like to have newer version of sqlite being > already with python > > I am noob in Python still > > Thanks for your input > > Aivars > > > > 2008/11/6 John Fouhy <[EMAIL PROTECTED]>: >> 2008/11/7 aivars <[EMAIL PROTECTED]>: >>> I use python 2.5.2.2 (activestate), WinXP, sqlite version 3.6.2 >> >> Hi Aivars, >> >> I believe python has its own built-in sqlite, rather than using the >> version you installed independently. So it is possible that the >> python version of sqlite is older than 3.6.2 and does not yet have the >> replace() function. >> >> (run 'import sqlite3' and then examine 'sqlite3.sqlite_version' to see >> what version you are using) >> >> You could try replacing sqlite3.dll in your python25\dlls directory >> with the DLL from your sqlite installation (make a backup first :-) ). >> Alternatively, you could define the replace() function in python and >> then add it to your database: see >> http://www.initd.org/pub/software/pysqlite/doc/usage-guide.html#creating-user-defined-functions >> . >> >> HTH. >> >> -- >> John. >> > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
Thanks, John, Yes it seems you are right. The ActiveState python version I have installed have sqlite 2.3.2 only. I find it strange. I see that on a python website there is is a new version Python26 relesed. Should i go on and install Python26? I understand that I can install pure Python from python website and after that I can install Mark Hammonds PythonWin to get other things for windows? Or maybe I will reinstall ActiveState Python25 and install Python25 from the official website Copying dll to c:\python25\DLLs directory did not help - it still shows version sqlite version 2.3.2. which I also do not understand why Re user defined function - it is one of the ways to go probably quickest but I would like to have newer version of sqlite being already with python I am noob in Python still Thanks for your input Aivars 2008/11/6 John Fouhy <[EMAIL PROTECTED]>: > 2008/11/7 aivars <[EMAIL PROTECTED]>: >> I use python 2.5.2.2 (activestate), WinXP, sqlite version 3.6.2 > > Hi Aivars, > > I believe python has its own built-in sqlite, rather than using the > version you installed independently. So it is possible that the > python version of sqlite is older than 3.6.2 and does not yet have the > replace() function. > > (run 'import sqlite3' and then examine 'sqlite3.sqlite_version' to see > what version you are using) > > You could try replacing sqlite3.dll in your python25\dlls directory > with the DLL from your sqlite installation (make a backup first :-) ). > Alternatively, you could define the replace() function in python and > then add it to your database: see > http://www.initd.org/pub/software/pysqlite/doc/usage-guide.html#creating-user-defined-functions > . > > HTH. > > -- > John. > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with sqlite replace function
2008/11/7 aivars <[EMAIL PROTECTED]>: > I use python 2.5.2.2 (activestate), WinXP, sqlite version 3.6.2 Hi Aivars, I believe python has its own built-in sqlite, rather than using the version you installed independently. So it is possible that the python version of sqlite is older than 3.6.2 and does not yet have the replace() function. (run 'import sqlite3' and then examine 'sqlite3.sqlite_version' to see what version you are using) You could try replacing sqlite3.dll in your python25\dlls directory with the DLL from your sqlite installation (make a backup first :-) ). Alternatively, you could define the replace() function in python and then add it to your database: see http://www.initd.org/pub/software/pysqlite/doc/usage-guide.html#creating-user-defined-functions . HTH. -- John. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help with sqlite replace function
Hello, I am stuck now. I have a sqlite database with a table calendar (which is an auxilary calendar table containing dates, years, months, days) >From sqlite prompt I can run the following query without any problem: SELECT replace( datums,'-','' ) FROM calendar where Y='2008' and M='5' It gives me back date strings in the format MMDD. But when I run it from the python script it gives me the following error: sqlite3.OperationalError: no such function: replace. Script is simple as follows: import sqlite3 spath=r'e:\pythonexamples\aivars2.db' sql="SELECT replace(datums,'-','') FROM Calendar where Y='2008' and M='5'" cn=sqlite3.connect(spath) for row in cn.execute(sql): print row[0] When I run the script without the replace function in select statement it runs OK. I use python 2.5.2.2 (activestate), WinXP, sqlite version 3.6.2 Thanks for any tip. maybe I should ask this to sqlite mailing list? Aivars ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
aivars wrote: Hello, Lie, I renamed the directory back to Cgi-bin and the scripts are NOT working. Going back to cgi-bin it works. I also do not understand why. Aivars 2008/10/26 Lie Ryan <[EMAIL PROTECTED]>: On Sun, 26 Oct 2008 08:32:52 +, Alan Gauld wrote: "aivars" <[EMAIL PROTECTED]> wrote in message news:[EMAIL PROTECTED] I finally get the script working! I renamed the script directory from Cgi-bin to cgi-bin just as Alan told. I'm glad it worked but I confess I'm not sure why it worked. The interpreter was apparently finding your script OK but it was the environment that was messed up. I don't fully understand the interaction going on there. But in things web related I've learned that consistency throughout is usually helpul! Alan G. I wouldn't have thought it could work, since Windows is case insensitive and web server is required understand URL as case insensitive. Why that Cgi-bin and cgi-bin differs on a windows-based server is beyond me. Why do you think web servers are required to understand URLs as case insensitive? This is not the case (other than the domain name itself). ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
Hello, Lie, I renamed the directory back to Cgi-bin and the scripts are NOT working. Going back to cgi-bin it works. I also do not understand why. Aivars 2008/10/26 Lie Ryan <[EMAIL PROTECTED]>: > On Sun, 26 Oct 2008 08:32:52 +, Alan Gauld wrote: > >> "aivars" <[EMAIL PROTECTED]> wrote in message >> news:[EMAIL PROTECTED] >>>I finally get the script working! >>> >>> I renamed the script directory from Cgi-bin to cgi-bin just as Alan >>> told. >> >> I'm glad it worked but I confess I'm not sure why it worked. The >> interpreter was apparently finding your script OK but it was the >> environment that was messed up. I don't fully understand the interaction >> going on there. But in things web related I've learned that consistency >> throughout is usually helpul! >> >> Alan G. >> > > I wouldn't have thought it could work, since Windows is case insensitive > and web server is required understand URL as case insensitive. Why that > Cgi-bin and cgi-bin differs on a windows-based server is beyond me. > > ___ > Tutor maillist - Tutor@python.org > http://mail.python.org/mailman/listinfo/tutor > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
On Sun, 26 Oct 2008 08:32:52 +, Alan Gauld wrote: > "aivars" <[EMAIL PROTECTED]> wrote in message > news:[EMAIL PROTECTED] >>I finally get the script working! >> >> I renamed the script directory from Cgi-bin to cgi-bin just as Alan >> told. > > I'm glad it worked but I confess I'm not sure why it worked. The > interpreter was apparently finding your script OK but it was the > environment that was messed up. I don't fully understand the interaction > going on there. But in things web related I've learned that consistency > throughout is usually helpul! > > Alan G. > I wouldn't have thought it could work, since Windows is case insensitive and web server is required understand URL as case insensitive. Why that Cgi-bin and cgi-bin differs on a windows-based server is beyond me. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
"aivars" <[EMAIL PROTECTED]> wrote in message news:[EMAIL PROTECTED] I finally get the script working! I renamed the script directory from Cgi-bin to cgi-bin just as Alan told. I'm glad it worked but I confess I'm not sure why it worked. The interpreter was apparently finding your script OK but it was the environment that was messed up. I don't fully understand the interaction going on there. But in things web related I've learned that consistency throughout is usually helpul! Alan G. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
I finally get the script working! I renamed the script directory from Cgi-bin to cgi-bin just as Alan told. Many thanks to all you who responded Aivars 2008/10/26 aivars <[EMAIL PROTECTED]>: > Thanks John and Alan > > I get the following error when I run the script from IDLE: > > Traceback (most recent call last): > File "C:\Cgi-bin\friends1.py", line 15, in >who = form['person'].value > File "C:\Python25\lib\cgi.py", line 567, in __getitem__ >raise KeyError, key > KeyError: 'person' > > > Aivars > Windows XP, python 2.5 > > 2008/10/26 John Pomni <[EMAIL PROTECTED]>: >> what error do you get? It works without any changes on my Linux machine >> with python 2.5 >> >> John >> >> On Sat, 2008-10-25 at 21:33 +0300, aivars wrote: >>> It does not work neither as script or from command line. I will try to >>> find the guy Wesley Chun and ask him >>> >>> 2008/10/25 John Pomni <[EMAIL PROTECTED]>: >>> > Hi, >>> > >>> > The script does not work from command line but I guess you do not have >>> > any problems running it as CGI? >>> > >>> > I like cgitb modules for debugging purposes very much. >>> > >>> > http://www.python.org/doc/2.5.2/lib/node566.html >>> > >>> > Jan >>> > >>> > On Fri, 2008-10-24 at 18:55 +0300, aivars wrote: >>> >> Thanks very much, Kent, >>> >> >>> >> So it seems that directory /cgi-bin should be a subdirectory to that >>> >> directory from which the web server was started/is running. That >>> >> worked and Deitel's script - getting time displayed finally worked. >>> >> >>> >> still banging mu head with Wesley Chun's simple example - >>> >> >>> >> #!C:\python25\python.exe >>> >> >>> >> import cgi >>> >> >>> >> reshtml = '''Content-Type: text/html\n >>> >> >>> >> Friends CGI Demo (dynamic screen) >>> >> >>> >> Friends list for: %s >>> >> Your name is: %s >>> >> You have %s friends. >>> >> ''' >>> >> >>> >> form = cgi.FieldStorage() >>> >> who = form['person'].value >>> >> howmany = form['howmany'].value >>> >> print reshtml % (who, who, howmany) >>> >> >>> >> It gives me the following error: >>> >> Traceback (most recent call last): >>> >> File "C:\Cgi-bin\friends1.py", line 15, in >>> >> who = form['person'].value >>> >> File "C:\Python25\lib\cgi.py", line 567, in __getitem__ >>> >> raise KeyError, key >>> >> KeyError: 'person' >>> >> >>> >> I understand python is saying that there is no such a key in a directory. >>> >> >>> >> The HTML form looks like this. it is displayed correctly both in FF and >>> >> IE >>> >> >>> >> >>> >> >>> >> Friends CGI Demo (static screen) >>> >> >>> >> Friends list for: NEW USER >>> >> >>> >> Enter your Name: >>> >> >>> >>How many friends do you have? >>> >> 0 >>> >>10 >>> >>25 >>> >>50 >>> >>100 >>> >> >>> >> >>> >> Thanks again, >>> >> >>> >> Aivars >>> >> >>> >> >>> >> >>> >> >>> >> >>> >> >>> >> 2008/10/24 Kent Johnson <[EMAIL PROTECTED]>: >>> >> > On Fri, Oct 24, 2008 at 10:25 AM, aivars <[EMAIL PROTECTED]> wrote: >>> >> >> Hello, >>> >> >> >>> >> >> I am learning python. >>> >> >> >>> >> >> I start the python CGI server like this: >>> >> >> >>> >> >> python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core >>> >> >> Python Programming chapter 20.5) >>> >> >> >>> >> >> The server starts in command prompt on windows XP by answering: >>> >> >> Serving HTTP on 0.0.0.0 port 8000... >>> >> >> >>> >> >> Next I want to run this simple CGI script (from Deitel Python How to >>> >> >> Program chapter 6). it is supposed to print out current date and time >>> >> >> in a browser >>> >> > >>> >> > The CGI script should me in a /cgi-bin subdirectory of the dir where >>> >> > you run the script. The URL to run the CGI will then be something like >>> >> > http:://localhost:8000/cgi-bin/myscript.py >>> >> > >>> >> > Kent >>> >> > >>> >> ___ >>> >> Tutor maillist - Tutor@python.org >>> >> http://mail.python.org/mailman/listinfo/tutor >>> > >>> > >> >> > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
Thanks John and Alan I get the following error when I run the script from IDLE: Traceback (most recent call last): File "C:\Cgi-bin\friends1.py", line 15, in who = form['person'].value File "C:\Python25\lib\cgi.py", line 567, in __getitem__ raise KeyError, key KeyError: 'person' Aivars Windows XP, python 2.5 2008/10/26 John Pomni <[EMAIL PROTECTED]>: > what error do you get? It works without any changes on my Linux machine > with python 2.5 > > John > > On Sat, 2008-10-25 at 21:33 +0300, aivars wrote: >> It does not work neither as script or from command line. I will try to >> find the guy Wesley Chun and ask him >> >> 2008/10/25 John Pomni <[EMAIL PROTECTED]>: >> > Hi, >> > >> > The script does not work from command line but I guess you do not have >> > any problems running it as CGI? >> > >> > I like cgitb modules for debugging purposes very much. >> > >> > http://www.python.org/doc/2.5.2/lib/node566.html >> > >> > Jan >> > >> > On Fri, 2008-10-24 at 18:55 +0300, aivars wrote: >> >> Thanks very much, Kent, >> >> >> >> So it seems that directory /cgi-bin should be a subdirectory to that >> >> directory from which the web server was started/is running. That >> >> worked and Deitel's script - getting time displayed finally worked. >> >> >> >> still banging mu head with Wesley Chun's simple example - >> >> >> >> #!C:\python25\python.exe >> >> >> >> import cgi >> >> >> >> reshtml = '''Content-Type: text/html\n >> >> >> >> Friends CGI Demo (dynamic screen) >> >> >> >> Friends list for: %s >> >> Your name is: %s >> >> You have %s friends. >> >> ''' >> >> >> >> form = cgi.FieldStorage() >> >> who = form['person'].value >> >> howmany = form['howmany'].value >> >> print reshtml % (who, who, howmany) >> >> >> >> It gives me the following error: >> >> Traceback (most recent call last): >> >> File "C:\Cgi-bin\friends1.py", line 15, in >> >> who = form['person'].value >> >> File "C:\Python25\lib\cgi.py", line 567, in __getitem__ >> >> raise KeyError, key >> >> KeyError: 'person' >> >> >> >> I understand python is saying that there is no such a key in a directory. >> >> >> >> The HTML form looks like this. it is displayed correctly both in FF and IE >> >> >> >> >> >> >> >> Friends CGI Demo (static screen) >> >> >> >> Friends list for: NEW USER >> >> >> >> Enter your Name: >> >> >> >>How many friends do you have? >> >> 0 >> >>10 >> >>25 >> >>50 >> >>100 >> >> >> >> >> >> Thanks again, >> >> >> >> Aivars >> >> >> >> >> >> >> >> >> >> >> >> >> >> 2008/10/24 Kent Johnson <[EMAIL PROTECTED]>: >> >> > On Fri, Oct 24, 2008 at 10:25 AM, aivars <[EMAIL PROTECTED]> wrote: >> >> >> Hello, >> >> >> >> >> >> I am learning python. >> >> >> >> >> >> I start the python CGI server like this: >> >> >> >> >> >> python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core >> >> >> Python Programming chapter 20.5) >> >> >> >> >> >> The server starts in command prompt on windows XP by answering: >> >> >> Serving HTTP on 0.0.0.0 port 8000... >> >> >> >> >> >> Next I want to run this simple CGI script (from Deitel Python How to >> >> >> Program chapter 6). it is supposed to print out current date and time >> >> >> in a browser >> >> > >> >> > The CGI script should me in a /cgi-bin subdirectory of the dir where >> >> > you run the script. The URL to run the CGI will then be something like >> >> > http:://localhost:8000/cgi-bin/myscript.py >> >> > >> >> > Kent >> >> > >> >> ___ >> >> Tutor maillist - Tutor@python.org >> >> http://mail.python.org/mailman/listinfo/tutor >> > >> > > > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
"aivars" <[EMAIL PROTECTED]> wrote still banging mu head with Wesley Chun's simple example - I'm not sure if this is significant but It gives me the following error: Traceback (most recent call last): File "C:\Cgi-bin\friends1.py", line 15, in Notice that the file path has Cgi not cgi Case may be significant... The action expects cgi Just a thought. -- Alan Gauld Author of the Learn to Program web site http://www.freenetpages.co.uk/hp/alan.gauld ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
It does not work neither as script or from command line. I will try to find the guy Wesley Chun and ask him 2008/10/25 John Pomni <[EMAIL PROTECTED]>: > Hi, > > The script does not work from command line but I guess you do not have > any problems running it as CGI? > > I like cgitb modules for debugging purposes very much. > > http://www.python.org/doc/2.5.2/lib/node566.html > > Jan > > On Fri, 2008-10-24 at 18:55 +0300, aivars wrote: >> Thanks very much, Kent, >> >> So it seems that directory /cgi-bin should be a subdirectory to that >> directory from which the web server was started/is running. That >> worked and Deitel's script - getting time displayed finally worked. >> >> still banging mu head with Wesley Chun's simple example - >> >> #!C:\python25\python.exe >> >> import cgi >> >> reshtml = '''Content-Type: text/html\n >> >> Friends CGI Demo (dynamic screen) >> >> Friends list for: %s >> Your name is: %s >> You have %s friends. >> ''' >> >> form = cgi.FieldStorage() >> who = form['person'].value >> howmany = form['howmany'].value >> print reshtml % (who, who, howmany) >> >> It gives me the following error: >> Traceback (most recent call last): >> File "C:\Cgi-bin\friends1.py", line 15, in >> who = form['person'].value >> File "C:\Python25\lib\cgi.py", line 567, in __getitem__ >> raise KeyError, key >> KeyError: 'person' >> >> I understand python is saying that there is no such a key in a directory. >> >> The HTML form looks like this. it is displayed correctly both in FF and IE >> >> >> >> Friends CGI Demo (static screen) >> >> Friends list for: NEW USER >> >> Enter your Name: >> >>How many friends do you have? >> 0 >>10 >>25 >>50 >>100 >> >> >> Thanks again, >> >> Aivars >> >> >> >> >> >> >> 2008/10/24 Kent Johnson <[EMAIL PROTECTED]>: >> > On Fri, Oct 24, 2008 at 10:25 AM, aivars <[EMAIL PROTECTED]> wrote: >> >> Hello, >> >> >> >> I am learning python. >> >> >> >> I start the python CGI server like this: >> >> >> >> python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core >> >> Python Programming chapter 20.5) >> >> >> >> The server starts in command prompt on windows XP by answering: >> >> Serving HTTP on 0.0.0.0 port 8000... >> >> >> >> Next I want to run this simple CGI script (from Deitel Python How to >> >> Program chapter 6). it is supposed to print out current date and time >> >> in a browser >> > >> > The CGI script should me in a /cgi-bin subdirectory of the dir where >> > you run the script. The URL to run the CGI will then be something like >> > http:://localhost:8000/cgi-bin/myscript.py >> > >> > Kent >> > >> ___ >> Tutor maillist - Tutor@python.org >> http://mail.python.org/mailman/listinfo/tutor > > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
Thanks very much, Kent, So it seems that directory /cgi-bin should be a subdirectory to that directory from which the web server was started/is running. That worked and Deitel's script - getting time displayed finally worked. still banging mu head with Wesley Chun's simple example - #!C:\python25\python.exe import cgi reshtml = '''Content-Type: text/html\n Friends CGI Demo (dynamic screen) Friends list for: %s Your name is: %s You have %s friends. ''' form = cgi.FieldStorage() who = form['person'].value howmany = form['howmany'].value print reshtml % (who, who, howmany) It gives me the following error: Traceback (most recent call last): File "C:\Cgi-bin\friends1.py", line 15, in who = form['person'].value File "C:\Python25\lib\cgi.py", line 567, in __getitem__ raise KeyError, key KeyError: 'person' I understand python is saying that there is no such a key in a directory. The HTML form looks like this. it is displayed correctly both in FF and IE Friends CGI Demo (static screen) Friends list for: NEW USER Enter your Name: How many friends do you have? 0 10 25 50 100 Thanks again, Aivars 2008/10/24 Kent Johnson <[EMAIL PROTECTED]>: > On Fri, Oct 24, 2008 at 10:25 AM, aivars <[EMAIL PROTECTED]> wrote: >> Hello, >> >> I am learning python. >> >> I start the python CGI server like this: >> >> python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core >> Python Programming chapter 20.5) >> >> The server starts in command prompt on windows XP by answering: >> Serving HTTP on 0.0.0.0 port 8000... >> >> Next I want to run this simple CGI script (from Deitel Python How to >> Program chapter 6). it is supposed to print out current date and time >> in a browser > > The CGI script should me in a /cgi-bin subdirectory of the dir where > you run the script. The URL to run the CGI will then be something like > http:://localhost:8000/cgi-bin/myscript.py > > Kent > ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help with simple python CGI script
On Fri, Oct 24, 2008 at 10:25 AM, aivars <[EMAIL PROTECTED]> wrote: > Hello, > > I am learning python. > > I start the python CGI server like this: > > python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core > Python Programming chapter 20.5) > > The server starts in command prompt on windows XP by answering: > Serving HTTP on 0.0.0.0 port 8000... > > Next I want to run this simple CGI script (from Deitel Python How to > Program chapter 6). it is supposed to print out current date and time > in a browser The CGI script should me in a /cgi-bin subdirectory of the dir where you run the script. The URL to run the CGI will then be something like http:://localhost:8000/cgi-bin/myscript.py Kent ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help with simple python CGI script
Hello,
I am learning python.
I start the python CGI server like this:
python -m CGIHTTPServer (this syntax I saw in Wesley Chun's Core
Python Programming chapter 20.5)
The server starts in command prompt on windows XP by answering:
Serving HTTP on 0.0.0.0 port 8000...
Next I want to run this simple CGI script (from Deitel Python How to
Program chapter 6). it is supposed to print out current date and time
in a browser
#!C:\python25\python.exe
import time
def printHeader(title):
print """Content-type: text/html
http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd";>
http://www.w3.org/1999/xhtml"; >
%s
""" % title
printHeader("Current date and time")
print time.ctime(time.time())
print ""
And The server prints the script text in the browser. It does not run
the script.
The server response is 200.
The script itself runs OK if being run from python/command line
I also could not run the script from wesley chun's book. I think also
because it seems the python cgi web server does not understand that it
should run the script and not to print it out in web browser
I am using python 2.5 on windows XP.
What I am missing?
Thanks
Aivars
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help formating
Just for fun, here is a parser written with pyparsing. It treats
newlines as whitespace so it will work with the split data you posted.
http://pyparsing.wikispaces.com/
data = '''(39577484, 39577692) [['NM_003750']]
(107906, 108011) [['NM_002443']]
(113426, 113750) [['NM_138634', 'NM_002443']]
(106886, 106991) [['NM_138634', 'NM_002443']]
(100708, 100742) [['NM_138634', 'NM_002443']]
(35055935, 35056061) [['NM_002313', 'NM_001003407',
'NM_001003408']]
'''
from pyparsing import *
keys = Suppress('(') + Word(nums) + Suppress(',') + Word(nums) +
Suppress(')')
values = Group(Suppress('[[') +
delimitedList(sglQuotedString.setParseAction(removeQuotes)) +
Suppress(']]'))
expr = keys + values
for result, start, end in expr.scanString(data):
print '%s %s\t%s' % (result[0], result[1], ','.join(result[2]))
Kent
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help formating
kumar s wrote:
> hi group,
>
> i have a data obtained from other student(over 100K)
> lines that looks like this:
> (39577484, 39577692) [['NM_003750']]
> (107906, 108011) [['NM_002443']]
> (113426, 113750) [['NM_138634', 'NM_002443']]
> (106886, 106991) [['NM_138634', 'NM_002443']]
> (100708, 100742) [['NM_138634', 'NM_002443']]
> (35055935, 35056061) [['NM_002313', 'NM_001003407',
> 'NM_001003408']]
>
> I know that first two items in () are tuples, and the
> next [[]] a list of list. I was told that the tuples
> were keys and the list was its value in a dictionary.
>
> how can I parse this into a neat structure that looks
> like this:
> 39577484, 39577692 \t NM_003750
> 107906, 108011 \t NM_002443
> 113426, 113750 \t NM_138634,NM_002443
> 106886, 106991 \t NM_138634,NM_002443
> 100708, 100742 \t NM_138634,NM_002443
> 35055935, 35056061 \t
> NM_002313,NM_001003407,NM_001003408
How about this (assuming the line wrap at the end was done by mail; if
it is in the data it is a little harder to parse it):
data = '''(39577484, 39577692) [['NM_003750']]
(107906, 108011) [['NM_002443']]
(113426, 113750) [['NM_138634', 'NM_002443']]
(106886, 106991) [['NM_138634', 'NM_002443']]
(100708, 100742) [['NM_138634', 'NM_002443']]
(35055935, 35056061) [['NM_002313', 'NM_001003407', 'NM_001003408']]
'''.splitlines()
import re
for line in data:
match = re.match(r'\((\d*), (\d*)\) \[\[(.*)\]\]', line)
if match:
t1, t2, data = match.group(1, 2, 3)
data = data.replace("'", "").replace(' ', '')
print '%s %s\t%s' % (t1, t2, data)
else:
print 'no match:', line
Note the format of the data here is different from what you showed in
your post last night...
Kent
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help formating
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Why does my "homework-alert" ring with this post? Andreas kumar s wrote: > hi group, > > i have a data obtained from other student(over 100K) > lines that looks like this: > (39577484, 39577692) [['NM_003750']] > (107906, 108011) [['NM_002443']] > (113426, 113750) [['NM_138634', 'NM_002443']] > (106886, 106991) [['NM_138634', 'NM_002443']] > (100708, 100742) [['NM_138634', 'NM_002443']] > (35055935, 35056061) [['NM_002313', 'NM_001003407', > 'NM_001003408']] > > I know that first two items in () are tuples, and the > next [[]] a list of list. I was told that the tuples > were keys and the list was its value in a dictionary. > > how can I parse this into a neat structure that looks > like this: > 39577484, 39577692 \t NM_003750 > 107906, 108011 \t NM_002443 > 113426, 113750 \t NM_138634,NM_002443 > 106886, 106991 \t NM_138634,NM_002443 > 100708, 100742 \t NM_138634,NM_002443 > 35055935, 35056061 \t > NM_002313,NM_001003407,NM_001003408 > > > I treid substituting in vim editor but it is not > effective. > > Thank you > > kum > > > > Pinpoint > customers who are looking for what you sell. > http://searchmarketing.yahoo.com/ > ___ > Tutor maillist - Tutor@python.org > http://mail.python.org/mailman/listinfo/tutor -BEGIN PGP SIGNATURE- Version: GnuPG v1.4.2 (GNU/Linux) Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org iD8DBQFGU2ZmHJdudm4KnO0RAnIgAJ4oHRPSfYFId7C7TzeWYXPobf9l+QCg34Ja bRtlufQ7K/TKPsLOOBNEmJI= =QeIu -END PGP SIGNATURE- ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help formating
hi group, i have a data obtained from other student(over 100K) lines that looks like this: (39577484, 39577692) [['NM_003750']] (107906, 108011) [['NM_002443']] (113426, 113750) [['NM_138634', 'NM_002443']] (106886, 106991) [['NM_138634', 'NM_002443']] (100708, 100742) [['NM_138634', 'NM_002443']] (35055935, 35056061) [['NM_002313', 'NM_001003407', 'NM_001003408']] I know that first two items in () are tuples, and the next [[]] a list of list. I was told that the tuples were keys and the list was its value in a dictionary. how can I parse this into a neat structure that looks like this: 39577484, 39577692 \t NM_003750 107906, 108011 \t NM_002443 113426, 113750 \t NM_138634,NM_002443 106886, 106991 \t NM_138634,NM_002443 100708, 100742 \t NM_138634,NM_002443 35055935, 35056061 \t NM_002313,NM_001003407,NM_001003408 I treid substituting in vim editor but it is not effective. Thank you kum Pinpoint customers who are looking for what you sell. http://searchmarketing.yahoo.com/ ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me
Let no good deed go unpunished! -Original Message- From: Daniel Yoo Date: Friday, Apr 13, 2007 8:24 pm Subject: Re: [Tutor] please help me > If this is homework, please tell your teacher I helped - I need the > extra credit. > >Please avoid giving homework answers like this. Rather than actually help >the person, it can do harm, because it encourages a lazy attitude toward >solving problems. ___ Tutor maillist - [EMAIL PROTECTED] http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me
> If this is homework, please tell your teacher I helped - I need the > extra credit. Please avoid giving homework answers like this. Rather than actually help the person, it can do harm, because it encourages a lazy attitude toward solving problems. ___ Tutor maillist - [EMAIL PROTECTED] http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me!
You On 4/12/07, suryo agung <[EMAIL PROTECTED]> wrote: > pleate tell me how to make > > input number=4 > result > > 1 > 22 > 333 > > > in python > please give me your answer. input_number = 4 for i in range(1,input_number + 1): print str(i) * i If this is homework, please tell your teacher I helped - I need the extra credit. ___ Tutor maillist - [EMAIL PROTECTED] http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] please help me!
suryo agung wrote: > pleate tell me how to make > > input number=4 > result > > 1 > 22 > 333 > > > in python > please give me your answer. This looks a lot like homework to me. What have you tried? What have you learned? Kent ___ Tutor maillist - [EMAIL PROTECTED] http://mail.python.org/mailman/listinfo/tutor
[Tutor] please help me!
pleate tell me how to make input number=4 result 1 22 333 in python please give me your answer. ___ Tutor maillist - [EMAIL PROTECTED] http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to resolve this...
>> def hello():
>> return "Hello World"
>>
>> server = SOAP.SOAPServer(("localhost", 23000))
>> server.registerFunction(hello)
>> server.serve_forever()
>
> Have you tried running server.py? There's a glaring error in it. (Hint: SOAP
> != SOAPpy)
Actually, there's a much more glaring error in it. Note the early exit
from 'return "hello world". The program is escaping out too quickly.
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to resolve this...
> *#server.py*
> import SOAPpy
>
>
> def hello():
> return "Hello World"
>
> server = SOAP.SOAPServer(("localhost", 23000))
> server.registerFunction(hello)
> server.serve_forever()
Hi Asrarahmed,
I also want to reiterate what Luke said: it does get a little irritating
if we see the same question repeated. Try reading:
http://catb.org/esr/faqs/smart-questions.html
to get a better feel for what kind of things help us answer your questions
better.
Have you tried running server.py? There's a glaring error in it. (Hint:
SOAP != SOAPpy)
I know it might sound silly, but just to make sure you understand: the
server must be up and running before you try contacting it with the
client.
Also, you may want to reconsider SOAPpy: we've had previous discussion
where it was apparent SOAPpy is a dead project:
http://mail.python.org/pipermail/tutor/2006-November/050530.html
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to resolve this...
Asrarahmed Kadri wrote: > Hi, Asrarahmed: You posted this exact question only 4 hours ago. Reposting questions this quickly is an abuse of the mailing list, as far as I'm concerned. If you don't wait at _minimum_ a full day, preferably at least 2, for an answer, it just irritates people and makes it less likely for you to get an answer. People may completely disregard this question now, just as a matter of principle, so that they don't give you the idea that reposting is appreciated. Not mad or anything, just informing you. HTH, -Luke ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to resolve this...
* Asrarahmed Kadri <[EMAIL PROTECTED]> [061108 19:51]: > Hi, > > I have successfully installed the SOAPpy module. The version is 0.11.6 > > I am trying to run simple test program for server and cliet. The script for > server is executing without any error; but the client script is giving me Well, the error means that nothing is listening on port 23000 on localhost. Firewall? Andreas ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
[Tutor] Please help to resolve this...
Hi,
I have successfully installed the SOAPpy module. The version is 0.11.6
I am trying to run simple test program for server and cliet. The script for server is executing without any error; but the client script is giving me the error as below.
TRACEBACK:
C:\project stuff-programs>python client.pyTraceback (most recent call last): File "client.py", line 4, in ? print server.hello() File "C:\Python24\Lib\site-packages\SOAPpy\Client.py", line 453, in __call__
return self.__r_call(*args, **kw) File "C:\Python24\Lib\site-packages\SOAPpy\Client.py", line 475, in __r_call self.__hd, self.__ma) File "C:\Python24\Lib\site-packages\SOAPpy\Client.py", line 347, in __call
config = self.config) File "C:\Python24\Lib\site-packages\SOAPpy\Client.py", line 187, in call r.endheaders() File "C:\Python24\lib\httplib.py", line 798, in endheaders self._send_output()
File "C:\Python24\lib\httplib.py", line 679, in _send_output self.send(msg) File "C:\Python24\lib\httplib.py", line 646, in send self.connect() File "C:\Python24\lib\httplib.py", line 630, in connect
raise socket.error, msgsocket.error: (10061, 'Connection refused')
#server.py
import SOAPpy
def hello(): return "Hello World"
server = SOAP.SOAPServer(("localhost", 23000)) server.registerFunction(hello) server.serve_forever()
# client.py
import SOAPpy
server = SOAPpy.SOAPProxy("http://localhost:23000/")print server.hello()
TIA.
Best Regards,
Asrarahmed-- To HIM you shall return.
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to debug this function..
Reposting to the list.
--- Asrarahmed Kadri <[EMAIL PROTECTED]> wrote:
> > >except ValueError:
> > >flag = False
> > >startdate = None
> > >enddate = None
> > >err_msg = traceback.format_exc()
> > >index = string.find(err_msg,'Value')
> > >print err_msg[index:]
> > >return (flag,startdate,enddate)
> >
> >Since this block is essentially identical to the except
> >block above you could package them both as a function
> >which would shorten the code a little.
> It might seem silly, but can you just give a hint as to how to
> put the code in a function..
def handleValueError():
flag = False
startdate = None
enddate = None
err_msg = traceback.format_exc()
index = err_msg.find('Value')
print err_msg[index:]
return (flag,startdate,enddate)
And in your code above:
except ValueError:
return handleValueError()
> > It would be better to raise a ValueError which can be caught
> > by the external program:
> How to catch the exception from one module into another ..???
Just use try/except as usual. There is no difference
to exceptions thrown by your code and the ones thrown
by the standard Python functions. Consider:
### module.py ###
def f():
raise ValueError
##
## main.py ##
import module
try:
module.f()
except ValueError:
print "It broke!"
#
Is that clear?
Alan G
___
All new Yahoo! Mail "The new Interface is stunning in its simplicity and ease
of use." - PC Magazine
http://uk.docs.yahoo.com/nowyoucan.html
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to debug this function.. it takes a date and num. of days and returns startdate and enddate (fwd)
[Forwarding to Tutor; busy at the moment] -- Forwarded message -- Date: Mon, 6 Nov 2006 18:41:54 + From: Asrarahmed Kadri <[EMAIL PROTECTED]> To: Danny Yoo <[EMAIL PROTECTED]> Subject: Re: [Tutor] Please help to debug this function.. it takes a date and num. of days and returns startdate and enddate Hi Danny, Can you please test it !!! Also I would like to know if it can be coded in a better way... TIA. Regards, Asrarahmed On 11/6/06, Danny Yoo <[EMAIL PROTECTED]> wrote: > > > > On Mon, 6 Nov 2006, Asrarahmed Kadri wrote: > >> I have written a function that takes a date and an integer representing >> the number of days. >> >> Please test it, comment on the logic . > > > Hi Asrarahmed, > > You should be able to write your own tests too. You might want to look > at: > > http://www.diveintopython.org/unit_testing/index.html > > for an example of how to write unit tests; the author there goes through > an example with a Roman Numeral program written with unit tests. > -- To HIM you shall return. ___ Tutor maillist - Tutor@python.org http://mail.python.org/mailman/listinfo/tutor
Re: [Tutor] Please help to debug this function.. it takes a date andnum. of days and returns startdate and enddate
"Asrarahmed Kadri" <[EMAIL PROTECTED]> wrote
> Please test it, comment on the logic .
I haven't tested it but here are some comments:
> import string
> import datetime
> import traceback
>
> def dateCheck(date1,num_days):
>flag = True
>startdate = None
>enddate = None
>
>if num_days < 0 or num_days > 31:
>flag = False
>print "The argument for -n has to be between 0 and 31"
>return (flag,startdate,enddate)
>
>else:
You don't need the else since the if block returns.
Thus you only reach the followiong code if the test is false.
This reduces the anumber of levels of indenting by one which
improves readability and thus maintenance.
>date_lst = string.split(date1,"/")
better to use the string methods. ie date1.split('/')
>ln = len(date_lst)
>if ln != 3 :
you could have combined those lines into one since you never
use 'ln' except in the test.
if len(date1.split('/') != 3:
>flag = False
>print "The argument for -D option has to be in the
> format:
> dd/mm/"
>return (flag,startdate,enddate)
>else:
Same as above, the else is just adding levels of indentation.
>date_lst.reverse()
>print date_lst
>try:
>if int(date_lst[0]) < 2000:
>flag = False
>print "The year cannot be earlier than 2000 and
> it
> should be in the format ''."
>return (flag,startdate,enddate)
>except ValueError:
>flag = False
>err_msg = traceback.format_exc()
>index = string.find(err_msg,'Value')
Again use the string method:
index = err_msg.find('Value')
>print err_msg[index:]
>return (flag,startdate,enddate)
>
>try:
>startdate = datetime.date
> (int(date_lst[0]),int(date_lst[1]),int(date_lst[2]))
>enddate = startdate +
> datetime.timedelta(days=num_days)
>print startdate, enddate
>
>except ValueError:
>
>flag = False
>startdate = None
>enddate = None
>err_msg = traceback.format_exc()
>index = string.find(err_msg,'Value')
>print err_msg[index:]
>return (flag,startdate,enddate)
Since this block is essentially identical to the except block above
you could package them both as a function which would shorten
the code a little.
>if enddate > datetime.date.today():
>enddate = datetime.date.today()
>if startdate > datetime.date.today():
>flag = False
>startdate = None
>enddate = None
>print "The -D option should have a date not later
> than
> today's date"
Since this is a function and not part of the user interface there
shouldn't really be any knowledge of the -D option in this code.
What if you want to call it from another module that uses
different options?
It would be better to raise a ValueError which can be caught
by the external program:
raise ValueEerror ("startdate later than today")
>return (flag,startdate,enddate)
>
HTH,
--
Alan Gauld
Author of the Learn to Program web site
http://www.freenetpages.co.uk/hp/alan.gauld
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
