On 20/01/2014 17:09, Neil Cerutti wrote:
On 2014-01-20, Devin Jeanpierre wrote:
On Mon, Jan 20, 2014 at 8:16 AM, Mark Lawrence
wrote:
On 20/01/2014 16:04, Neil Cerutti wrote:
I use regular expressions regularly, for example, when
editing text with gvim. But when I want to use them in Python
On 20/01/2014 17:06, Rustom Mody wrote:
On Monday, January 20, 2014 10:10:32 PM UTC+5:30, Devin Jeanpierre wrote:
On Mon, Jan 20, 2014 at 8:16 AM, Mark Lawrence wrote:
On 20/01/2014 16:04, Neil Cerutti wrote:
I use regular expressions regularly, for example, when editing
text with gvim. But wh
On Monday, January 20, 2014 10:10:32 PM UTC+5:30, Devin Jeanpierre wrote:
> On Mon, Jan 20, 2014 at 8:16 AM, Mark Lawrence wrote:
> > On 20/01/2014 16:04, Neil Cerutti wrote:
> >> I use regular expressions regularly, for example, when editing
> >> text with gvim. But when I want to use them in Pyth
On 2014-01-20, Devin Jeanpierre wrote:
> On Mon, Jan 20, 2014 at 8:16 AM, Mark Lawrence
> wrote:
>> On 20/01/2014 16:04, Neil Cerutti wrote:
>>> I use regular expressions regularly, for example, when
>>> editing text with gvim. But when I want to use them in Python
>>> I have to contend with the
On Mon, Jan 20, 2014 at 8:16 AM, Mark Lawrence wrote:
> On 20/01/2014 16:04, Neil Cerutti wrote:
>> I use regular expressions regularly, for example, when editing
>> text with gvim. But when I want to use them in Python I have to
>> contend with the re module. I've never become comfortable with
>>
On 20/01/2014 16:04, Neil Cerutti wrote:
On 2014-01-20, Roy Smith wrote:
In article
, Ben
Finney wrote:
Be aware that regex is not the solution to all parsing
problems; for many parsing problems it is an attractive but
inappropriate tool. You may need to construct a more specific
parser for y
On 2014-01-20, Roy Smith wrote:
> In article
> , Ben
> Finney wrote:
>> Be aware that regex is not the solution to all parsing
>> problems; for many parsing problems it is an attractive but
>> inappropriate tool. You may need to construct a more specific
>> parser for your needs. Even if it's pos
In article ,
Ben Finney wrote:
> With a little experimenting I get:
>
> >>> p = re.compile('((?:CAA)+)?((?:TCT)+)?((?:TA)+)?')
> >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
> [('CAACAACAA', 'TCTTCTTCTTCT', 'TATATA'), ('', '', '')]
Perhaps a matter of style, but I would have left o
Aah! I understand now.
Thank you
Regards,
Krishna Mohan
On Mon, Jan 20, 2014 at 4:48 PM, Ben Finney wrote:
> km writes:
>
> > I am trying to find sub sequence patterns but constrained by the order
> > in which they occur
>
> There are also specific resources for understanding and testing rege
km writes:
> I am trying to find sub sequence patterns but constrained by the order
> in which they occur
There are also specific resources for understanding and testing regex
patterns, such as http://www.pythonregex.com/>.
> For example
>
> >>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
> >>> p.fi
On Mon, Jan 20, 2014 at 9:44 PM, km wrote:
p = re.compile('(CAA)+?(TCT)+?(TA)+?')
p.findall('CAACAACAATCTTCTTCTTCTTATATA')
> [('CAA', 'TCT', 'TA')]
>
> But I instead find only one instance of the CAA/TCT/TA in that order.
> How can I get 3 matches of CAA, followed by four matches of TCT
On Mon, Jan 20, 2014 at 2:44 AM, km wrote:
> I am trying to find sub sequence patterns but constrained by the order in
> which they occur
> For example
>
p = re.compile('(CAA)+?(TCT)+?(TA)+?')
p.findall('CAACAACAATCTTCTTCTTCTTATATA')
> [('CAA', 'TCT', 'TA')]
>
> But I instead find only o
I am trying to find sub sequence patterns but constrained by the order in
which they occur
For example
>>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAA', 'TCT', 'TA')]
But I instead find only one instance of the CAA/TCT/TA in that order.
How can I get
13 matches
Mail list logo
