Hi: I am writing to see if I could any help. I am trying to find if a mutation in gene falls in a polymer region of DNA. To explain in simplistic terms,
Given a piece of DNA string, with following characters, I know where mutation happens. Happens at T (in quotes with spaces.) 3 As before T and 4 As after T are removed in a disease. Given following sequence, I should be able to find if this T is in a polymer region. such as 'AAA' T 'AAAA. AAATAGCAGAAA 'T' AAAAGAAAAGATTGGAACTAGGTCAG I am not sure if there are any methods in python to find these. Do you think a script has to be written with more logic involving some known algorithms. Please advise. thanks Hs.
_______________________________________________ Tutor maillist - [email protected] To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
