Hiram, I only want to output the recode which have more that 90% overlap.
Is it possible to config blat only output IDENTITY>90% and QSIZE==SPAN? If do it chromsome by chromosome, it will let my output times 22. I hope get less output. Thanks. On Mon, Jun 13, 2011 at 7:17 PM, Hiram Clawson <[email protected]> wrote: > > I can't tell why you have a problem with memory. When I run your > test here I can see the blat process reach a maximum size of just > under 4 Gb as it operates. Can you indicate what source version > you have or where you picked it up from ? > > The procedure you indicate where you operate one chromosome at a time > is actually a more efficient procedure of running through a number > of query sequences. You can also make it operate much faster with > a pre-computed ooc file. Use the command: > > blat hg19.2bit /dev/null /dev/null -tileSize=11 -makeOoc=hg19.11.ooc > -repMatch=1024 > > Then, in each of your per-chromosome mapping operations, use the -ooc flag: > > blat hg19.2bit:chr12 -ooc=hg19.11.ooc test.fa test.psl > > --Hiram > > ----- Original Message ----- > From: "Jinyan Huang" <[email protected]> > To: "Hiram Clawson" <[email protected]> > Cc: [email protected] > Sent: Monday, June 13, 2011 9:35:50 AM > Subject: Re: [Genome] Blat problem > > If I do like this: > > blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl > > it works. But I really do not like it. I have lots of query. > > blat ~/bin/blat/hg19.2bit:chr12 test.fa test.psl > Loaded 133851895 letters in 1 sequences > Searched 243 bases in 1 sequences > > Thanks. > > On Mon, Jun 13, 2011 at 6:33 PM, Jinyan Huang <[email protected]> wrote: >> Here is my test.fa >> >>>probe_set:HuEx-1_0-st-v2:2315101; Assembly=build-34/hg16; Seqname=chr1; >>>Start=1788; Stop=2030; Strand=+; >> TGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTC >> TTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAG >> GGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGG >> ATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAG >> GCA >> >> On Mon, Jun 13, 2011 at 6:29 PM, Hiram Clawson <[email protected]> wrote: >>> Can you say anything about your query sequence in test.fa ? >>> >>> ----- Original Message ----- >>> From: "Jinyan Huang" <[email protected]> >>> To: [email protected] >>> Sent: Monday, June 13, 2011 6:17:18 AM >>> Subject: [Genome] Blat problem >>> >>> Dear list, >>> >>> When I run blat local. I always get this error. >>> >>>>blat ~/bin/blat/hg19.2bit test.fa test.psl >>> >>> Loaded 3137161264 letters in 93 sequences >>> needHugeMen: Out of huge memory - request size 962165992 bytes >>> >>> In fact, my machine have 48G memory. I have set: >>> >> > _______________________________________________ Genome maillist - [email protected] https://lists.soe.ucsc.edu/mailman/listinfo/genome
