Tom, Sorry I am talking about the header in the fasta file, ie EBV-MIR-BART13 as In the example below: > EBV-MIR-BART13 TGTAACTTGCCAGGGACGGCTGA Lana
-----Original Message----- From: Thomas W. Blackwell [mailto:[email protected]] Sent: Tuesday, May 27, 2014 10:58 AM To: Lana Schaffer Cc: [email protected] Subject: Re: [Samtools-help] align to fasta DB with names The usual hack is 'samtools view file.bam | cut -f 1 | sort | uniq -c'. If on Windows, you're on your own. - tom blackwell - On Tue, 27 May 2014, Lana Schaffer wrote: > Hi, > I am aligning to fasta DB of sequences and would like to count The > number of reads to each fasta entry by header names. > How do I designate to bowtie to store the names in the SAM File and > then use samtool to count them? > > Lana Schaffer > The Scripps Research Institute > Biostatistics, Informatics > DNA Array Core Facility > 858-784-2263 > ------------------------------------------------------------------------------ The best possible search technologies are now affordable for all companies. Download your FREE open source Enterprise Search Engine today! Our experts will assist you in its installation for $59/mo, no commitment. Test it for FREE on our Cloud platform anytime! http://pubads.g.doubleclick.net/gampad/clk?id=145328191&iu=/4140/ostg.clktrk _______________________________________________ Samtools-help mailing list [email protected] https://lists.sourceforge.net/lists/listinfo/samtools-help
