perl file parsing

Dear Gurus, I have a file of the follwoing form FFM50HR02GMY4E length=75 xy=2604_3772 region=2 run=R_2008_08_19_08_32_31_ TCAATGGGTCCGACGGAGAAAGCGCGACAGAAAAGCCCTTTTGT TCGACTAGCGTCGTG FFM50HR02F5QTS length=59 xy=2408_2686 region=2 run=R_2008_08_19_08_32_31_

simple file parsing.

Hi All, I am not really new to perl but still find myself struggling with it. I have a very simple problem in front of me, but am unable to slove it. Here is the problem: I have a file with lines like FF3M62TC02 AGGCAT-GGATG-ACAGT There are multiple lines like this. ALl I have to do it have

Re: simple file parsing.

Thanks a lot. I think I am all set. I used the code drafted by Dermot. And Shawn , Thanks a lot for your advise. -Minky On Tue, Sep 30, 2008 at 9:28 AM, minky arora [EMAIL PROTECTED] wrote: Hi All, I am not really new to perl but still find myself struggling with it. I have a very simple

reformatting excel files

Hi Gurus, I need some sugegstions as to how to go about doing the following. I have a huge excel file and a file map associated with it, which says how the excel sheet is to be formatted. For instance, a set of 96 cells which are named A , need to be entered below a set of 96 cells named B (B

SOAP::Lite on Leopard

Hi, Can anyone please point me in the right direction to download SOAP::Lite on Leopard? I am unable to find instructions for the same, It will be a great help. Thanks..

how to increment to records using SEEK

Hi Gurus, I am parsing through a file and need to print the records in the following order: Minky Arora 235 River Drive, Newton,PA 19073 Here is my code: !/usr/bin/perl use strict; open FILE, /users/meenaksharora/db.txt or diecnt open $!; my($fname,$lname,$address,$lline,$line,@db); foreach

Re: regex parsing-Beginner

gtagtagata ataataataa aactgagtat Please Advise as to the best way to go about this. On 12/4/07, Gunnar Hjalmarsson [EMAIL PROTECTED] wrote: minky arora wrote: Gunnar Hjalmarsson wrote: minky arora wrote: I have been able to retrive all the info i need and in the format that I want. Would

regex parsing-Beginner

Hi All, I am quite new to perl so pls bear with me.I am trying to do some Bioinformatics Analysis.A part of my file looks like this: gene410..1750 /gene=dnaA /db_xref=EMBL:2632267 CDS 410..1750

Re: regex parsing-Beginner

Thanks PAul, That solves half my problem.I am working on it.If I need more help,I will post it up. -Min On 12/4/07, Paul Lalli [EMAIL PROTECTED] wrote: On Dec 4, 11:06 am, [EMAIL PROTECTED] (Minky Arora) wrote: I am quite new to perl so pls bear with me.I am trying to do some

Fwd: regex parsing-Beginner

: dnaA:75 I need an idea as to how to tie the gene name with the diff. value. Thanks a lot, On 12/4/07, Gunnar Hjalmarsson [EMAIL PROTECTED] wrote: minky arora wrote: .A part of my file looks like this: gene410..1750 /gene=dnaA

Re: Fwd: regex parsing-Beginner

ILTGVNWKVEQSELLCTATDSHRLALRKAKLDIPEDRSYNVVIPGKSLTELSKILDDN QELVDIVITETQVLFKAKNVLFFSRLLDGNYPDTTSLIPQDSKTEIIVNTKEFLQAID RASLLAREGRNNVVKLSAKPAESIEISSNSPEIGKVVEAIVADQIEGEELNISFSPKY MLDALKVLEGAEIRVSFTGAMRPFLIRTPNDETIVQLILPVRTY On 12/4/07, Gunnar Hjalmarsson [EMAIL PROTECTED] wrote: minky

Newbie question on substitution with Subroutines

Hi Team, I need to make multiple substitutions in a file.There could be a situation where there are more than one substitution on a single line.I want to count the total # of substituitions.I need to use subroutines: I have 3 questions: 1) Do I have to make 3 separate Regex.How can it be done

Array reformatting problem

Hello Team, I have a problem and I need some ideas to put me on the right track to form an algo: I have four 8x12 arrays (Arr1,Arr2, Arr3,Arr4) and ONE 16x24 (ARR5) array. Now these four arrays are formatted in a particular way by a robot( these are actually plates with wells ..I am dealing