Hello, Could someone point me to a description of defline format for the multiz46way FASTA files? For instance:
>uc010nxq.1_hg19_1_3 38 0 2 chr1:12190-12227+ ATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCA >uc010nxq.1_panTro2_1_3 38 0 2 chr15:100048575-100048624- ATGAGTGAGAGGATCAACTTCTCTGACAGCCTAGGCCA >uc010nxq.1_gorGor1_1_3 38 0 2 What is the meaning of the numbers following (obviously) the knownGene and assembly version id's? Thanks, Ivan _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
