Hi ! Have you considered regular expressions in Python ?
Please take a look at "Regular Expression HOWTO", at http://docs.python.org/howto/regex.html All the best, Hilton On Thu, Jan 19, 2012 at 4:09 PM, Hs Hs <[email protected]> wrote: > Hi: > I am writing to see if I could any help. > I am trying to find if a mutation in gene falls in a polymer region of > DNA. To explain in simplistic terms, > > Given a piece of DNA string, with following characters, I know where > mutation happens. Happens at T (in quotes with spaces.) 3 As before T and > 4 As after T are removed in a disease. > > Given following sequence, I should be able to find if this T is in a > polymer region. such as 'AAA' T 'AAAA. > > AAATAGCAGAAA 'T' AAAAGAAAAGATTGGAACTAGGTCAG > > > > I am not sure if there are any methods in python to find these. Do you > think a script has to be written with more logic involving some known > algorithms. > > Please advise. > > thanks > Hs. > > _______________________________________________ > Tutor maillist - [email protected] > To unsubscribe or change subscription options: > http://mail.python.org/mailman/listinfo/tutor > > -- (11)8131-5213
_______________________________________________ Tutor maillist - [email protected] To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
