Tom,
Sorry I am talking about the header in the fasta file, ie EBV-MIR-BART13 as
In the example below:
> EBV-MIR-BART13
TGTAACTTGCCAGGGACGGCTGA
Lana

-----Original Message-----
From: Thomas W. Blackwell [mailto:[email protected]] 
Sent: Tuesday, May 27, 2014 10:58 AM
To: Lana Schaffer
Cc: [email protected]
Subject: Re: [Samtools-help] align to fasta DB with names


The usual hack is 'samtools view file.bam | cut -f 1 | sort | uniq -c'.
If on Windows, you're on your own.

                                                        -  tom blackwell  -

On Tue, 27 May 2014, Lana Schaffer wrote:

> Hi,
> I am aligning to fasta DB of sequences and would like to count The 
> number of reads to each fasta entry by header names.
> How do I designate to bowtie to store the names in the SAM File and 
> then use samtool to count them?
>
> Lana Schaffer
> The Scripps Research Institute
> Biostatistics, Informatics
> DNA Array Core Facility
> 858-784-2263
>

------------------------------------------------------------------------------
The best possible search technologies are now affordable for all companies.
Download your FREE open source Enterprise Search Engine today!
Our experts will assist you in its installation for $59/mo, no commitment.
Test it for FREE on our Cloud platform anytime!
http://pubads.g.doubleclick.net/gampad/clk?id=145328191&iu=/4140/ostg.clktrk
_______________________________________________
Samtools-help mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/samtools-help

Reply via email to