Thanks Valerie and Herve for the fast fix - I can confirm that the problem is
gone with the versions below.
Michael
On Sep 12, 2013, at 11:50 AM, Valerie Obenchain <voben...@fhcrc.org>
wrote:
> The 'GroupedIRanges' error is related to some cleanup Herve is doing on the
> subsetting code in IRanges/XVector. The error should be gone with the most
> recent devel versions (IRanges 1.19.33, XVector 0.1.2, GenomicRanges
> 1.13.42). These may take a day to propagate through biocLite().
>
> Valerie
>
>
> On 09/12/2013 08:06 AM, Kasper Daniel Hansen wrote:
>> We are getting hit hard by this in minfi as well, assuming this is fall out
>> from us using SummarizedExperiment.
>>
>> Best,
>> Kasper
>>
>>
>> On Thu, Sep 12, 2013 at 7:16 AM, Stadler, Michael
>> <michael.stad...@fmi.ch>wrote:
>>
>>> Dear list and ShortRead maintainers,
>>>
>>> Since I updated BioC 2.13 yesterday to the latest package versions, I am
>>> experiencing errors when trying to build the QuasR vignette.
>>>
>>> It seems the error is caused in QuasR::preprocessReads(), which tries to
>>> subset a ShortRead::ShortReadQ object with a logical vector.
>>>
>>> The problem does not seem to be QuasR related and can be reproduced with a
>>> minimal example:
>>>
>>> library(ShortRead)
>>> seqFile <- tempfile(fileext=".fq")
>>>
>>> writeLines(c("@seq1/1","AAAGGCCACACTTTTGAAAAAAGAAAAACAAGAATAAGCCCTGTTGCTCT","+","ggggggggggggggggggfffffffffggggggggggggggggggggggg",
>>>
>>>
>>> "@seq2/1","CTGCCGTAATATTCAGCTCCCTGAGCTGAGCCTTGAGGTCCGAGTTCATC","+","ghgggggggggggggggggfgggfggggggggggggfggggggggggggg",
>>>
>>>
>>> "@seq3/1","GTTCCACATTGTTCTGCTGTGCTTTGTCCAAATGAACCTTTATGAGCCGG","+","gggggggggggggggggggggggggggggggggggggggggggggggggg",
>>>
>>>
>>> "@seq4/1","CGGGAGATTCACCAGGACTGGGCTGACCAGGAGTACATTGAGATAATCAC","+","eggegddceedggggeZcec^]`^`ffffcTTSUTTSSTTfffaf]``]^"),
>>> seqFile)
>>> fs1 <- FastqStreamer(seqFile)
>>> chunks <- yield(fs1)
>>> chunks[c(T,F,T,F)] # ERROR
>>> chunks[1:2] # ERROR
>>> close(fs1)
>>>
>>> The error message is:
>>> Error in validObject(.Object) :
>>> invalid class “GroupedIRanges” object: slot "group" slot must have same
>>> length as object
>>>
>>> My environment is:
>>> R version 3.0.1 (2013-05-16)
>>> Platform: x86_64-apple-darwin10.8.0 (64-bit)
>>>
>>> locale:
>>> [1] C/UTF-8/C/C/C/C
>>>
>>> attached base packages:
>>> [1] parallel stats graphics grDevices utils datasets methods
>>> [8] base
>>>
>>> other attached packages:
>>> [1] ShortRead_1.19.10 latticeExtra_0.6-26 RColorBrewer_1.0-5
>>> [4] Rsamtools_1.13.39 lattice_0.20-23 Biostrings_2.29.16
>>> [7] GenomicRanges_1.13.41 XVector_0.1.1 IRanges_1.19.32
>>> [10] BiocGenerics_0.7.5
>>>
>>> loaded via a namespace (and not attached):
>>> [1] Biobase_2.21.7 bitops_1.0-6 grid_3.0.1 hwriter_1.3
>>> stats4_3.0.1
>>> [6] tools_3.0.1 zlibbioc_1.7.0
>>>
>>> Any help would be highly appreciated.
>>> Michael
>>>
>>> _______________________________________________
>>> Bioc-devel@r-project.org mailing list
>>> https://stat.ethz.ch/mailman/listinfo/bioc-devel
>>>
>>
>> [[alternative HTML version deleted]]
>>
>>
>>
>> _______________________________________________
>> Bioc-devel@r-project.org mailing list
>> https://stat.ethz.ch/mailman/listinfo/bioc-devel
>>
>
_______________________________________________
Bioc-devel@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/bioc-devel
