Dear list and ShortRead maintainers, Since I updated BioC 2.13 yesterday to the latest package versions, I am experiencing errors when trying to build the QuasR vignette.
It seems the error is caused in QuasR::preprocessReads(), which tries to subset a ShortRead::ShortReadQ object with a logical vector. The problem does not seem to be QuasR related and can be reproduced with a minimal example: library(ShortRead) seqFile <- tempfile(fileext=".fq") writeLines(c("@seq1/1","AAAGGCCACACTTTTGAAAAAAGAAAAACAAGAATAAGCCCTGTTGCTCT","+","ggggggggggggggggggfffffffffggggggggggggggggggggggg", "@seq2/1","CTGCCGTAATATTCAGCTCCCTGAGCTGAGCCTTGAGGTCCGAGTTCATC","+","ghgggggggggggggggggfgggfggggggggggggfggggggggggggg", "@seq3/1","GTTCCACATTGTTCTGCTGTGCTTTGTCCAAATGAACCTTTATGAGCCGG","+","gggggggggggggggggggggggggggggggggggggggggggggggggg", "@seq4/1","CGGGAGATTCACCAGGACTGGGCTGACCAGGAGTACATTGAGATAATCAC","+","eggegddceedggggeZcec^]`^`ffffcTTSUTTSSTTfffaf]``]^"), seqFile) fs1 <- FastqStreamer(seqFile) chunks <- yield(fs1) chunks[c(T,F,T,F)] # ERROR chunks[1:2] # ERROR close(fs1) The error message is: Error in validObject(.Object) : invalid class “GroupedIRanges” object: slot "group" slot must have same length as object My environment is: R version 3.0.1 (2013-05-16) Platform: x86_64-apple-darwin10.8.0 (64-bit) locale: [1] C/UTF-8/C/C/C/C attached base packages: [1] parallel stats graphics grDevices utils datasets methods [8] base other attached packages: [1] ShortRead_1.19.10 latticeExtra_0.6-26 RColorBrewer_1.0-5 [4] Rsamtools_1.13.39 lattice_0.20-23 Biostrings_2.29.16 [7] GenomicRanges_1.13.41 XVector_0.1.1 IRanges_1.19.32 [10] BiocGenerics_0.7.5 loaded via a namespace (and not attached): [1] Biobase_2.21.7 bitops_1.0-6 grid_3.0.1 hwriter_1.3 stats4_3.0.1 [6] tools_3.0.1 zlibbioc_1.7.0 Any help would be highly appreciated. Michael _______________________________________________ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel