Dear all,
I have a problem with accessing class attributes. I was unable to solve this
yet, but someone may know how to solve it.
I'm trying to extract some information from the summary, and Akaike
weight has the desired value.
Object for a model fitted using the glmmML function from the
glmmML pa
See ?confint2 in the nlrwr package for confidence intervals and for more info
on hypothesis testing in nonlinear regression focused on R see the book
associated with that package.
On Wed, Dec 24, 2008 at 6:20 PM, adam99 wrote:
>
> I am using nonlinear regression to fit a couple of variables to a
On Dec 24, 2008, at 6:20 PM, adam99 wrote:
I am using nonlinear regression to fit a couple of variables to a
set of
measurements. I would like to do some significance tests for the
estimated
parameters. I am able to check the confidence intervals using the
Jacobian
coming out of nonline
Tests of statistical significance and/or confidence intervals for individual
parameters in nonlinear regression are often meaningless and misguided.
Nonlinear regression is **inherently** different than linear regression. It
may make no physical sense whatever to eliminate *any* of the parameters
d
Lacking specifics about what you actually did, one can only guess.
Have you yet tried setting
..., main = "" , within the plot call, whatever that might have
been?
Failing that, the way to specify the color of the "main" argument to
title() is not bg (which is an argument for the plot
Hi, useRs-
I have a plot with a title generated automatically.
I need to overwrite the title, but I can't figure out how to do that.
I've tried the following:
title( "abc", bg='white')
But, that does not set the title background as white.
Now I am stuck and need your help. Thanks-
--
View
Dear Sir/Madam,
Since a few day now I try to use the command "polygenic" from the GenAbel
package. However, I keep bumping up against an error message: "Error in
polygenic(Testo, kin = kinship, data = data1) : dimension of outcome and
kinship.matrix do not match".
My data exists of 1240 indi
Dear All!
I want to test a coeffcient restriction beta=1 in a univariate model lm
(y~x). Entering
lm((y-x)~1) does not help since anova test requires the same dependent
variable. What is the right way to proceed?
Thank you for your help and marry xmas,
Serguei Kaniovski
Dear Mr. Ripley,
snowfall 1.7 is finished, and is now working on Windows as intended -
sorry for my oversight of that error. The given example now runs (as a
sidenote: snow does not have to loaded explicitely, snowfall will do that).
Also the NWS startup is fixed now (thanks to M. Schmidtberg
Dear R-helpers:
I am new to R and would like to seek your expert opinion on installation
tip. Many thanks in advance.
I want to update my R to the newest version and wonder the following two
questions:
Question 1:
How can I install R and its contributed packages in a way so when updating R
in t
I am using nonlinear regression to fit a couple of variables to a set of
measurements. I would like to do some significance tests for the estimated
parameters. I am able to check the confidence intervals using the Jacobian
coming out of nonlinear regression.
I do see in a paper which shows t-val
Any opinions on the list about these courses?
Are they addressed to business analysts who are whizzes at Excel?
To programmers?
To statisticians?
To mathematicians?
Has anyone on the list attended them?
Did they find them more useful than working through a book or some online
resource?
Milton Huang wrote:
> Thank you both for such beautiful solutions. Just what I was looking for! I
> love the Internet, R, and the R-list! There is so much opportunity to learn.
>
> In fact, looking at the replace function, I see the two solutions are the
> same:
>
>
>> replace
>>
>
would you make this reproducible, please. Think cut and paste out of
email into R.
?dput
my guess would be the breaks argument
On Wed, Dec 24, 2008 at 12:31 PM, Felipe Carrillo
wrote:
> Hi: I need some help.
> I am ploting a bar graph but I can't adjust my x axis scale
> I use this code:
>
Check out:
https://stat.ethz.ch/pipermail/r-help/2008-October/176486.html
On Wed, Dec 24, 2008 at 3:04 AM, norman Maiwashe wrote:
> ** High Priority **
>
> I have recently installed the R program in Windows Vista. However, I am
> experiencing problem installing some of the packages. Specificall
Ravi, thank you for the explanation - that makes perfect sense, and it
wouldn't have occurred to me to suspect a negative parameter based on the
error. Using the elaborated syntax from the help page yields a lovely fit.
Regards,
Jason
On Wed, Dec 24, 2008 at 10:57 AM, Ravi Varadhan wrote:
> H
since 'glm' is an object, just type its name at the command prompt:
> glm
function (formula, family = gaussian, data, weights, subset,
na.action, start = NULL, etastart, mustart, offset, control =
glm.control(...),
model = TRUE, method = "glm.fit", x = FALSE, y = TRUE, contrasts = NULL,
Dear All,
I would like to plot two quantities using two different scales along the
two vertical y axes.
On top of this, I would like to use two different colors (let us say red
and blue) for the two vertical axes, their labels, their ticks and the
text for each tick.
I paste below a code snip
Hi Antonio,
Sounds like your .RData file might be corrupt. Did you try deleting it
(or renaming it) and starting R again?
The .RData file should be in the directory where you started R.
HTH,
Brian
-Original Message-
From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org
How do you view the code for a built-in R command (i.e., if I want to see
what R is doing when I run a glm() statement)?
Regards,
Stephen
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/
I just installed R 2.8.1 for windows. When I try to start the software I get
the following:
Fatal error: unable to restore saved data in .RData.
Note that on my previous section I tried to read a large dataset and I got a
message stating that no enough memory was avaliable (I don't have the
compl
Hi: I need some help.
I am ploting a bar graph but I can't adjust my x axis scale
I use this code:
i <- qplot(ForkLength,Number,data=FL,geom="bar")
i + geom_bar(colour="blue",fill="grey65") # too crowded
FL_dat <- ggplot(FL,aes(x=ForkLength,y=Number)) +
geom_bar(colour="green",f
Sorry, I meant
`[.gene`
where gene would be your new class.
-s
On Wed, Dec 24, 2008 at 11:00 AM, Stavros Macrakis wrote:
> You might consider using the 'bit' library and use two bits per base. You
> could then wrap this in an object with appropriate functions (bit.`[`,
> etc
The problem is that you are not coding your data the way that I would;
program
authors do not always anticipate what others will do! The Weibull distribution
has support on (0, infinity). Using Surv(t1, t2, type='interval2'), you can
have
a left censored observation where time of even
Since you only have 4 characters, you can can create a table of all
the combinations of 4 of them and this will reduce to one byte instead
of 4. This is fine if you just want to store them.
> x <- expand.grid(c("A","C","G","T"),
+ c("A", "C", "G", "T"),
+ c("A", "C", "G", "T"),
+ c("A
Happy Holidays!
We've updated our courses lists to add New&Emerging Courses for 2009.
--USAR2009 is on April 26-29-
(1) R/S-PLUS Fundamentals and Programming Techniques
http://www.xlsolutions-corp.com/coursedetail.asp?id=30
* San Francisco *
Thank you both for such beautiful solutions. Just what I was looking for! I
love the Internet, R, and the R-list! There is so much opportunity to learn.
In fact, looking at the replace function, I see the two solutions are the
same:
> replace
function (x, list, values)
{
x[list] <- valu
You might consider using the 'bit' library and use two bits per base. You
could then wrap this in an object with appropriate functions (bit.`[`,
etc.).
-s
On Wed, Dec 24, 2008 at 10:26 AM, Gundala Viswanath wrote:
> Dear all,
>
> What's the R way to compress the string into smaller 2
Hi Jason,
The error message indicates that there was problem in estimating the gradient
of objective function. It has nothing to do with your second data point. This
could happen for a variety of reasons, but the most proximate cause of the
problem seems due to a parameter being negative duri
Dear all,
What's the R way to compress the string into smaller 2~3 char/digit length.
In particular I want to compress string of length >=30 characters,
e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC
The reason I want to do that is because, there are billions
of such string I want to print out. And I ne
Dear list members,
I constructed this model:
bao1<-lme(sla~mg, random=~pop/nr.tree, weights=varPower(form=~sla|pop)
variables:
- sla = continuus
- mg = factor
- pop = factor
- nr.tree = factor
So, the variance of sla increases with sla, dependent of the pop.
However, I fitted another (h
On Dec 24, 2008, at 2:35 AM, Gundala Viswanath wrote:
Dear all,
I have the following data frame:
raw.count
Var1
Freq
1 AA 707
2 AC14
3 AAA
> mat[,colSums(mat!=0)>=5]
Jacques VESLOT
CEMAGREF - UR Hydrobiologie
Route de Cézanne - CS 40061
13182 AIX-EN-PROVENCE Cedex 5, France
Tél. + 0033 04 42 66 99 76
fax+ 0033 04 42 66 99 34
email jacques.ves...@cemagref.fr
>-Message d'origine-
>De : r-help-boun...@r-
Hello,
I am hoping for some advice as to how I might create a subset of a
matrix. The matrix is 176 x 3530. The rows are individual records
and the columns words. I want to create a new matrix that only
consists of words which occur in at least 5 records. For example,
if column 7 is "char
Stephen,
when I think about you're problem I'm a little worried as it should be is
very simple.
If you think of a the more straightforward AR(1) model y_t = a0 + b*y_t-1
the intercept is the the value y_t=a0 on the scatterplot of y_t vs. y_t-1.
For your first series labelled "a" for example the s
Ben Bolker wrote:
Khawaja, Aman wrote:
I need to answer one of the question in my open source test is: What are
the four questions asked about the parameters in hypothesis testing?
Please check the posting guide.
* We don't answer homework questions ("open source" doesn't mean
that other p
Wacek Kusnierczyk wrote:
> Milton Huang wrote:
>>
>>
>>> Dear list members:
>>>
>>> I am looking for an elegant (or efficient) way to accomplish the following:
>>>
>>> take a large boolean vector and fill the TRUE values with the values from a
>>> smaller boolean vector that has a length t
I believe the following does what is wanted:
desired <- large
desired[large] <- small
Patrick Burns
patr...@burns-stat.com
+44 (0)20 8525 0696
http://www.burns-stat.com
(home of S Poetry and "A Guide for the Unwilling S User")
Milton Huang wrote:
Dear list members:
I am looking for an elegan
Wacek Kusnierczyk wrote:
> Milton Huang wrote:
>
>> Dear list members:
>>
>> I am looking for an elegant (or efficient) way to accomplish the following:
>>
>> take a large boolean vector and fill the TRUE values with the values from a
>> smaller boolean vector that has a length that is the numb
Milton Huang wrote:
> Dear list members:
>
> I am looking for an elegant (or efficient) way to accomplish the following:
>
> take a large boolean vector and fill the TRUE values with the values from a
> smaller boolean vector that has a length that is the number of TRUE values of
> the large vect
Dear list members:
I am looking for an elegant (or efficient) way to accomplish the following:
take a large boolean vector and fill the TRUE values with the values from a
smaller boolean vector that has a length that is the number of TRUE values of
the large vector.
Example:
large<- c(FALSE,
This is not a problem in R, but with Internet access from your system.
It is an FAQ, see
http://cran.r-project.org/bin/windows/base/rw-FAQ.html#The-Internet-download-functions-fail_002e
Another possibility is to download the file
http://www.stats.ox.ac.uk/pub/RWin/bin/windows/contrib/2.8/BRugs_0.
** High Priority **
I have recently installed the R program in Windows Vista. However, I am
experiencing problem installing some of the packages. Specifically, I wanted to
install BRugs package running R as an administrator. I issued the following
command in R and received the following error m
43 matches
Mail list logo
