Re: "temp" vs "my"

What you want is OUTER ... my $v = "original"; > { > my $v = OUTER::<$v>; > say $v; > $v = "new one"; > say $v; > } > say $v; It's how you access the outer scope from an inner scope. -Scott On Wed, Oct 3, 2018 at 1:10 AM yary wrote: > Reading and playing with

Re: using run

If you don't specify the :out adverb, then the output of the program you are running will be sent to standard output. Immediately when the program executes. If you specify the :out adverb, output from the program will be available for capture via the $proc.out method. A similar thing applies

Re: need s/ help

On Tue, May 1, 2018 at 8:37 AM, ToddAndMargo wrote: > Hi All, > > I am trying to change the last three letters of a string > > $ perl6 -e 'my $x="abcabcabc"; $x ~~ s/"a.*"$/xyz/; say $x;' > The double quotes around your text make it a string literal, so it will only match

Re: Does words have a delimiter?

Looking at that page myself, it doesn't appear that you can specify the separator for .words. So ... no. Though, that would make an interesting addition IMHO -Scott On Sat, Apr 14, 2018 at 12:27 AM, ToddAndMargo wrote: > Hi All, > > I am over on >

Re: [perl #131781] :?smth should construct a truthy pair (say (:?foo))

The OP said :?foo should work because :foo and :!foo work. I don't follow the logic. How are those things related? Why should :foo and :!foo imply :?foo? (In my head it makes as much sense as ":foo and :!foo implies :*foo", which is to say, none.) I don't see any benefit to adding a :?foo

Re: [perl #131781] :?smth should construct a truthy pair (say (:?foo))

The OP said :?foo should work because :foo and :!foo work. I don't follow the logic. How are those things related? Why should :foo and :!foo imply :?foo? (In my head it makes as much sense as ":foo and :!foo implies :*foo", which is to say, none.) I don't see any benefit to adding a :?foo

Re: learning perl6?

If, by "regular book", you mean "bound paper sheafs with ink on them", then the answer is currently "no". Is there something wrong with the documentation online? (besides there not being enough of it :) -Scott On Mon, Jan 4, 2016 at 9:55 PM, Yonghua Peng wrote: > Hello,

Re: grep changes?

The block does get the topic, but the regex isn't executing immediately. Another way to get what you want, rather than mentioning the topic explicitly, is to use the m// form of match. > grep { m/\.pl6/ }, (a.pl6) For sanity's sake, I would recommend writing your match-immediately regex like

Re: Strict Rakudo version of this Perl5 one-liner

If you're not married to the "key : value" format, you could use this: scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { .say for sort %d }' Here's another variation, but keeping your original format: scan +spam | perl6 -ne 'my %d; %d{.words[1]}++; END { say "$_.key() :

Re: [perl #118865] Parameter '' requires an instance, LTA error

IMHO, the message is actually slightly worse. Now it's talking about an invocant when there are no classes or methods involved! -Scott On Wed, Mar 11, 2015 at 1:26 PM, Christian Bartolomaeus via RT bugs-comm...@bugs6.perl.org wrote: The error message has changed slightly and now states that

Announce: Rakudo Compiler Release #81 (Linz)

6 test suite, MoarVM and the specification. The following people contributed to this release: Elizabeth Mattijsen, Jonathan Worthington, Tobias Leich, Moritz Lenz, Jonathan Scott Duff, Christian Bartolomäus, Brad Gilbert, Solomon Foster, Larry Wall, Pepe Schwarz, Timo Paulssen, Mikhail Khorkov

Re: s:g/T/U/ doesn't work ?

I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify

Announce: Rakudo Perl 6 compiler development release #57 (Tokyo)

On behalf of the Rakudo development team, I'm thrilled to announce the October 2012 release of Rakudo Perl #57 Tokyo. Rakudo is an implementation of Perl 6 on the Parrot Virtual Machine (see http://www.parrot.org). The tarball for this release is available from

[Announce] Rakudo 2012.06 Strasbourg

the release on 2012-05-17: Moritz Lenz, Jonathan Worthington, Patrick R. Michaud, kboga, Jonathan Scott Duff, Tadeusz Sośnierz, Carl Masak, Geoffrey Broadwell, diakopter, Solomon Foster, JimmyZ, TimToady If you would like to contribute, see http://rakudo.org/how-to-help, ask on the perl6-compi

Announce: Rakudo Perl 6 compiler development release #45 (Houston)

people contributed to this release: Jonathan Worthington, Moritz Lenz, Will Coke Coleda, Tadeusz Sośnierz, Patrick R. Michaud, Jonathan Scott Duff, Carl Masak, Geoffrey Broadwell, mls, snarkyboojum, gfldex, TimToady, TiMBuS, JimmyZ If you would like to contribute, see http://rakudo.org/how-to-help

Announce: Rakudo Perl 6 compiler development release #40 (ZA)

Lester, Jonathan Scott Duff, flussence, Patrick Abi Salloum, Carl Masak, Jarrod If you would like to contribute, see http://rakudo.org/how-to-help, ask on the perl6-compi...@perl.org mailing list, or ask on IRC #perl6 on freenode. The next release of Rakudo (#41) is scheduled for May 19, 2011

Re: Current vs future Perl 6 binary size

On Thu, Apr 21, 2011 at 6:33 PM, gvim gvi...@gmail.com wrote: This is not a criticism of anything. I am not a core developer but need to be aware of what to expect when Perl 6 settles down into a production-ready state. The Perl 6 binary within the January release of Rakudo Star is 10Mb on my

Announce: Rakudo Perl 6 compiler development release #34 (Paris)

manager Jonathan Scott Duff. If you would like to contribute, see http://rakudo.org/how-to-help, ask on the perl6-compi...@perl.org mailing list, or ask on IRC #perl6 on freenode. The next release of Rakudo (#35) is scheduled for November 18, 2010. A list of the other planned release dates

Re: Performance: ... vs ..

On Tue, Aug 3, 2010 at 1:18 AM, Aaron Sherman a...@ajs.com wrote: I know that Rakudo isn't well tuned for performance right now, but this is still probably worth noting because it's such a specific difference between two similar ways of doing one task. The recent thread about ... and .. had

Re: r31627 -[S32/Temporal] Changed to use a different way of specifying time zones, which is hopefully saner than my last proposal.

On Sun, Jul 11, 2010 at 12:56 PM, pugs-comm...@feather.perl6.nl wrote: Author: Kodi Date: 2010-07-11 19:56:33 +0200 (Sun, 11 Jul 2010) New Revision: 31627 Modified: docs/Perl6/Spec/S32-setting-library/Temporal.pod Log: [S32/Temporal] Changed to use a different way of specifying time

Re: underscores vs hyphens (was Re: A new era for Temporal)

On Sat, Apr 10, 2010 at 5:14 AM, Mark J. Reed markjr...@gmail.com wrote: I'd much rather see a single consistent style throughout the setting than backwards compatibility with p5 naming conventions. If Temporal is the first setting module to use multiword identifiers, I vote for hyphens.

Re: Custom errors on subsets?

that the functionality will fall out of the ability to have nice failures because surely something like the following works now: subset Filename of Str where { $_ ~~ :f or fail No such file: '$_' } Perhaps s/fail/die/, but that seems like a means to your desired end. -Scott -- Jonathan Scott Duff perlpi

Rakudo Perl 6 development release #22 (Thousand Oaks)

are scheduled to occur two days after each Parrot monthly release. Parrot releases the third Tuesday of each month. Have fun! -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: [perl #68876] issues with 3.. and ..3 in regular expression...

number as the end of the range use the Whatever *. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: Re-thinking file test operations

On Thu, Jul 9, 2009 at 7:50 PM, Aristotle Pagaltzis pagalt...@gmx.dewrote: * Moritz Lenz mor...@faui2k3.org [2009-07-10 00:25]: stat($str, :e)# let multi dispatch handle it for us This gets my vote. Me too. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: [perl #66250] Trouble with white space in Rakudo grammars

at the spec, so I'm not entirely sure what blank should match) -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: New CPAN

://perlcabal.org/syn/S11.html#Versioning -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: Unexpected behaviour with @foo.elems

in favor of the above forms instead. Or perhaps for 0...@foo.end - $k { ... } @foo.keys may not be what the user wanted if @foo is a sparse array. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

[perl #65224] class name as string unexpectedly works

# New Ticket Created by Jonathan Scott Duff # Please include the string: [perl #65224] # in the subject line of all future correspondence about this issue. # URL: http://rt.perl.org/rt3/Ticket/Display.html?id=65224 PerlJam rakudo: class Foo { }; my $x = Foo; my $y = $x.new; $y.WHAT.say

Re: [perl #64062] split should return captured delimiters

were abc::def::ghi::jkl, @split would contain (abc,:,,:,def,:,,:,ghi::jkl) -Scott -- Jonathan Scott Duff d...@lighthouse.tamucc.edu

Re: Some setting candidates

://wiki.github.com/rakudo/rakudo/setting-candidates See also the file docs/guide_to_setting.pod in the Rakudo repository. At present I'm still heavily favoring patches submitted via RT over those submitted via the fork queue on github. Pm -- Jonathan Scott Duff perlpi...@gmail.com

Re: Git workflow

, forgot to twiddle the frobnitz in the previous commit Just my humble opinion, -Scott -- Jonathan Scott Duff d...@lighthouse.tamucc.edu

Re: Programmatic REPL history/result access?

to the language itself? Sounds usefulish for the perl 6 REPL. But not so much for ordinary programming. So, given that, I'd say an external tool (module) is the way to go. -Scott -- Jonathan Scott Duff d...@lighthouse.tamucc.edu

Re: Rakudo repository -- svn or git?

now except to say this: I prefer git :-) -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: design of the Prelude (was Re: Rakudo leaving the Parrot nest)

trying to bootstrap as much as possible with just a few primitives to get things started. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: [PATCH] Add .trim method

them in terms of trim() rather than the other way around. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: [perl #62116] no interpolation into string of array element

So, it would seem that my @x = 1, 2, 3; say 2nd is @x[1]; # 2nd is 2 is perfectly valid perl 6. -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: Regex - Accessing captured subrules could be problematic

), but you don't want the significant whitespace, you can turn that off temporarily (or again, use some other technique). HTH, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Split with negative limits, and other weirdnesses

. -- The unavoidable price of reliability is simplicity -- C.A.R. Hoare Simplicity does not precede complexity, but follows it. -- A.J. Perlis 1 + 2 + 3 + 4 + ... = -1/12 -- Srinivasa Ramanujan my two cents, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: method signature issues

. If they didn't, then how would multi-methods then be possible? These dispatch first on the invocant, and then once that provides the methods to consider, by the multi-dispatch algorithm within those candidates. Jonathan -- Jonathan Scott Duff [EMAIL PROTECTED]

PCT patch

Scott Duff [EMAIL PROTECTED] diff --git a/compilers/pct/src/PCT/HLLCompiler.pir b/compilers/pct/src/PCT/HLLCompiler.pir index 13164ed..1a529a0 100644 --- a/compilers/pct/src/PCT/HLLCompiler.pir +++ b/compilers/pct/src/PCT/HLLCompiler.pir @@ -458,6 +458,14 @@ options provided. $P0 = $P0(args :flat

Re: muse on Compact Structs, pack/unpack

reorg, and most of them could use it. Maybe it's time to set up Twiki on my home machine... Larry -- Jonathan Scott Duff [EMAIL PROTECTED]

[perl #51838] [BUG] cygwin build fails

# New Ticket Created by Jonathan Scott Duff # Please include the string: [perl #51838] # in the subject line of all future correspondence about this issue. # URL: http://rt.perl.org/rt3/Ticket/Display.html?id=51838 --- osname= cygwin osvers= 1.5.24(0.15642) arch= cygwin-thread-multi-64int

Re: Perl6::Doc # Hail to the new pharao

You have my permission as well. -Scott On Dec 29, 2007 7:04 AM, herbert breunung [EMAIL PROTECTED] wrote: thanks to chromatic, so i have ask Jonathan Scott Duff, Phil Crow and wait for /Adrianos answer. what i yesterday also forgot to mention is that rumor says that the emerald tables

Re: Concerns about {...code...}

., the adverb would be required to make them interpolate) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Concerns about {...code...}

On Thu, Dec 20, 2007 at 11:23:05AM -0600, Jonathan Scott Duff wrote: Adriano answered #1 I think: $yaml = Q:!c{ $key: 42 }; Er, I just looked over the spec again and realized that Q does absolutely no interpolation, so it would be more like this: $yaml = Q:qq:!c{ $key: 42 }; or perhaps

[PATCH] [NQP] Use || in places where order matters

I understand that | and || may not actually be differentiated in implementation yet, but they do different things according to the spec. I've attached a patch for NQP to change | to || in places where I think it matters. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED] nqp.patch Description

Re: parentheses and context (was Re: state and START)

once while the third calls it every time (just as you have it written). Now, someone tell me if I'm right or wrong and why :-) Nicholas Clark -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

, , and backtracking.

... anyone care to enlighten me on how this is supposed to work? Thanks, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [svn:perl6-synopsis] r14421 - doc/trunk/design/syn

are just as important as the red threads, but they each may have different purposes in the overall design. my two cents, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Is Perl 6 too late?

it to be bad style. I think of it more like hungarian notation. The sigils enable a default set of expectations. Oh, I see an @, so this thing must be an array. Perl 6 has changed the meaning behind the notation ever so slightly, but the utility is still there. -Scott -- Jonathan Scott Duff

Re: Working on punie + rindolf (the implementation) Reloaded

of Perl 5 are still present in Perl 6: TMTOWTDI, easy things easy, hard things possible, etc. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Perl 6 Microgrants. Now accepting proposals.

THIS FILE - it is machine generated -*- c++ -*- So, perhaps it's not the .h files we should be parsing, but whatever source files were used to generate them. Though, of course, some C++-to-Perl6 tool would be a good thing too. :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Negative array subscripts

On 2/6/07, Smylers [EMAIL PROTECTED] wrote: Jonathan Scott Duff writes: ... I can see the need for a pragma to help out the Pascal or Fortran programmers start all of their arrays at something other than 0. Those sort of crutches in programming languages (let's help folk who know some

Re: Negative array subscripts

the need for a modifier so that an individual array can start at an index other that 0. just registering my tuppence, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Numeric Semantics

and have become used to the limitations of digital media. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Fwd: Numeric Semantics

I accidently sent this just to Darren ... -Scott -- Forwarded message -- From: Jonathan Scott Duff [EMAIL PROTECTED] Date: Jan 22, 2007 6:23 PM Subject: Re: Numeric Semantics To: Darren Duncan [EMAIL PROTECTED] On 1/22/07, Darren Duncan [EMAIL PROTECTED] wrote:. I think

Re: Fwd: Numeric Semantics

. (at least it does for me) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: beginner's question

, you probably want to know about Perl5 resources. A good place to start would be http://learn.perl.org/. Also, you might want to try on IRC. There's #perl on the freenode network and #perlhelp on efnet. hope this helps, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Automatic coercion and context

itself into a Foo. I'm of the opinion that if you need a routine to handle multiple types then you should define it such that it is sufficiently general enough to do so without the benefit of added behind the scenes magic. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: FYI compiling PIR function calls

$mysub()# calls the foo subroutine -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: renaming grep to where

all may cause confusion, but presumably, if an individual has asked for an alias, they are willing to risk the potential confusion. For me personally, I can live with filter as an alias for grep. But that's just me. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: -X file test operators

forms. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

dashed identifiers (was Re: -X file test operators)

$some_long_name if only to not touch the shift key :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: META vs meta

help? It's still a pollution of the method space, any way that you look at it... Yeah but perl has already has a cultural claim on ALLCAPS thingys. So, yes, it does help. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Stubborn coworkers

to apply the perl is line noise argument but only for perl6. IMHO, the same counter arguments apply. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Implicit current-index variable, scoped inside for-loops

that don't involve introducing some implicit thing. -Scott (PerlJam) -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: End the Hollerith Tyranny? (linelength.t)

to be too big of an endeavour, we can always go back to 80 columns, but I'm guessing whatever problems there are will be small and localized. just my humble opinion, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: clarify: does Dog is Mammal load Mammal for you?

something we shouldn't encourage as it tends toward tight coupling of implementations where it should be tight coupling of abstractions. I don't know ... someone argue my brain into a new position :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: NEXT and the general loop statement

; # LAST -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Curious corner cases concerning closure cloning

# again, blank on purpose 1 for 1,2 - $x { END { say $x } } For this one I'd guess that a solitary 2 is output. The END block closed over the $x and the last value that $x obtained was 2. my humble guesses, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Module/Class Authoritys

-- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [svn:perl6-synopsis] r10804 - doc/trunk/design/syn

the trick is built-in to the language :) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: S04 - forbidden coding-style

:if $hungry; go_postal :when $aggravation 10; .sleep :until .rested; *Everybody* wants the colon! ;-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: ===, =:=, ~~, eq and == revisited (blame ajs!)

1 } which is true if these return true values: sub { return 1 }-([1,2]) sub { return 1 }-(3) Which they do. So, smart-match fails as a deep equality operator precisely because it's so smart. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [ANNOUNCE] Pugs 6.2.12 and v6.pm released! (reformatted)

::Caller which fails to work using that compiler combination (i.e., fails all tests after a build using its makefile and Visual Studio 2003 as the C compiler). Bummer. You could check out the Vanilla/Strawberry Perl effort at http://win32.perl.org/ -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Pm's YAPC::NA talk online

and a much simpler language like PIR ;). TGE lets you factor out the complexity of your source language in incremental steps (as small or as large steps as you want). Good luck for today's presentation :) Yeah, good luck Pm :) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Why does p6 always quote non-terminals?

will come along and give something more definitive :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Mutil Method Questions

. Not that perl shouldn't let the programmer get himself in trouble, but this seems like one of those things that should require asking to turn on rather than asking to turn off. my two cents, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Mutil Method Questions

On Fri, Jun 23, 2006 at 06:55:28PM +0300, Markus Laire wrote: On 6/23/06, Jonathan Scott Duff [EMAIL PROTECTED] wrote: An alternate interpretation would be that the last one is actually a compile- time error because none of the sigs match (Int,Int) and for a call to work with 2 Int

Re: Can foo(123) dispatch to foo(Int) (was: Mutil Method Questions)

is well. Otherwise it's an error. Since Num does Int, a call such as Cfoo(10); succeeds. At least that's my vague interpretation of this aspect of perl6 at this moment. :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: lvalue functions and lvalue parameters

be constant Int $a = 0; constant Int $b = 0; (cond(True, $a,$b))++; and that should fail at compile time because the compiler knows that $a and $b are constant and can't be rw. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Concurrency: hypothetical variables and atomic blocks

the locks in virtual time such that they still make sense. Then you just pretend that things happened in that order. Forgive this ignorant soul; but what is STM? Software Transaction Memory -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Simple Print/Say Question

going to type @results, maybe it needs to be: my @results is Array of Array of int; or maybe my Array of int @results; Or something like that :-) -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Newbe: How do I configure @*INC ?

) separated list of directories to search. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Windows Binaries for Pugs

are definitely worth it to give people something to play with (especially on difficult platforms like Windows). It doesn't have to be the latest and greatest, it just has to implement a large-enough feature set. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: A rule by any other name...

the correspondence between classes+methods and grammars+rules, then surely grammars are composable entities just like classes. Seeking clarification, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: A rule by any other name...

On Thu, May 11, 2006 at 12:19:21PM -0700, Allison Randal wrote: Jonathan Scott Duff wrote: On Wed, May 10, 2006 at 05:58:57PM -0700, Allison Randal wrote: rule: - Has :ratchet and :skip turned on by default - May only be used inside a grammar Should that be - Must be declared as part

Re: Scans

specify. My vote would be that list([+] 1) == (1) just like [+] 1 == 1 -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: S5 - Question about repetition qualifier

syntax. How often does that come up in practice though? I don't think I've ever wanted something like that. If we allow Junction of Int that also gets us Set of Int as Junctions are just funny Sets. Why not Array of Int too? -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: S05: Interpolated hashes?

to the spot where the key actually matched. /speculation -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [svn:perl6-synopsis] r8899 - doc/trunk/design/syn

immediately in a value context (void, Boolean, string, or numeric) and since (state $x) ||= / pattern /; is very much the same as state $x; $x = $x || /pattern/; I'd say that's a boolean context and thus matches against $_ instead of assigning the Regex object to $x. -Scott -- Jonathan Scott

Re: [svn:perl6-synopsis] r8899 - doc/trunk/design/syn

On Fri, Apr 21, 2006 at 11:06:20AM -0700, Larry Wall wrote: On Fri, Apr 21, 2006 at 12:45:13PM -0500, Jonathan Scott Duff wrote: : According to S05, a /.../ matches immediately in a value context : (void, Boolean, string, or numeric) and since : : (state $x) ||= / pattern

Re: synopses

On Sat, Apr 08, 2006 at 03:22:15PM -0400, Sean Sieger wrote: Is there public access to the synopses at svn or cvs? If you're just looking for read-only access, see http://svn.perl.org/perl6/doc/trunk -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [svn:perl6-synopsis] r8569 - doc/trunk/design/syn

change? Sending the log + diff gives an easy way to brain-filter the messages too. I can look at the log and decide if I really care about the minute changes to twigils enough to read through all of the places where it makes a difference. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: Perl 6 on Solaris 10 anyone ?

Parrot VM ? Isn't that right ? Eventually. When there's a perl6 compiler that's based on parrot. Right now, the only usable implementation of perl6 that we have is pugs. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: 'temp $x;' with no assignment

, except from a historical perspective. Is there some reason we're huffmannizing my $x = 5; { temp $x = $MY::x + 1;# or whatever the proper syntax is # $x is 6 } $x = 5; ?? Can you elaborate an example that would show this to be a boon? -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: 'temp $x;' with no assignment

On Mon, Mar 27, 2006 at 10:46:02PM +0200, Yuval Kogman wrote: On Mon, Mar 27, 2006 at 14:35:52 -0600, Jonathan Scott Duff wrote: I think that if Ctemp is the new Clocal, then immediately after the Ctemp $x line, $x should hold whatever flavor of undef is appropriate. snip Is there some

Re: The definition of 'say'

too have been thinking of say as print + newline. -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: ff and fff [Was: till (the flipflop operator, formerly ..)]

On Wed, Jan 25, 2006 at 11:37:42AM -0800, Larry Wall wrote: I've changed the flipflop operator/macro to ff, short for flipflop. Two questions: 1) Will ff (and fff) require whitespace around them? 2) Do we get a more punctuationish unicode equivalent? -Scott -- Jonathan Scott Duff [EMAIL

  1   2   3   4   5   >