I can't tell why you have a problem with memory.  When I run your
test here I can see the blat process reach a maximum size of just
under 4 Gb as it operates.  Can you indicate what source version
you have or where you picked it up from ?

The procedure you indicate where you operate one chromosome at a time
is actually a more efficient procedure of running through a number
of query sequences.  You can also make it operate much faster with
a pre-computed ooc file.  Use the command:

blat hg19.2bit /dev/null /dev/null -tileSize=11 -makeOoc=hg19.11.ooc 
-repMatch=1024

Then, in each of your per-chromosome mapping operations, use the -ooc flag:

blat hg19.2bit:chr12 -ooc=hg19.11.ooc test.fa test.psl

--Hiram

----- Original Message -----
From: "Jinyan Huang" <[email protected]>
To: "Hiram Clawson" <[email protected]>
Cc: [email protected]
Sent: Monday, June 13, 2011 9:35:50 AM
Subject: Re: [Genome] Blat problem

If I do like this:

blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl

it works. But I really do not like it. I have lots of query.

blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl
Loaded 133851895 letters in 1 sequences
Searched 243 bases in 1 sequences

Thanks.

On Mon, Jun 13, 2011 at 6:33 PM, Jinyan Huang <[email protected]> wrote:
> Here is my test.fa
>
>>probe_set:HuEx-1_0-st-v2:2315101; Assembly=build-34/hg16; Seqname=chr1; 
>>Start=1788; Stop=2030; Strand=+;
> TGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTC
> TTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAG
> GGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGG
> ATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAG
> GCA
>
> On Mon, Jun 13, 2011 at 6:29 PM, Hiram Clawson <[email protected]> wrote:
>> Can you say anything about your query sequence in test.fa ?
>>
>> ----- Original Message -----
>> From: "Jinyan Huang" <[email protected]>
>> To: [email protected]
>> Sent: Monday, June 13, 2011 6:17:18 AM
>> Subject: [Genome] Blat problem
>>
>> Dear list,
>>
>> When I run blat local. I always get this error.
>>
>>>blat ~/bin/blat/hg19.2bit test.fa test.psl
>>
>> Loaded 3137161264 letters in 93 sequences
>> needHugeMen: Out of huge memory - request size 962165992 bytes
>>
>> In fact, my machine have 48G memory. I have set:
>>
>
_______________________________________________
Genome maillist  -  [email protected]
https://lists.soe.ucsc.edu/mailman/listinfo/genome

Reply via email to