ension
To: syed zaidi, tutor
take a look at numpy
and don't necessarily give us the whole code. it becomes too long without
purpose
Abdur-Rahmaan Janhangeer,
Mauritius
abdurrahmaanjanhangeer.wordpress.com<http://abdurrahmaanjanhangeer.wordpress.com>
On 6 Jun 2017 03:26, "syed
hi,
I would appreciate if you can help me suggesting a quick and efficient strategy
for comparing multiple lists with one principal list
I have about 125 lists containing about 100,000 numerical entries in each
my principal list contains about 6 million entries.
I want to compare each small
nny@gmail.com> Date:
3/9/2016 08:39 (GMT+08:00) To: syed zaidi
<syedzaid...@hotmail.co.uk> Cc: Python Tutor Mailing List
<tutor@python.org> Subject: Re: [Tutor] FASTA FILE SUB-SEQUENCE
EXTRACTION
You should probably look into Biopython:
http://biopython.org/wiki/Main_Page
Yo
STA FILE SUB-SEQUENCE EXTRACTION
> From: wolfrage8...@gmail.com
> To: syedzaid...@hotmail.co.uk
>
> What is FASTA? This seems very specific. Do you have any code thus far
> that is failing?
>
> On Tue, Mar 8, 2016 at 2:33 AM, syed zaidi <syedzaid...@hotmail.co.uk> wrote:
&g
Hello all,
I am stuck in a problem, I hope someone can help me out. I have a FASTA file
with multiple sequences and another file with the gene coordinates. SAMPLEFASTA
FILE:
>EBM_revised_C2034_1
Hi,I am trying to develop a python code that takes a character string as input
and finds for the occurrence of letters that are occurring thrice or more
consecutively.For E.g.
a = 'ataattaaacagagtgagcagt'In the output I want a list of those
characters that are occuring thrice or more.
Dear all
Can someone please tell me how to solve the following problem. I have
developed a python code to extract specific information from more than 1000
files which have slightly different format. The problem I am facing is that I
have to develop specific RE for each of the file which is
Thanks for the help
I need the whole line starting from 'D' but in seperate columns.like KO, EC,
Gene ID, Enzyme Name etc
Date: Mon, 16 Apr 2012 00:24:17 +1000
From: st...@pearwood.info
To: tutor@python.org
Subject: Re: [Tutor] Help with regular expression
syed zaidi wrote:
Dear Steve
