We are getting hit hard by this in minfi as well, assuming this is fall out
from us using SummarizedExperiment.
Best,
Kasper
On Thu, Sep 12, 2013 at 7:16 AM, Stadler, Michael <michael.stad...@fmi.ch>wrote:
> Dear list and ShortRead maintainers,
>
> Since I updated BioC 2.13 yesterday to the latest package versions, I am
> experiencing errors when trying to build the QuasR vignette.
>
> It seems the error is caused in QuasR::preprocessReads(), which tries to
> subset a ShortRead::ShortReadQ object with a logical vector.
>
> The problem does not seem to be QuasR related and can be reproduced with a
> minimal example:
>
> library(ShortRead)
> seqFile <- tempfile(fileext=".fq")
>
> writeLines(c("@seq1/1","AAAGGCCACACTTTTGAAAAAAGAAAAACAAGAATAAGCCCTGTTGCTCT","+","ggggggggggggggggggfffffffffggggggggggggggggggggggg",
>
>
> "@seq2/1","CTGCCGTAATATTCAGCTCCCTGAGCTGAGCCTTGAGGTCCGAGTTCATC","+","ghgggggggggggggggggfgggfggggggggggggfggggggggggggg",
>
>
> "@seq3/1","GTTCCACATTGTTCTGCTGTGCTTTGTCCAAATGAACCTTTATGAGCCGG","+","gggggggggggggggggggggggggggggggggggggggggggggggggg",
>
>
> "@seq4/1","CGGGAGATTCACCAGGACTGGGCTGACCAGGAGTACATTGAGATAATCAC","+","eggegddceedggggeZcec^]`^`ffffcTTSUTTSSTTfffaf]``]^"),
> seqFile)
> fs1 <- FastqStreamer(seqFile)
> chunks <- yield(fs1)
> chunks[c(T,F,T,F)] # ERROR
> chunks[1:2] # ERROR
> close(fs1)
>
> The error message is:
> Error in validObject(.Object) :
> invalid class “GroupedIRanges” object: slot "group" slot must have same
> length as object
>
> My environment is:
> R version 3.0.1 (2013-05-16)
> Platform: x86_64-apple-darwin10.8.0 (64-bit)
>
> locale:
> [1] C/UTF-8/C/C/C/C
>
> attached base packages:
> [1] parallel stats graphics grDevices utils datasets methods
> [8] base
>
> other attached packages:
> [1] ShortRead_1.19.10 latticeExtra_0.6-26 RColorBrewer_1.0-5
> [4] Rsamtools_1.13.39 lattice_0.20-23 Biostrings_2.29.16
> [7] GenomicRanges_1.13.41 XVector_0.1.1 IRanges_1.19.32
> [10] BiocGenerics_0.7.5
>
> loaded via a namespace (and not attached):
> [1] Biobase_2.21.7 bitops_1.0-6 grid_3.0.1 hwriter_1.3
> stats4_3.0.1
> [6] tools_3.0.1 zlibbioc_1.7.0
>
> Any help would be highly appreciated.
> Michael
>
> _______________________________________________
> Bioc-devel@r-project.org mailing list
> https://stat.ethz.ch/mailman/listinfo/bioc-devel
>
[[alternative HTML version deleted]]
_______________________________________________
Bioc-devel@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/bioc-devel
