Can anyone point to an "easy" way to sort the display of CFDIRECTORY
filenames by file extension, and then perhaps by name?
-- Rick.
~|
Order the Adobe Coldfusion Anthology now!
http://www.amazon.com/Adobe-Coldfusion-Anthology
Then, on the third or fourth try, it executed???
On 7/29/2014 1:56 PM, Richard Colman wrote:
> this is even stranger.
>
> when I run the compile command, it overwrites the compile.bat file and
> makes it zero length.
>
> this used to work:
>
>C:\Windows\System32>
lon\secure_source_compiled
what am I doing wrong, please.
On 7/29/2014 1:44 PM, Richard Colman wrote:
> Somehow, my CF10 version of CFCOMPILE.BAT got wiped out [zero length
> file] (in Coldfusion10/cfusion/bin)
>
> would some kind sole send me a copy of the file to rcol...@c
Somehow, my CF10 version of CFCOMPILE.BAT got wiped out [zero length
file] (in Coldfusion10/cfusion/bin)
would some kind sole send me a copy of the file to rcol...@cox.net.
TNX!!!
~|
Order the Adobe Coldfusion Anthology n
ew Scott
> WebSite: http://www.andyscott.id.au/
> Google+: http://plus.google.com/113032480415921517411
>
>
>
> On Mon, Jul 28, 2014 at 1:53 AM, Richard Colman wrote:
>
>> Apparently, CFCOMPILE.BAT is missing from Coldfusion 10. Anyone know
>> where to find the 10.1 update?
Apparently, CFCOMPILE.BAT is missing from Coldfusion 10. Anyone know
where to find the 10.1 update?
On 7/27/2014 9:01 AM, John M Bliss wrote:
> https://www.copy.com/s/i0LSL1n8A6QC/ColdFusion%20Installs
>
>
> On Sun, Jul 27, 2014 at 10:59 AM, Richard Colman wrote:
>
>> Does
Does anyone know where to find a download of V. 10 ... Adobe only seems
to have Coldfusion11 available.
TNX if you can help.
-- Rick
~|
Order the Adobe Coldfusion Anthology now!
http://www.amazon.com/Adobe-Coldfusion-Anthology
Thank you. Good start.
There is the question of the best way to keep track of keys for various,
different files; or use the same key for all files without exposing it.
As you can see, I am very much a security novice when it comes to this
stuff.
On 7/17/2014 2:18 PM, John M Bliss wrote:
> Che
Just to clarify, the problem is not in the transmission, which can be
accomplished by FTPs, etc.
Once the file resides on the shared FTP server, it needs to be encrypted
to maintain security.
So, I think the flow is: (1) transmit plain file up to server, and (2)
encrypt on the server. Revers
There are lots of examples on using these functions on strings.
However, is it possible to use these functions to encrypt/decrypt entire
files (not .cfm code files), for example, to maintain security in an FTP
server, etc.
TNX for any pointers.
-- Rick
~~~
I am trying to output a PDF through the cfdocument tag, without any any
page breaks. I would like to get one long document, with pagination.
Does anyone know of a way to do this?
-- rick
~|
Order the Adobe Coldfusion Anthology
I have been with CrystalTech (Newtek or TBS whatever) for almost 20
years and have no reason to complain.
On 10/22/2013 8:56 PM, Maureen wrote:
> Viviotech - best hosting company I have ever encountered.
>
>
> On Mon, Oct 21, 2013 at 6:04 AM, Robert Harrison > wrote:
>> I know this has been aske
Hate to bring this up again, but I have used Homesite for many years and
do like it.
I need to transfer the application to a new computer, and the original
install disks are long gone.
Does anyone know of a source to obtain or purchase?
TNX,
signed ... the dinosaur ...
~
I am doing some first-time international monetary stuff, and having some
trouble figuring out how to process the numbers in CF.
The problem is that decimal points and thousands separators can come in
two flavors:
US: xxx,xxx.yy
- or -
Europe, SA: xxx.xxx,yy
Note that decimals and commas can
her a. use
apache side by side with IIS on a diff ip b. run either the ASP apps or CF
in a VM
Russ
> -Original Message-
> From: Richard Colman [mailto:[EMAIL PROTECTED]
> Sent: Friday, April 04, 2008 12:23 PM
> To: CF-Talk
> Subject: Update a Current 32/64 bit instal
After a considerable amount of work, we FINALLY got a mixed installation
running successfully; i.e. 64-bit Windows 2003 server running 32-bit IIS in
emulation mode with CF8 running OK * AND * .NET applications running (3.5)
in 32-bit mode. It is FINALLY working.
So, now the 8.0.1 update comes out.
HELP! I just bought a 64-bit windows server. What versions of CF7 or CF8
can I run on this machine?
Rick Colman
-Original Message-
From: Ben Forta [mailto:[EMAIL PROTECTED]
Sent: Friday, February 15, 2008 10:36 AM
To: CF-Talk
Subject: RE: No 64-bit on Windows for CF8?
64bit CF8 is in f
I need to convert a dynamic CF page to static html. The easiest way is
to just run the page, view page source, and save the page source to a
file. HOWEVER, I need to do this for about 40 different pages.
Is there some easier, programmatic way to write the resulting html page
to file without too mu
We don't have CFDOCS on the server, but it looks like somebody tries to
keep hitting it ...
"Error","jrpp-252","01/15/08","19:48:32",,"File not found:
/cfdocs/snippets/fileexists.cfm The specific sequen
ce of files included or processed is:
/export/disk01/ricklres/apache-conf/htdocs/wwwroot/cbrl_n
;19:50:06",,"File not found:
/cfdocs/snippets/fileexists.cfm The specific sequence
of files included or processed is:
/export/disk01/ricklres/pkg/coldfusionmx7/wwwroot/cfdocs/snippets/fileex
is
ts.cfm "
Richard Colman
~|
Adobe®
There seem to be many custom tags, UDFs, packages around for image
manipulation. My needs are a simple image resize, from the native image
file to the desired size on the web page.
Can someone with more experience in this area suggest the best approach.
TNX for any help.
Rick Colman
~~~
I just did an upgrade to CF8 and my venerable CF_forward tag is now
causing a problem. Does anyone know if this tag still works with CF8?
Richard Colman
~|
Adobe® ColdFusion® 8 software 8 is the most important and dramatic
Scott [mailto:[EMAIL PROTECTED]
Sent: Monday, December 03, 2007 1:26 PM
To: CF-Talk
Subject: Re: nobody on Linux
Was CF8 installed as root? I would say it wasn't, if you are having
access problems.
And seeing as you haven't mentioned it, what sort of access problems are
you having?
On 1
uot;nobody" account?
Any comments greatly appreciated.
Richard Colman
~|
Download the latest ColdFusion 8 utilities including Report Builder,
plug-ins for Eclipse and Dreamweaver updates.
http;//www.adobe.com/cfusion/entitlem
AND THATS A GOOD THING.
Once in a while, it is good to jus say: "... screw work ..."
-Original Message-
From: Asim Manzur [mailto:[EMAIL PROTECTED]
Sent: Friday, November 23, 2007 10:48 AM
To: CF-Talk
Subject: Black Friday
Hmmm ... not many people are working today..
--
.
If I am going to run a Web/.NET/CF8 server, will these applications take
advantage of dual or quad core processers?
Rick Colman
~|
Create robust enterprise, web RIAs.
Upgrade to ColdFusion 8 and integrate with Adobe Flex
http://
DOH ...
-Original Message-
From: Ben Doom [mailto:[EMAIL PROTECTED]
Sent: Monday, October 22, 2007 9:29 AM
To: CF-Talk
Subject: Re: UNZIP
cfzip? :-)
--Ben Doom
Richard Colman wrote:
> Can anyone recommend a tag for unzipping files programmatically?
>
> Ri
Can anyone recommend a tag for unzipping files programmatically?
Rick Colman
~|
ColdFusion 8 - Build next generation apps
today, with easy PDF and Ajax features - download now
http://download.macromedia.com/pub/labs/coldfusion/cf
I fall prey to making quick updates directly on the server for
low-volume/low-usage applications. My BAD ...
-Original Message-
From: Claude Schneegans [mailto:[EMAIL PROTECTED]
Sent: Friday, October 19, 2007 3:30 PM
To: CF-Talk
Subject: Re: DEATH to HOMESITE
>>F*cking HomeSite+ wiped o
F*cking HomeSite+ wiped out my file on the server (AGAIN). I do a file
write, it hangs, and I have to kill HomeSite. When I start homesite
again, guess what, the file is gone from the server.
What a piece of crap.
Rick Colman
~|
I just installed the Linux version of CF8, and, attempting to connect an
RDS server from HomeSite+, I am getting a 404:page not found error.
I have a similar setup running correctly on a Linux CF7 server.
Any ideas as to how to solve this problem?
Rick Colman
~
To: CF-Talk
Subject: Re: Killing a login
Richard Colman wrote:
> I am trying to provide a "logout" function on my site.
> Is there any way to kill a login without exiting the browser?
How do you log u
I am trying to provide a "logout" function on my site. I have tried
various combination like:
But the login presists until the browser is closed.
Is there any way to kill
I want to log the sql text of various queries into a log table.
When I try:
insert into ChangeLog(actor, ChangeText, UpdateDate)
Values('#actor#','#sqltext#','#datenow#')
I get errors like:
Incorrect syntax near the keyword 'Update'.
insert into ChangeLog(actor, ChangeText, UpdateDate)
V
F&*cking Homesite+ keeps on hanging on my ftp connection to CrystalTech,
and I have to kill the app. This seems to be happening often, now.
Sometimes it also wipes out the file that I have been working on.
Anyone know how to fix this problem?
Richard Co
Can anyone recommend a linear programming calculation package that would
easily hook to a CF application?
Any recommendations appreciated.
R. Colman
~|
Create robust enterprise, web RIAs.
Upgrade to ColdFusion 8 and integrate
Crystaltech just start effering it.
-Original Message-
From: Ali Majdzadeh [mailto:[EMAIL PROTECTED]
Sent: Monday, August 20, 2007 1:18 PM
To: CF-Talk
Subject: Coldfusion 8 hosting
Hi:
Is there any reliable Coldfusion 8 hosting server right now?
I found by googling the following company
I am using CF_forward to return to a page after doing an insert. They
way I have it setup is:
Page1
-
Send a form to the action page
Page2
-
Do the insert and
back to page 1
HOWEVER, when I end up back at Page1, the URL address line on the
browser says: http://page2 instead of http:
I have a simple page with a CFTREE command that used to load OK, but now
the java applet refuses to load. It just hangs with the Java Sun
Microsystems logo going around and around. This happens in both IE and
Firefox.
Any ideas?
Rick Colman
~~
Does anyone know of an example of how to populate a multi-lvel CFTREE
control from a query. There are doc examples showing hard coding the levels,
but I can't seem to find one showing how to populate from a query.
TNX if you can provide a pointer.
Rick Colman
~~~
Does anyone know of an example of how to populate a multi-lvel CFTREE
control from a query. There are doc examples showing hard coding the
levels, but I can't seem to find one showing how to populate from a
query.
TNX if you can provide a pointer.
Rick Colman
ion.
>
> Since the page source is exactly the same, I am at a loss to explain
> how this is happenening.
>
> Any help greatly appreciated.
>
> Richard
Colman
~|
Deploy Web Applications Quickly acros
"unsubscribe" at the bottom of every email. :-)
--Ben Doom
Richard Colman wrote:
> I need to unsubscribe for a month while on vacation.
>
> I went to houseoffusion.com and can't find any way to do this. Very
> frustrating. HELP
I need to unsubscribe for a month while on vacation.
I went to houseoffusion.com and can't find any way to do this. Very
frustrating. HELP please.
Richard Colman
~|
Upgrade to Adobe ColdFusion MX7
Experience Flex 2
What is the easiest way to do a back to the calling page?
Rick Colman
~|
Deploy Web Applications Quickly across the enterprise with ColdFusion MX7 &
Flex 2.
Free Trial
http://www.adobe.com/products/coldfusion/flex2/
Archive:
Can someone describe exactly how the "free" developer edition limits
utilization of a web site/CFM pages.
TNX if you have had some specific experience in this area.
Rick Colman
~|
Upgrade to Adobe ColdFusion MX7
Experience Fle
I need to set up individual customer sharepoint sites, and I am looking
for a consultant quite familiar and knowledgeable with Microsoft
Sharepoint.
Please contact me off of the list if you can provide a reference.
Rick Colman
~
I assume the SQL-Server datatype is datefime? Could you give an example
of using getDate() in a sql update statement, please?
Rick Colman
why pass anything from CF? why not just make the default value of the
field in the database getDate()?
if you're updating...just pass ge
I create session variables on user login within CF. Is there some
reasonable way to a .NET application to pick up and use those session
variables?
Rick Colman
~|
Upgrade to Adobe ColdFusion MX7
Experience Flex 2 & MX7 integratio
This yields an INCORRECT SYNTAX error:
'#updatecustomer_result.sql#',
79 :'#session.lname#',
80 :'#createodbcdatetime(now())#')
81 :
82 :
SQLinsert into ... '{ts '2007-01-23 14:54:41'}')
What is the best way to automatically insert the current date into a
data table?
I tried something like:
With the following in the insert statement
... '23-Jan-07')
Into a SQL-Server datetime column.
Yields the error message: "String or
I wish to store the actual text of a SQL query to a logfile.
At the risk of belaboring the obvious, from:
Select * from blah
I wish to actual put "select * from blah" into a text variable and write
it to a logfile or data table.
Can someone suggest an easy way to do this?
TNX.
Rick Colman
Has anyone out there used the Webdrive FTP Client (Swouth River
Technologies) with CF?
This product is supposed to map an external ftp server as a network
drive, hopefully enabling seemless access to external files through
CFFILE, etc. I sort of have it working, but not entirely successfully.
If
This snippet is intended to cause the page to wait until a file appears
on a disk directory. This is timing out without completing successfully.
Wonder if the syntax is correct, or ???
Help appreciated.
Rick Colman
~
I need to start a script on a remote server, wait for the results file
to appear, and get the contents. I often need to wait about 15-30
seconds from the start to finish.
Is there any easy way to have a cold fusion page "wait" for the remote
action to appear. Is there the equivalent of a SLEEP co
I am trying to connect to a MySQL database running on a remote linux
server from CFMX7.
When I setup the connection using the Microsoft ODBC utility, everything
works great.
When I attempt to setup the connection with the CFMX Data Sources
utility, using the exact same settings, it fails with the
1) if I want to do a replace where the character to be replaced is a
forward or backward angle bracket "<" or ">" then I assume that this
will not work:
How do I "escape" the bracket character to make it work?
2) this is from the CFFILE doc for action="read":
It is not intended for use with
1) if I want to do a replace where the character to be replaced is a
forward or backward angle bracket "<" or ">" then I assume that this
will not work:
How do I "escape" the bracket character to make it work?
2) this is from the CFFILE doc for action="read":
It is not intended for use with
-Original Message-
From: "Doug Brown" <[EMAIL PROTECTED]>
To: "CF-Talk"
Sent: 11/14/06 7:17 PM
Subject: Sql error during insert
I do not recall seeing this before. Could someone tell me what I am doing
wrong? I get the following error while executing this query.
Error Executing Da
eceeding "/" in your
intial path (i.e. "/directory/" instead of "directory/"). In IIS, if the
FTP sites are in user isolation mode, the inital "/" can cause problems.
-Jon
On Oct 16, 2006, at 1:12 PM, Richard Colman wrote:
> Does anyone know how to deal
Does anyone know how to deal with:
"Remote Server Operatiopn Failed, 230 user logged in, proceed"
Where I cannot connect to the site.
This is happening on several FTP sites, although my RDS sites are working
OK.
Rick Colman
~~
Anyone know what firewall ports need to be open to enable Homesite RDS and
FTP access?
TNX.
Rick Colman
~|
Introducing the Fusion Authority Quarterly Update. 80 pages of hard-hitting,
up-to-date ColdFusion information by yo
return (in this case) either 1, 2, or 3. Therefore, for
each page load, you will get a random banner to show.
Ben Nadel
www.bennadel.com
-Original Message-
From: Richard Colman [mailto:[EMAIL PROTECTED]
Sent: Thursday, August 17, 2006 5:18 PM
To: CF-Talk
Subject
I want to do a REALY simple "banner rotation" on each page load, where the
"banner" is not an image, but a small file containing an image with some
text.
So, on the first load, it would run:
Then, perhaps:
http://www.fusionauthority.com/quarterly
Archive:
http://www.houseoffusion.com/group
I want to do a REALY simple "banner rotation" on each page load, where the
"banner" is not an image, but a small file containing an image with some
text.
So, on the first load, it would run:
Then, perhaps:
http://www.fusionauthority.com/quarterly
Archive:
http://www.houseoffusion.com/gro
Trying to replace everything that is NOT:
abcdefghiklmnpqrstvwyz
with a blank (including white space, returns, etc.)
Thought this would work, but it does not:
Help!
Rick Colman
~|
Introducing the Fusion Author
Written by someone else ...
-Original Message-
From: Bryan Stevenson [mailto:[EMAIL PROTECTED]
Sent: Thursday, July 06, 2006 2:07 PM
To: CF-Talk
Subject: Re: Calling a Web Service from CF
Did you write the webservice or are you trying to consume one written by
someone else?
plz post an
My first TRY failed. Can someone suggest a really rock-solid tutorial on how
to do thius?
TNX.
Rick Colman
~|
Message: http://www.houseoffusion.com/lists.cfm/link=i:4:245612
Archives: http://www.houseoffusion.com/cf_lists/t
this on numerous projects.
http://webfx.eae.net/dhtml/tabpane/tabpane.html
Check out the various styles as they vary quite a bit.
Terry
"Richard Colman" <[EMAIL PROTECTED]> wrote on 06/23/2006 01:37:06
PM:
> Hi,
>
> What is the EASIEST and FASTEST way to create a prot
Hi,
What is the EASIEST and FASTEST way to create a prototype TABBED interface
to be able to run separate forms in each tab?
Suggestions appreciated since this is my first attempt and running out of
time ...
Rick Colman
~|
M
Actually, it works with 6.1 on another server, but does not work with 7.0 .
It displays line charts fine, but not bar charts!!
TNX so much for the reference.
-Original Message-
From: Peter Legg [mailto:[EMAIL PROTECTED]
Sent: Monday, June 19, 2006 12:36 PM
To: CF-Talk
Subject: Re: Proble
I am trying to do a plain ol' bar chart in CFCHART, but I am getting no bars
displayed on the chart. Using the plain vanilla example in livedocs, and I
know there is data in the query.
Here is what is not working:
Any ideas appreciated.
~
Exactly right, TNX1
-Original Message-
From: James Smith [mailto:[EMAIL PROTECTED]
Sent: Friday, June 16, 2006 1:11 AM
To: CF-Talk
Subject: RE: 3-D charts with cfchart
> I can't seem to get cfchart to show 3-D data with arguments like:
> show3d="Yes" xoffset="-1" yoffset="-1
Have you tr
I can't seem to get cfchart to show 3-D data with arguments like:
show3d="Yes" xoffset="-1" yoffset="-1
I would like to show multiple sets of data in 3-D rows ... mountain range
effect.
Does anyone know if this is possible?
Rick Colman
Anyone know the proper syntax for checking whether a list member exists,
like:
Which does not work, BTW.
TNX if you can help.
Rick Colman
~|
Message: http://www.houseoffusion.com/lists.cfm/link=i:4:242358
Archives: htt
Anyone know of a CF-based system for managing physical assets like
computers, lab equipment, etc.
Rick Colman
~|
Message: http://www.houseoffusion.com/lists.cfm/link=i:4:238905
Archives: http://www.houseoffusion.com/cf_lists/
How do I move my Homesite installation from my old computer (retiring) to my
new computer. I have been searching through the MM website trying to learn
how to do this, but can't seem to find a direct reference.
Comments appreciated.
Rick Colman
What is the proper separator to use in a cfmail tag for multiple addresses
in the cc= section comma Or
Rick Colman
~|
Message: http://www.houseoffusion.com/lists.cfm/link=i:4:237368
Archives: http://www.houseoffusion.
, but I can't
see any reason why the others would fail.
Russ
-Original Message-
From: Richard Colman [mailto:[EMAIL PROTECTED]
Sent: 31 March 2006 23:37
To: CF-Talk
Subject: CF_FORWARD problem
This is a really wonderful tag, and I use it all the time within a site.
HOWEVER, attem
erOligos.aspx"
Etc.
The error occurred in C:\Inetpub\wwwroot\CODA\forward.cfm: line 68
66 :
67 :
68 :getPageContext().forward("#attributes.URL#");
69 :
70 :
Any advice appreciated.
Richard Colman
Calling page is:
Still not working.
-Original Message-
From: Charles Sheehan-Miles [mailto:[EMAIL PROTECTED]
Sent: Wednesday, March 29, 2006 7:43 AM
To: CF-Talk
Subject: Re: cgi.HTTP_REFERER
This is kind of like asking to make sure your computer is plugged in (so
you've probably alre
I am trying to get this to work, and the simple test case is:
cgi variable exists
cgi variable does not exist
#CGI.HTTP_REFERER#
However I am not getting anything back in the cgi variable.
Any comments appreciated.
Rick Colman
~
or me all the time
#newvar#
-Original Message-
From: Richard Colman [mailto:[EMAIL PROTECTED]
Sent: Friday, March 24, 2006 12:58 PM
To: CF-Talk
Subject: RE: CFIF and null values
expr3=[#expr3#]
Results in:
expr3=[]
on the web page.
I can see the NULL i
expr3=[#expr3#]
Results in:
expr3=[]
on the web page.
I can see the NULL in the database. Datatype is SQL-Server numeric.
I am mystified why this does not work Maybe a typo??
-Original Message-
From: Bryan Stevenson [mailto:[EMAIL PROTECTED]
Sent: Friday, March 24, 2006 12:4
ually 'NULL'? Try dumping expr3, but
wrap the output with some sort of delimiter so you can tell whether there's
any space, maybe...
On 3/24/06, Richard Colman <[EMAIL PROTECTED]> wrote:
> I have a null value being returned from a query. I would like to catch
> it and g
I have a null value being returned from a query. I would like to catch it
and give it a value before proceeding.
So, assuming that CF returns a null value as a null string, I tried the
following:
Also
However, neither of these are working.
Any suggestions appreciated.
? I don't know if
you copy/pasted that result line, but if you did there /is/ a space there.
Could just be your email software too. :)
> -Original Message-----
> From: Richard Colman [mailto:[EMAIL PROTECTED]
> Sent: Friday, March 17, 2006 9:13 AM
>
> Here is a simple
Here is a simple program flow statement that is failing. I don't know why.
Data values are not null. I am probably doing something really stupid. Can
someone offer an insight? TNX.
value should be Yes but is
#getproject.clusterbillable#
value should be No but is
#getproject.clust
Hi Randy,
Pretty cool so far. I assume that "save changes" overwrites (updates)
records for the week until the following week, in which case it then writes
a new set of records ...
Rick.
~|
Message: http://www.houseoffusion.c
I notice that LISP is rated ahead of CF ... When was the last time you came
across a Lisp application ... ???
-Original Message-
From: Stephen Lapointe [mailto:[EMAIL PROTECTED]
Sent: Friday, January 27, 2006 11:20 AM
To: CF-Talk
Subject: Re: Tiobe programming languages ranking
>Scroll
I have used network drive mapping with no problems, going from a WINDOWS
host running CF to a LINUX cluster through a samba server. So, even this is
possible, but, I am interested the the pros and cons of a UNC path vs.
network drive mapping. Would it work in between different OS?
Here is another
Does anyone know if it is practical write some CF code to import an Excel
spreadsheet into Microsoft Excel? Need to do this several hundred times as
part of a survey operation.
Responses appreciated before I get myself into hot water ...
TNX.
Rick Colman
~~~
Well, I need something that is multi-user ... Several different people
working on several different projects at the same time ... And need to be
able to summarize data by project and person.
Rick Colman
-Original Message-
From: Mike Kear [mailto:[EMAIL PROTECTED]
Sent: Thursday, January
Hi gang,
I need a relatively simple time tracking app in CF, something that can be
used to accumulate people time spent on a specific projects. NOT a time card
application because I don't care about total time spent, just time on a
project.
Recommendations appreciated.
TNX.
Richard C
each sub-part of the
question, then it is easy to tabulate results for each part.
Recommendations appreciated.
Richard Colman
~|
Find out how CFTicket can increase your company's customer support
efficiency by 100%
Set it as a jpg... In cfchart
-Original Message-
From: Steve Brownlee [mailto:[EMAIL PROTECTED]
Sent: Wednesday, December 14, 2005 2:20 PM
To: CF-Talk
Subject: Love flash in CFCHART but hate...
It's been reported from some of my users that they find it distracting when
- using CFCHART a
Does anyone know if it is possible/practical to run CF pages within a
Microsoft Sharepoint Server environment?
Rick Colman
~|
Logware (www.logware.us): a new and convenient web-based time tracking
application. Start tracking an
Does anyone know if this looks right:
update spdinput set sequence = "(select sequence from spdinput where
spdinput_id = 559)"
where spdinput_id = 627
I am afraid of blowing up my data table in SQL-Server.
Rick Colman
~~
CFFILE seems to be putting extra linefeeds or carriage returns into the
output written to a file. For example,
Using:
Here is my contents:
GATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGC
TGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGTGACTTCCTCAGCACTTTCCACATCCGGAT C
I need to read every file in a directory (filenames unknown) and process
each file sequentially, extracting some text from each page and building a
datafile with the extracted page.
I think I know how to do it, but am not sure about the reading a directory
part and getting the filenames
Ca
1 - 100 of 231 matches
Mail list logo
