The .fasta header line in the example below appears to have a space
character in between '>' and 'EBV-MIR-BART13'. Most aligners report
the string of characters following '>' up to and not including the
first whitespace character as the query sequence identifier. For
this example, that will be the empty string.
Don't be embarrassed. I got caught by this too, many, many years ago,
and had to have it explained to me. It seems perfectly reasonable that
one could add a space for readability, but that's not what's expected.
- tom blackwell -
On Tue, 27 May 2014, Lana Schaffer wrote:
> Tom,
> Sorry I am talking about the header in the fasta file, ie EBV-MIR-BART13 as
> In the example below:
>> EBV-MIR-BART13
> TGTAACTTGCCAGGGACGGCTGA
> Lana
>
> -----Original Message-----
> From: Thomas W. Blackwell [mailto:[email protected]]
> Sent: Tuesday, May 27, 2014 10:58 AM
> To: Lana Schaffer
> Cc: [email protected]
> Subject: Re: [Samtools-help] align to fasta DB with names
>
>
> The usual hack is 'samtools view file.bam | cut -f 1 | sort | uniq -c'.
> If on Windows, you're on your own.
>
> - tom blackwell -
>
> On Tue, 27 May 2014, Lana Schaffer wrote:
>
>> Hi,
>> I am aligning to fasta DB of sequences and would like to count The
>> number of reads to each fasta entry by header names.
>> How do I designate to bowtie to store the names in the SAM File and
>> then use samtool to count them?
>>
>> Lana Schaffer
>> The Scripps Research Institute
>> Biostatistics, Informatics
>> DNA Array Core Facility
>> 858-784-2263
>>
>
------------------------------------------------------------------------------
The best possible search technologies are now affordable for all companies.
Download your FREE open source Enterprise Search Engine today!
Our experts will assist you in its installation for $59/mo, no commitment.
Test it for FREE on our Cloud platform anytime!
http://pubads.g.doubleclick.net/gampad/clk?id=145328191&iu=/4140/ostg.clktrk
_______________________________________________
Samtools-help mailing list
[email protected]
https://lists.sourceforge.net/lists/listinfo/samtools-help
