Are you tired of bash scripting?
http://pypi.python.org/pypi/Scripy
http://bitbucket.org/ares/scripy/
--
http://mail.python.org/mailman/listinfo/python-announce-list
Support the Python Software Foundation:
http://www.python.org/psf/donations/
Benjamin Kaplan, 27.01.2010 22:25:
On Wed, Jan 27, 2010 at 3:56 PM, John Nagle na...@animats.com wrote:
2. Python 3 is supported by multiple Python implementations.
FALSE - Only CPython supports 3.x. Iron Python, Unladen Swallow,
PyPy, and Jython have all stayed with 2.x
Hi!
I have an exotic db, with exotic drivers, and it have buggy ODBC driver.
But I have native driver - under Delphi.
I need to access this DB under Pylons (or mod_python).
I wrote one solution that working with XML.
But I search for easier way to transform and move data between apps.
I saw
David Cournapeau courn...@gmail.com writes:
Unstable may be strong - every minor version of python has a lifespan
of several years. But yes, that's an hindrance for packagers: you need
to package binaries for every minor version of python
It's important to note that this is mitigated,
Ben Finney, 27.01.2010 22:50:
Christian Heimes writes:
John Nagle wrote:
1. Python 3 is supported by major Linux distributions.
FALSE - most distros are shipping with Python 2.4, or 2.5 at best.
You are wrong. Modern versions of Debian / Ubuntu are using Python
2.6.
Only if by
David Cournapeau, 28.01.2010 06:58:
On Thu, Jan 28, 2010 at 7:38 AM, Terry Reedy wrote:
For a windows user who depends on pre-built binaries, every new release
breaks *every* library that is not pure Python and needs to be compiled.
That's not windows specific - most packages which
Jonathan Gardner jgard...@jonathangardner.net writes:
If you're going to have statements, you're going to need the null
statement. That's pass.
Why? Expressions are statements, so you could just say pass (in
quotes, denoting a string literal), or 0, or None, os anything else like
that, instead
Stefan Behnel stefan...@behnel.de writes:
The amount of work that the Jython project put into catching up from 2.1 to
2.5/6 (new style classes! generators!) is really humongous compared to the
adaptations that an implementation needs to do to support Python 3 code.
I wonder whether Jython
On Thu, Jan 28, 2010 at 5:08 PM, Ben Finney ben+pyt...@benfinney.id.au wrote:
It's important to note that this is mitigated, ironically enough, by
intentionally targeting a minimum Python minor version because the code
base makes use of Python features not available in older versions.
That
On Thu, Jan 28, 2010 at 5:40 PM, Stefan Behnel stefan...@behnel.de wrote:
That doesn't completely match my experience. It's true that there is no
guarantee that the ABI will stay compatible, but when you compile lxml
against Py2.4 on a 32bit machine, it will continue to import in Py2.5 and
* Steven D'Aprano:
On Wed, 27 Jan 2010 18:29:25 +0100, Alf P. Steinbach wrote:
The main problem with the incompatibility is for porting code, not for
writing code from scratch.
Correct. It's a trivial problem, but still a problem.
It's also a problem wrt. learning the language.
This
David Cournapeau, 28.01.2010 09:54:
On Thu, Jan 28, 2010 at 5:40 PM, Stefan Behnel wrote:
That doesn't completely match my experience. It's true that there is no
guarantee that the ABI will stay compatible, but when you compile lxml
against Py2.4 on a 32bit machine, it will continue to
David Cournapeau courn...@gmail.com writes:
So yes, you could say just try and if it crashes, check that it is
not ABI-related. In practice, this is very poor engineering in my
book...
I just looked at PEP 384 and I don't see anything in it about version
numbers in the interfaces. I certainly
Terry Reedy tjre...@udel.edu wrote:
Constant tuples (a tuple whose members are all seen as constants by the
compiler) are now pre-compiled and constructed once and put into the
code object as such rather than re-constructed with each run of the code.
Sadly that's not entirely accurate.
Please don't post more noise and ad hominem attacks to the group, Steve.
Ad hominem?
Please, operor non utor lingua non notus per vulgaris populus.
Gratias ago vos...
--
http://mail.python.org/mailman/listinfo/python-list
Luis M. González wrote:
Please don't post more noise and ad hominem attacks to the group, Steve.
Ad hominem?
Please, operor non utor lingua non notus per vulgaris populus.
Gratias ago vos...
ad hominem is lingua notus per vulgaris populus, the vulgar pop of these
parts, anyway.
--
On Jan 25, 8:05 pm, Alexander Moibenko moibe...@fnal.gov wrote:
I have a simple question to which I could not find an answer.
What is the [total maximal] size of list including size of its elements?
Beware, sys.getsizeof(alist) is 4*len(alist) + a bit, regardless of
alists's contents ?!
See
Owen Jacobson wrote:
On 2010-01-27 21:06:28 -0500, Rotwang sg...@hotmail.co.uk said:
Hi all, I've been trying to make a class with which to manipulate
sound data, and have run into some behaviour I don't understand which
I hope somebody here can explain. The class has an attribute called
In the code:
f = open('input.txt', 'r+')
for line in f:
s = line.replace('python', 'PYTHON')
# f.tell()
f.write(s)
When f.tell() is commented, 'input.txt' does not change; but when
uncommented, the f.write() succeeded writing into the 'input.txt'
(surprisingly, but not entirely
Hi all,
I wonder if anyone knows any alternative function in pylab (or
otherwise) that could be used to save an image. My problem is as
follows:
---
from pylab import *
...
figure(1)
fig1 = gca()
figure(2)
fig2 = gca()
figure(3)
fig3 = gca()
for i,data_file in
I'm going to be starting some new Python projects in Python 2.6, but am
concerned that at least three of the libraries I will be
using--pycrypto, paramiko and feedparser--are not currently supported in
Python 3.x. The authors of these programs have not given any indication
that work is
On Jan 27, 3:07 pm, Arnaud Delobelle arno...@googlemail.com wrote:
On 27 Jan, 14:41, D HANNEY spam2...@nney.com wrote:
[...]
See [1] for an explanation. Here is an idea: you could get round that
by generating a class on the fly, if you don't mind changing the class
of the object (untested):
[snip]
Regex doesn't gain you much. I'd split the string and then fix the parts
as necessary:
def parse_address(address):
... parts = address.split()
... if parts[-2] == S:
... parts[1 : -1] = [parts[-2]] + parts[1 : -2]
... parts[1 : -1] = [ .join(parts[1 :
On Jan 28, 7:40 am, Brian D brianden...@gmail.com wrote:
[snip]
Regex doesn't gain you much. I'd split the string and then fix the parts
as necessary:
def parse_address(address):
... parts = address.split()
... if parts[-2] == S:
... parts[1 : -1] =
On Jan 28, 1:31 pm, D HANNEY spam2...@nney.com wrote:
Your solution works if I change type(obj) to say obj.__class__.
If I don't make this change Python complains TypeError: Error when
calling the metaclass bases type 'instance' is not an acceptable base
type.
So, I've got something that
Suppose we have a program that writes its process id into a pid file.
Usually the program deletes the pid file when it exists... But in some
cases (for example, killed with kill -9 or TerminateProcess) pid file is
left there. I would like to know if a process (given with its process
id) is
On 01/28/10 11:28, Brian D wrote:
I've tackled this kind of problem before by looping through a patterns
dictionary, but there must be a smarter approach.
Two addresses. Note that the first has incorrectly transposed the
direction and street name. The second has an extra space in it before
On 10:50 am, gand...@shopzeus.com wrote:
Suppose we have a program that writes its process id into a pid file.
Usually the program deletes the pid file when it exists... But in
some cases (for example, killed with kill -9 or TerminateProcess) pid
file is left there. I would like to know if a
On Jan 28, 7:12 am, Lie Ryan lie.1...@gmail.com wrote:
In the code:
f = open('input.txt', 'r+')
for line in f:
s = line.replace('python', 'PYTHON')
# f.tell()
f.write(s)
[snip]
My guess is that there are a few possible problems:
1) In this case, writing to file opened
* Anthony Tolle:
On Jan 28, 7:12 am, Lie Ryan lie.1...@gmail.com wrote:
In the code:
f = open('input.txt', 'r+')
for line in f:
s = line.replace('python', 'PYTHON')
# f.tell()
f.write(s)
[snip]
My guess is that there are a few possible problems:
1) In this case, writing to
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
AGATAAGCTAATTAAGCTACTGGGTT 1
* evilweasel:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
AGATAAGCTAATTAAGCTACTGGGTT 1
On Jan 28, 3:07 pm, evilweasel karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program.
snip
for j in range(0, b):
if lister[j] == 0:
At a guess, this line should be:
if lister[j] == '0':
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I
On Thu, 28 Jan 2010 07:07:04 -0800 (PST)
evilweasel karthikramaswam...@gmail.com wrote:
I am a newbie to python, and I would be grateful if someone could
Welcome.
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
You don't say how it isn't
On Thu, Jan 28, 2010 at 4:31 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I
On Jan 28, 12:29 pm, kiwanuka robert.kiwan...@gmail.com wrote:
Hi all,
I wonder if anyone knows any alternative function in pylab (or
otherwise) that could be used to save an image. My problem is as
follows:
---
from pylab import *
...
figure(1)
fig1 = gca()
figure(2)
* kiwanuka:
On Jan 28, 12:29 pm, kiwanuka robert.kiwan...@gmail.com wrote:
Hi all,
I wonder if anyone knows any alternative function in pylab (or
otherwise) that could be used to save an image. My problem is as
follows:
---
from pylab import *
...
figure(1)
fig1 = gca()
figure(2)
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ignore the ones
On Jan 22, 2010, at 11:56 AM, Roald de Vries wrote:
Hi Martin,
On Jan 21, 2010, at 8:43 AM, Martin Drautzburg wrote:
Hello all,
When passing parameters to a function, you sometimes need a paramter
which can only assume certain values, e.g.
def move (direction):
...
If
I have been working with Python 3 for over a year. I used it in
writing my book Bioinformatics Programming Using Python (http://oreilly.com/catalog/9780596154509
). I didn't see any point in teaching an incompatible earlier version
of a language in transition. In preparing the book and its
In article pan.2010.01.28.00.35...@remove.this.cybersource.com.au,
Steven D'Aprano ste...@remove.this.cybersource.com.au wrote:
On Wed, 27 Jan 2010 16:25:46 -0500, Benjamin Kaplan wrote:
When Python 2.6 came out, Jython was still on 2.2. The difference
between 2.2 and 2.6 is almost as big of a
Many people who want to learn Islam or are new converts find it hard
to have a simplified guide that explains to them the basics of Islam
in a nutshell; so I decided to collect the basic guidelines and gather
them in an e-book I named it Basic Islam for Introducing Islam
In article mailman.1545.1264694607.28905.python-l...@python.org,
Mitchell L Model mlm...@comcast.net wrote:
I use the sep and end keywords all the time.
What are 'sep' and 'end'? I'm looking in
http://docs.python.org/3.1/genindex-all.html and don't see those mentioned
at all. Am I just
In article zt68n.3893$pv.1...@news-server.bigpond.net.au,
Neil Hodgson nyamatongwe+thun...@gmail.com wrote:
Carl Banks:
There is also no hope someone will fork Python 2.x and continue it in
perpetuity. Well, someone might try to fork it, but they won't be
able to call it Python.
Over
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been
* Roy Smith:
In article mailman.1545.1264694607.28905.python-l...@python.org,
Mitchell L Model mlm...@comcast.net wrote:
I use the sep and end keywords all the time.
What are 'sep' and 'end'? I'm looking in
http://docs.python.org/3.1/genindex-all.html and don't see those mentioned
at
On Thu, Jan 28, 2010 at 11:09, talal awadh allah...@gmail.com wrote:
Many people who want to learn Islam or are new converts find it hard
I just wanted to thank you for reminding me that I needed to write a
mail filter to delete this kind of drivel. I appreciate the reminder!
Cheers,
Jeff
--
On 01/28/10 19:37, Paul Rubin wrote:
Jonathan Gardner jgard...@jonathangardner.net writes:
If you're going to have statements, you're going to need the null
statement. That's pass.
Why? Expressions are statements, so you could just say pass (in
quotes, denoting a string literal), or 0, or
Stefan wrote:
From an implementors point of view, it's actually quite the opposite. Most
syntax features of Python 3 can be easily implemented on top of an existing
Py2 Implementation (we have most of them in Cython already, and I really
found them fun to write), and the shifting-around in the
Le Thu, 28 Jan 2010 00:19:24 +, Steven D'Aprano a écrit :
4. Python 3 will make you irresistible to women.
FALSE - Python 3 coders are no more likely to get a date than any
other programmer.
They spend less time coding, so they /can/ get more dates (what a
strange English word)
On 01/28/10 20:12, Alf P. Steinbach wrote:
* Steven D'Aprano:
On Wed, 27 Jan 2010 18:29:25 +0100, Alf P. Steinbach wrote:
Instead of:
print fileObj, x, y, z
you use regular function syntax with a meaningful keyword:
print(x, y, z, file=fileObj)
If you want suppress the newline at the
Le Wed, 27 Jan 2010 17:36:29 -0800, alex23 a écrit :
I've been a big supporter of Py3 from the beginning, but this repeated
claim of US becoming the mainline interpreter for 3.x pretty much kills
dead a lot of my interest.
As long as the U-S JIT can be disabled at compile-time (and also at
nn prueba...@latinmail.com writes:
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the
On 1/28/2010 10:50 AM, evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample).
Correction:
[snip] the expression parts[1 : -1] means gather list items from the
second element in the list (index value 1) to one index position
before the end of the list. [snip]
MRAB's solution was deserving of a more complete solution:
def parse_address(address):
# Handles
* Lie Ryan:
On 01/28/10 20:12, Alf P. Steinbach wrote:
import builtins
org_print = print
builtins.print = 666
print( trallala )
Traceback (most recent call last):
File stdin, line 1, in module
TypeError: 'int' object is not callable
org_print( but is that really so
On Jan 28, 8:27 am, Lie Ryan lie.1...@gmail.com wrote:
On 01/28/10 11:28, Brian D wrote:
I've tackled this kind of problem before by looping through a patterns
dictionary, but there must be a smarter approach.
Two addresses. Note that the first has incorrectly transposed the
direction
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant jeanmic...@sequans.com wrote:
Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really overkill for
On 1/28/2010 1:37 AM, Paul Rubin wrote:
David Cournapeaucourn...@gmail.com writes:
That's not windows specific - most packages which distribute binary
packages need to package binaries for every minor version (2.4, 2.5,
etc...)
I doubt that's what Paul was referring to, though - he seemed
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to
On 1/28/2010 3:37 AM, Paul Rubin wrote:
Jonathan Gardnerjgard...@jonathangardner.net writes:
If you're going to have statements, you're going to need the null
statement. That's pass.
Why? Expressions are statements, so you could just say pass (in
quotes, denoting a string literal), or 0, or
D'Arcy J.M. Cain wrote:
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant jeanmic...@sequans.com wrote:
Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two
I've to call to many functions with the format:
run(cmd)
were cmd is a command with its arguments to pass them to the shell
and run it, i.e.
run(pwd)
or
run(ls /home)
Does anybody knows any library to help me to avoid the use of the main
quotes, and brackets?
I would to use anything as:
On Jan 28, 8:10 am, a...@pythoncraft.com (Aahz) wrote:
In article zt68n.3893$pv.1...@news-server.bigpond.net.au,
Neil Hodgson nyamatongwe+thun...@gmail.com wrote:
Carl Banks:
There is also no hope someone will fork Python 2.x and continue it in
perpetuity. Well, someone might try to
Feedparser isn't supported for Python 3.0, so in Python 2.6, many warning
messages appear. I'm trying, in Python 2.6, to suppress the warning message:
./feedparser\feedparser.py:69: DeprecationWarning:
the sgmllib module has been removed in Python 3.0
import sgmllib,
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been
On 1/28/2010 11:03 AM, Mitchell L Model wrote:
I have been working with Python 3 for over a year. I used it in writing
my book Bioinformatics Programming Using Python
(http://oreilly.com/catalog/9780596154509). I didn't see any point in
teaching an incompatible earlier version of a language in
On Jan 28, 12:28 pm, Steven Howe howe.ste...@gmail.com wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to
John Nagle wrote:
Feedparser isn't supported for Python 3.0, so in Python 2.6, many
warning
messages appear. I'm trying, in Python 2.6, to suppress the warning
message:
./feedparser\feedparser.py:69: DeprecationWarning:
the sgmllib module has been removed in Python 3.0
import
On 2010-01-28, Joan Miller pelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on os.system().
--
Josh dutchie Holland j...@joshh.co.uk
http://www.joshh.co.uk/
http://twitter.com/jshholland
http://identi.ca/jshholland
--
I'm hoping someone on here can point me to an example of a python
package that is a great example of how to put it all together. I'm
hoping for example code that demonstrates:
-Strict adherence to PEP 8
-thorough use of Docstrings
-Conventional directory structure/package layout
-Appropriate use
On 28 ene, 19:16, Josh Holland j...@joshh.co.uk wrote:
On 2010-01-28, Joan Miller pelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on os.system().
No. I've a function that uses subprocess to run commands on the same
shell and so substitute
On 2010-01-28, Big Stu stu.dohe...@gmail.com wrote:
I'm hoping someone on here can point me to an example of a python
package that is a great example of how to put it all together. I'm
hoping for example code that demonstrates:
Surely most of the Standard Library should satisfy all your
On 2010-01-28 17:03, Mitchell L Model wrote:
I have been working with Python 3 for over a year. I used it in writing
my book Bioinformatics Programming Using Python
(http://oreilly.com/catalog/9780596154509).
That book sounds very interesting, even though I am more interested in
the
On 07:28 pm, j...@joshh.co.uk wrote:
On 2010-01-28, Big Stu stu.dohe...@gmail.com wrote:
I'm hoping someone on here can point me to an example of a python
package that is a great example of how to put it all together. I'm
hoping for example code that demonstrates:
Surely most of the Standard
On Jan 28, 2:28 pm, Josh Holland j...@joshh.co.uk wrote:
On 2010-01-28, Big Stu stu.dohe...@gmail.com wrote:
I'm hoping someone on here can point me to an example of a python
package that is a great example of how to put it all together. I'm
hoping for example code that demonstrates:
On 28 ene, 19:17, Big Stu stu.dohe...@gmail.com wrote:
I'm hoping someone on here can point me to an example of a python
package that is a great example of how to put it all together. I'm
hoping for example code that demonstrates:
-Strict adherence to PEP 8
-thorough use of Docstrings
On 2010-01-28, exar...@twistedmatrix.com exar...@twistedmatrix.com wrote:
Have you actually looked at any of the standard library?
Not recently or in depth, no. I would have thought that it would be of
high quality. I must have been mistaken.
--
Josh dutchie Holland j...@joshh.co.uk
Have you actually looked at any of the standard library?
Jean-Paul
I'm looking at urllib2 right now and it is covering a bunch of the
bases I'm looking for. And grepping in the /usr/lib/python2.5/ folder
for import statements on various things I'm interested in is bringing
up some good
Carl Banks wrote:
On Jan 28, 8:10 am, a...@pythoncraft.com (Aahz) wrote:
In article zt68n.3893$pv.1...@news-server.bigpond.net.au,
Neil Hodgson nyamatongwe+thun...@gmail.com wrote:
Carl Banks:
There is also no hope someone will fork Python 2.x and continue it in
perpetuity. Well, someone
Joan Miller wrote:
On 28 ene, 19:16, Josh Holland j...@joshh.co.uk wrote:
On 2010-01-28, Joan Miller pelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on os.system().
No. I've a function that uses subprocess to run commands on the same
shell
Why am I getting the following error message. Area has been declared as an
attribute of Circle. Thanks, Ray
class Circle:
def __init__(self):
self.radius = 1
def area(self):
return self.radius * self.radius * 3.14159
c = Circle()
c.radius = 3
print c.area()
Traceback (most
Steven Howe wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On 2010-01-28, Joan Millerpelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on os.system().
No. I've a function that uses subprocess to run
On 28 ene, 19:54, Steve Holden st...@holdenweb.com wrote:
Joan Miller wrote:
On 28 ene, 19:16, Josh Holland j...@joshh.co.uk wrote:
On 2010-01-28, Joan Miller pelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on os.system().
No. I've a
On 07:49 pm, stu.dohe...@gmail.com wrote:
Have you actually looked at any of the standard library?
Jean-Paul
I'm looking at urllib2 right now and it is covering a bunch of the
bases I'm looking for. And grepping in the /usr/lib/python2.5/ folder
for import statements on various things I'm
On 28 ene, 19:58, John Posner jjpos...@optimum.net wrote:
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On 2010-01-28, Joan Millerpelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on
On Thu, Jan 28, 2010 at 11:57 AM, Ray Holt mrhol...@sbcglobal.net wrote:
Why am I getting the following error message. Area has been declared as an
attribute of Circle. Thanks, Ray
class Circle:
def __init__(self):
self.radius = 1
def area(self):
return self.radius *
On Jan 28, 12:13 pm, Joan Miller pelok...@gmail.com wrote:
On 28 ene, 19:58, John Posner jjpos...@optimum.net wrote:
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On 2010-01-28, Joan Millerpelok...@gmail.com wrote:
I've to call to
On Jan 29, 6:58 am, John Posner jjpos...@optimum.net wrote:
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On 2010-01-28, Joan Millerpelok...@gmail.com wrote:
I've to call to many functions with the format:
run(cmd)
Check the docs on
Ray Holt wrote:
Why am I getting the following error message. Area has been declared as
an attribute of Circle. Thanks, Ray
class Circle:
def __init__(self):
self.radius = 1
def area(self):
return self.radius * self.radius * 3.14159
c = Circle()
c.radius = 3
print
Ray Holt wrote:
Why am I getting the following error message. Area has been declared as
an attribute of Circle. Thanks, Ray
class Circle:
def __init__(self):
self.radius = 1
def area(self):
return self.radius * self.radius * 3.14159
c = Circle()
c.radius = 3
print c.area()
On 28 ene, 20:20, Peter peter.milli...@gmail.com wrote:
On Jan 29, 6:58 am, John Posner jjpos...@optimum.net wrote:
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On 2010-01-28, Joan Millerpelok...@gmail.com wrote:
I've to call to
On 28 ene, 20:34, Joan Miller pelok...@gmail.com wrote:
On 28 ene, 20:20, Peter peter.milli...@gmail.com wrote:
On Jan 29, 6:58 am, John Posner jjpos...@optimum.net wrote:
On 1/28/2010 2:24 PM, Joan Miller wrote:
On 28 ene, 19:16, Josh Hollandj...@joshh.co.uk wrote:
On
We all know that Python is dynamically typed, and dynamically typed languages
are generally slower than statically typed ones. I wonder if it is possible at
all for Python to mix statically-typed-ness with dynamically-typed-ness to
boost up its speed a little bit, especially when speed is
On 1/28/2010 2:51 PM, Steve Holden wrote:
Carl Banks wrote:
Regardless of how magnaminous the people of PSF are, the unfortunate
reality is that trademark owners are forced by the law to be
particularly petty. PSF's IP lawyer will advise not to allow
unsanctioned fork of Python 2.7 to call
Arnaud Delobelle wrote:
nn prueba...@latinmail.com writes:
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the
Steven D'Aprano wrote:
4. Python 3 will make you irresistible to women.
FALSE
What?!? Drat!!! Guess I'll have to learn Lisp... ;)
~Ethan~
--
http://mail.python.org/mailman/listinfo/python-list
1 - 100 of 222 matches
Mail list logo