Re: [aroma.affymetrix] Re: EXON question

Hi Sabrina. Comments below. > Hi, Mark: > Thanks for the information. What I worried about using coordinate is > that coordinate changes with assembly, while sequences do not change. > I don't know how many psrs are out of exon boundary, I will look into > it. But here is an example: > group Num

Re: [aroma.affymetrix] Re: selection of "good" probes in exon CDF's

Hi Yu Chuan. You are correct. Custom CDF files are the best way to go for this. Cheers, Mark On 18-Nov-09, at 8:22 AM, Yu Chuan wrote: > Hi folks, > > I have a question related to this topic. I want to generate gene-level > expression values using the 3' end probes or 5' end probes only. Looks

extracting FIRMA scores (Was: [aroma.affymetrix] a question)

Hi Jiang. Its helpful to use meaningful subject headers, so that others can search the mailing lists. So, I've changed your messages to a new thread. Comments below. > Hi, > I have a question can you help me. That's about using FIRMA. I > cannot get the result after I run FIRMA. I only fo

[aroma.affymetrix] Re: selection of "good" probes in exon CDF's

Hi folks, I have a question related to this topic. I want to generate gene-level expression values using the 3' end probes or 5' end probes only. Looks like creating a custom CDF file containing only the probes I want is the only way for that. Is it correct? Thanks! Yu Chuan -- Forwarde

[aroma.affymetrix] Re: EXON question

Hi, Mark: Forgot to ask another question. Back to my original question, is there an (easy) way to map from partial sequence (i.e. the probeset sequence) to exon sequence in a batch mode or in R? Thanks! Sabrina On Nov 16, 8:10 pm, Mark Robinson wrote: > Hi folks. > > Note that you can download

[aroma.affymetrix] Re: EXON question

Hi, Mark: Thanks for the information. What I worried about using coordinate is that coordinate changes with assembly, while sequences do not change. I don't know how many psrs are out of exon boundary, I will look into it. But here is an example: group Number: 5092691: CTTATCGAGATAGTGCTTCTGTGGG

[aroma.affymetrix] Re: FIRMAGene with masked CEL files

Hi Mark, Thanks very much for the feedback. In the spirit of completeness I tried upgrading aroma.affymetrix and emptying the caches, although given your reply I'm not surprised it didn't work (see attached). I'll try with the custom CDF file approach and let you know how I get on. Cheers, Tim