On Wed, Jul 18, 2012 at 8:23 PM, Lee Harr <[email protected]> wrote:
>
>> grep ^TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT$> with no results
>
> How about:
> grep TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT outfile
> Just in case there is some non-printing character in there...
There are many instances of that sequence of characters in the RAW
input file, but that is what I would expect.
>
> Beyond that ... my guess would be that you are either not readingthe file you
> think you are, or not writing the file you think you are :o)
> out = each.replace('/gzip', '/rem_clusters2')
> Seems pretty bulletproof, but maybe just print each and out hereto make
> sure...
Checked this multiple times
>
> Also, I'm curious... Reading your code, I sort of feel like when I
> amlistening to a non-native speaker. I always get the urge to throw out
> thecorrect "Americanisms" for people -- to help them fit in better. So, I
> hope itdoes not make me a jerk, but ...
> infile = open(each, 'r') # I'd probably drop the 'r' also...
working in science, I try to be as explicit as possible, I've come to
dislike Perl for this reason.
> while not check_for_end_of_file:
> reads += 1
> head, sep, tail = id_line_1.partition(' ') # or, if I'm only using the one
> thing ..._, _, meaningful_name = id_line_1.partition(' ') # maybe call it
> "selector", then ...
> if selector in ('1:N:0:', '2:N:0:'):
>
Points taken, thanks.
> Hope this helps.
_______________________________________________
Tutor maillist - [email protected]
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
