Re: [galaxy-user] Make Galaxy continue running when i close the browser

[Björn Grüning]

Hi Efthymios,

it should work as you expected. The server and the processes should run
even if you close the browser. All you need is to keep the server (local
instance ...) running.

Cheers,
Bjoern

> Dear Galaxy users,
> 
> I have installed a local Galaxy instance on a server and I use it to
> run certain genomic assembly workflows. Nevertheless with larger
> datasets completion may take up to one day. How can i make Galaxy to
> continue the operation even when i close the browser? Is that possible
> on a local instance or on the main server?
> 
> Thank you,
> Efthymios Ladoukakis
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] How to do BLAST on Galaxy sever?

[Björn Grüning]

Hi David,

at first you need to predict some genes. In the tool-shed you will find
some gene prediction tools. With these gene you can search against local
BLAST-databases using the NCBI BLAST+ tools, included in Main-Galaxy.

Hope that helps,
Bjoern

> Hi, Everybody,
> 
> I uploaded two complete genome sequences and hope to BLAST homologs
> from both genome.
> 
> Does anybody know how to do BLAST search on galaxy?
> 
> Thanks
> 
> David 
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Question about plotting circos plot

[Björn Grüning]

Hi Shamsher.

We have a small initial wrapper for circos. Its not complete yet and we
are not sure if its even possible to wrap such a complex tool in a good
galaxy UI. But if you are interested i can share our code.

Cheers,
Bjoern

> I wonder if is it possible to visualize mutation data in circular plot
> termed as circos plot e.g
>  @http://www.eurekalert.org/multimedia/pub/31019.php?from=181881
>  
> Any suggestion for an alternative tool will also be appreciated.
>  
>  
> Thanks
>  
> Shamsher
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Trouble with BLAST+ and .loc file

[Björn Grüning]

Hi Makis,

here is my working nr entry:

/media/data/ncbi/blast/db/unpacked_nt/ntncbi_nt/media/data/databases/ncbi/blast/db/unpacked_nt/nt

i was not able to see if your tabs are correct. So maybe its just a
wrongly formatted loc file.

Cheers,
Bjoern

P.S. You can download preformatted blast-databases directly from
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/blastdb.html



> Dear Galaxy users,
> 
> I have been trying to upload a blastable database in my local instance
> of galaxy. I have used the nr database and generated all the nhr, nin,
> nsq, and nal files. I have also edited the blastdb.loc file in the
> galaxy-dist/tool-data/ directory and it looks like this:
> 
> database  [build data]  path
> nr_01_Mar_2012  nr 15 Mar 2012  /home/user/Desktop/nr.00/nr
> 
> 
> Nevertheless when i start galaxy the megablast tool can't recognise
> the database. Am I missing something?
> 
> Thank you in advance
> Makis Ladoukakis
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Include a data folder into Galaxy

[Björn Grüning]

Hi Norbert,

please have a look at the FTP-Upload feature from galaxy.
The idea is that every user gets an FTP folder in which he can upload
data. If you create such a directory you can probably link your data in
such directories and galaxy will offer them to the users in the upload
tool.

Hope that helps.
Cheers,
Bjoern

> Hello,
> 
> hopefully this is a simple question: How can I include a folder into the 
> Galaxy server?
> 
> The backgroud is, that I installed Galaxy on one of out server, which 
> has access to the data folders used everywhere at our institute.  So, 
> instead of uploading and copying serveral big files (and waisting space 
> on servers) I want to make a link to the appropiate folder, so it can be 
> used like as the data has been uploaded.  I hope I explained enough 
> details...  The question is: is it possible?
> 
> Thanks for help, Norbert
> 


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] galaaxy history size (gb)

[Björn Grüning]

Hi Irene,


> Hi, 
> I deleted  several jobs from my history (and purged history as well), however 
> the used space on history hasn't changed.
> What is the limit of Gb that can e stored?Can this be updated when files are 
> deleted permanently

Have a look @ 

allow_user_dataset_purge = False

in universe_wsgi.ini.sample

Also, please find find more information about removing datasets from
galaxy under:

http://wiki.g2.bx.psu.edu/Admin/Config/Performance/Purge%20Histories%
20and%20Datasets

Cheers,
Bjoern 


> Thanks, 
> ib
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] extract genome sequence

[Björn Grüning]

Hi Yan,

did you know the tool extractfeat from the EMBOSS suite (its in the
toolshed)?

I don't know offhand if it can work in batch mode, but its possible to
add that feature.

Cheers,
Bjoern

> Hi everyone,

> I have the genome sequence and gene annotation file. Is there a tool
> on Galaxy to extract the 5,000 bp upstream, 5,000 bp downstream and
> genome sequences of the genes (including exons and introns) from the
> genome sequence? Any suggestions are highly appreciated! Thanks!
> 
>  
> 
> Yan
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Trim Galore Galaxy Integration

[Björn Grüning]

Hi Sachit!

> Hello. I would like to integrate this great tool "Trim Galore" in the
> local Galaxy. Has anyone did this before? If so, please provide me
> with the wrapper and  .xml file? How can I integrate it?

I have a beta version of it, also a working Bismark (from the same
group) wrapper. I will finish it and get back to you.

Thanks,
Bjoern


> Best wishes,
> Sachit
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] How to do an GO enrichment analysis in Galaxy?

[Björn Grüning]

Hi Yan,

have a look at the blast2GO wrapper in the toolshed. If you already have
gene-ids you can download the GO in an appropriate format and intersect
with your ids.

Hope that works,
Bjoern

> Hi everyone,
> 
>  
> 
> I got a list of differentially expressed genes from my RNA-seq data.
> Is there a tool on Galaxy that I can do the GO enrichment analysis for
> the differentially expressed genes? Any help or suggestion is highly
> appreciated!
> 
>  
> 
> Best regards,
> 
> Yan
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Are tools must be installed in local machine?

[Björn Grüning]

Hi Sachit,

you need to install such tools by yourself, unless you are using some
new tools from the toolshed. For example the ncbi-tools or BWA from the
toolshed are capable of installing all dependency automatically.
In the future the plan is to move all heavy tools to the toolshed with
automatic dependency and version handling, afaik.

Regards,
Bjoern

> Hello. The tools like Tophat, Bowtie etc are pre-installed in Galaxy.
> Are those tools must be installed in order to work in Galaxy. For
> example: I am using Debian machine(Don't have tophat and bowtie
> installed). Will tophat and bowtie work in my local galaxy? Thanks  
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

[galaxy-user] genome-wide Bisulfite analyses ... was Re: Infinite TopHat run

[Björn Grüning]

Hi David,

please do not hijack a different thread :)
If you are analysing Bisulfite data i would recommend to have a look at
http://www.bioinformatics.babraham.ac.uk/projects/ ... especially at
bismark.

We have written a wrapper for bismark, its still in testing phase but if
you like to try it out, you are welcome.

Cheers,
Bjoern

> Hi, there, 
> 
> I just got two genome-wide Bisulfite sequences from BGI and start to
> analyze the data. 
> 
> I am trying to use Galaxy; but I find there is no such platform 
> available. Does anybody know where I can find this kind platform at 
> Galaxy or other places.
> 
> Thanks
> 
> David 
> 

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] genome-wide Bisulfite analyses ... was Re: Infinite TopHat run

[Björn Grüning]

Hi Kanwar,

> I interested in trying Bismark under Galaxy. Could you please point me
> where I can use it.

please have a look at the pull request ...
https://bitbucket.org/galaxy/galaxy-central/pull-request/73/bismark-wrapper-issue-626

Cheers,
bjoern

> 
> Thanks
> Kanwar 
> 
> On Mon, Oct 8, 2012 at 8:08 AM, Björn Grüning
>  wrote:
> Hi David,
> 
> please do not hijack a different thread :)
> If you are analysing Bisulfite data i would recommend to have
> a look at
> http://www.bioinformatics.babraham.ac.uk/projects/ ...
> especially at
> bismark.
> 
> We have written a wrapper for bismark, its still in testing
> phase but if
> you like to try it out, you are welcome.
> 
> Cheers,
> Bjoern
> 
> > Hi, there,
> >
> > I just got two genome-wide Bisulfite sequences from BGI and
> start to
> > analyze the data.
> >
> > I am trying to use Galaxy; but I find there is no such
> platform
> > available. Does anybody know where I can find this kind
> platform at
> > Galaxy or other places.
> >
> > Thanks
> >
> > David
> >
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> 


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Do I need to have tool or dependencies installed in the server to run Galaxy tools?

[Björn Grüning]

Hi Sachit,

the bismark wrapper is not finished, that's the reason its only in the
test-toolshed. When its finished you do not neet bismark to be
installed, but bowtie.

Cheers,
Bjoern

> I integrated Bismark in Galaxy in my server. I downloaded Bismark from
> Galaxy Tool shed. I just copied the Bismark into /tools directory and
> added some codes in tool_conf.xml to make it visible. Do I need to
> install the real Bismark application in the server too? I am really
> confused here. Thanks 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Annotation tool for prokaryotic genome

[Björn Grüning]

Hi Bernardo,

> Hello Galaxy community,
> 
> 
> I would like to know if there is any available tool in Galaxy for
> automated gene annotation. I need gene annotation in GTF or GFF3
> format to run CuffDiff on a RNA-Seq project that we are.

We have a tool, that annotates your prokaryotic genome, through
similarity searches and creates a genbank file afterwards ... Is that
what you are searching for?

> If not, do you recommend me any software or utility. We have the
> genome annotated in GenBank format, but searching in the web I've seen
> that is not possible to convert GenBank format to GTF or GFF3.

I think its possible. I have a 'GenBank / embl converter to GFF' and
vice versa converter here. I will try to pack it and send it tomorrow
when im back at work.

Cheers,
Bjoern

> 
> I appreciate your opinions. 
> Thank you, Bernardo
> 
> 
> -- 
> 
> 
> Bernardo Bello Ortí
> 
> Becario predoctoral FPI 
> 
> CReSA-IRTA
> 
> Campus de Bellaterra-Universitat Autònoma de Barcelona
> 
> Edifici CReSA
> 
> 08193  Bellaterra (Barcelona)
> 
> Tel.: 647 42 52 63 www.cresa.es  
> 
> 
> 
> 
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Batch jobs...

[Björn Grüning]

Hi Neil,

if you run your workflow, there is small little symbol/icon (looks like
papers). If you click these ... you can select multiple input files at
once. Also you can probably use the Galaxy API for your task [1].

Happy research!
Bjoern

[1] http://wiki.g2.bx.psu.edu/Learn/API

> Hi,
>I've created a workflow that works well. The workflow accepts 2 input 
> files. After uploading all my input files (there is a lot). How can I batch 
> the process, because I don't want to select files manually and run each job 
> manually. Is there a way to batch this action?
> 
> Thanks
> Neil
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Getting error in Bismark

[Björn Grüning]

Hi Sachit,

bismark is not yet in any official toolshed. It is in the test-toolshed
and there are reasons for it :)
Try to apply that patch and it should work:

https://bitbucket.org/BjoernGruening/galaxy-central-bismark/changeset/446c309fe6d346362ad0bcc29a216121553dd361

Cheers,
Bjoern

> I am getting this error at the top while opening Bismark Mapper:
> Data table named 'bismark_bs_indeces' is required by tool but not
> configured.
> 
> 
> 
> I got Bismark from official toolshed. 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] does Galaxy have a tool for converting .sra files to fastq files?

[Björn Grüning]

Hi,

you can try to import your SRA directly as fastq files. Paste that URL
in the upload tool and modify the  number.

http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?cmd=dload&run_list=SRRXX&format=fastq

Hope that helps,
Bjoern

> Hello,  I would like to download some GEO files that complement my own
> research with zebrafish embryos but apparently GEO is now only
> providing .sra flles.
> 
> For a not very experienced unix person, does Galaxy have a tool for
> this or is there a clear description somewhere else of how to do it
> for someone who is not a bioinformaticist?
> 
> Thanks,
> 
> el linney
> Duke University Medical Center
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/

-- 
Björn Grüning
Albert-Ludwigs-Universität Freiburg
Institute of Pharmaceutical Sciences
Pharmaceutical Bioinformatics
Hermann-Herder-Strasse 9
D-79104 Freiburg i. Br.

Tel.:  +49 761 203-4872
Fax.:  +49 761 203-97769
E-Mail: bjoern.gruen...@pharmazie.uni-freiburg.de
Web: http://www.pharmaceutical-bioinformatics.org/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

Re: [galaxy-user] Error / Nebula and RepeatMasker

[Björn Grüning]

Hi Sarah,

i looks like something is wrong with the PBS system.
The errors for bedtools and repeatmasker are the same. I can't
understand french but i guess that ";" are not supported by PBS or in
your configuration? Repeatmasker and bedtools creating more than one
shell command and concatenating them with ';'.

Hope that helps,
Bjoern

> Hello,
> 
> I've installed NEBULA tools and "RepeatMasker" tool on our local
> Galaxy instance.
> 
> For some tools (others work), I get the following errors:
> - Here is the error I get when running the tool FilterControl 
> *** glibc detected *** java: double free or corruption (!prev): 
> 0x7fe56800ecd0 ***
> *** glibc detected *** java: double free or corruption (!prev): 
> 0x7fe56800ecd0 ***
> *** glibc detected *** java: double free or corruption (!prev): 
> 0x7fe56800ecd0 ***
> *** glibc detected *** java: double free or corruption (!prev): 
> 0x7fe56800ecd0 ***
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/FilterControlPeaks/FilterControlPeaks.sh:
>  line 80: 61310 Abandon java -classpath $LOCAL_PATH/ -Xmx6g 
> FilterPeaks -f $inputfile -c $controlfile -t $minHeight -v $minRatio -o 
> $output > /dev/null
> *** glibc detected *** java: double free or corruption (!prev): 
> 0x7f1f5800ecd0 ***
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/FilterControlPeaks/FilterControlPeaks.sh:
>  line 81: 61351 Abandon  
> 
> - Here is the error I get when running the tool IntersectBed 
> 
> /work/galaxy/database/pbs/galaxy_4129.sh: line 13: Erreur de syntaxe
> près du symbole inattendu « ;; »
> /work/galaxy/database/pbs/galaxy_4129.sh: line 13: `bedtools intersect
> -f 0.05
> 
> - Here is the error I get when running the tool ChIPmunk (thanks Alban
> for you help (ChIPMunk v2 is used and all librairies are found) but
> here is a new error, maybe a problem of "dirname" ?)
> 
> mv: impossible d'évaluer
> « 
> /work/galaxy/database/job_working_directory/004/4132/galaxy_dataset_5992.dat_0.xml.png
>  »: Aucun fichier ou dossier de ce type
> mv: impossible d'évaluer « /work/gala
> 
> 
> - Here is the error I get when running the tool PeaksToBed 
> readline() on closed filehandle FILE at
>   
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/Peak2Bed/peak2bed.pl 
> line 124 (#1)
> (W closed) The filehandle you're reading from got itself closed sometime
> before now.  Check your control flow.
> 
> Use of uninitialized value $fields[1] in concatenation (.) or string at
>   
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/Peak2Bed/peak2bed.pl 
> line 154,  line 1 (#2)
> (W uninitialized) An undefined value was used as if it were already
> defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
> To suppress this warning assign a defined value to your variables.
> 
> To help you figure out what was undefined, perl will try to tell you the
> name of the variable (if any) that was undefined. In some cases it cannot
> do this, so it also tells you what operation you used the undefined value
> in.  Note, however, that perl optimizes your program and the operation
> displayed in the warning may not necessarily appear literally in your
> program.  For example, "that $foo" is usually optimized into "that "
> . $foo, and the warning will refer to the concatenation (.) operator,
> even though there is no . in your program.
> 
> Use of uninitialized value in concatenation (.) or string at
>   
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/Peak2Bed/peak2bed.pl 
> line 154,  line 1 (#2)
> Use of uninitialized value in numeric ge (>=) at
>   
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/Peak2Bed/peak2bed.pl 
> line 156,  line 1 (#2)
> ..
>   
> /usr/local/bioinfo/src/galaxy/galaxy-dist/tools/Nebula/Peak2Bed/peak2bed.pl 
> line 156,  line 63 (#2)
> 
> Use of uninitialized value $fields[1] in conc
> 
> 
> I dowloaded tool "RepeatMasker" from Galaxy Tool Shed,and RepeatMasker
> is installed on our cluster.
> Here is the error I get when running the tool RepeatMasker:
> 
> An error occurred running this job: Epilog : job finished at jeu.
> janv. 31 14:39:16 CET 2013
> /work/galaxy/database/pbs/galaxy_4134.sh: line 13: Erreur de syntaxe
> près du symbole inattendu « ;; »
> /work/galaxy/database/pbs/galaxy_4134.sh: line 13: `RepeatMasker
> -parallel 8 -speci
> 
> 
> Do you have any ideas ?
> Thank you in advance for your help,
> Sarah Maman 
> -- 
>   --*--
> Sarah Maman
> INRA - LGC - SI

Re: [galaxy-user] raw count of genes

[Björn Grüning]

Hi Els,

try the tool 'Group data by a column and perform aggregate operation on
other columns.' And choose 'count' or 'count distinct.

Hope that will work.
Happy research!
Bjoern

> Dear all,
> 
>  
> 
> I am a Phd student working on chicken genomics, with limited
> experience in the bio-informatics field. I performed an RNA-Seq
> experiment with single end 50 bp reads to find differential gene
> expressions between different groups. I have mapped this data with
> Tophat. Does anyone know how I can get the raw data count out of
> galaxy in a tab-delimited file? I would like to perform a statistical
> analysis in other software, without the RPKM normalization that
> cufflinks offers.  Thank you very much.
> 
>  
> 
> Have a nice day.
> 
>  
> 
> Yours Sincerely, Els 
> 
>  
> 
> ---
> 
> Ir. Els Willems
> 
> KU Leuven
> 
> Department of Biosystems
> 
> Division Livestock - Nutrition - Quality
> 
> Laboratory of Livestock Physiology
> 
> Kasteelpark Arenberg 30 bus 2456
> 
> B - 3001 Heverlee
> 
> T (+32) 016 32 17 29
> 
> F (+32) 016 32 19 94
> 
>  
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem uploading txt data

[Björn Grüning]

Hi Chunyu,

can you provide us with a small, reproducible example?

Thanks,
Björn

> Actually, the file is all tab-delimited, from beginning to end.
> It has no problem uploading larger data. Seems to be bug somewhere?
> Chunyu
> 
> 
> On Mon, May 13, 2013 at 12:45 PM, James Taylor 
> wrote:
> Are the first four lines of your file deliberately whitespace?
> This
> will definitely cause problems for file type detection (it is
> not a
> valid TSV file as is).
> 
> --
> James Taylor, Assistant Professor, Biology/CS, Emory
> University
> 
> 
> On Sun, May 12, 2013 at 10:52 AM, Chunyu Liu
>  wrote:
> > hi,
> > I had an odd problem today, seems not a problem before:
> > I am trying to upload a simple tab-delimited text file into
> galaxy,
> > but it kept telling me:
> > empty
> > format: txt, database: hg19
> > The uploaded binary file contains inappropriate content
> >
> > Also, showed filesize as 0 bytes.
> >
> > I tried Unix format, DOS format. It is a very small data,
> only 348 bytes.
> > 4 rows, as attached.
> >
> > What is WRONG?
> >
> > Thanks!
> >
> > Chunyu
> >
> > ___
> > The Galaxy User list should be used for the discussion of
> > Galaxy analysis and other features on the public server
> > at usegalaxy.org.  Please keep all replies on the list by
> > using "reply all" in your mail client.  For discussion of
> > local Galaxy instances and the Galaxy source code, please
> > use the Galaxy Development list:
> >
> >   http://lists.bx.psu.edu/listinfo/galaxy-dev
> >
> > To manage your subscriptions to this and other Galaxy lists,
> > please use the interface at:
> >
> >   http://lists.bx.psu.edu/
> >
> > To search Galaxy mailing lists use the unified search at:
> >
> >   http://galaxyproject.org/search/mailinglists/
> 
> 
> 
> 
> -- 
> Chunyu Liu, Ph.D.
> Associate Professor
> Department of Psychiatry
> University of Illinois at Chicago
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] How do I add Ray to Galaxy Central in the tool shed ?

[Björn Grüning]

Am Donnerstag, den 06.06.2013, 14:42 -0400 schrieb Sébastien Boisvert:
> On 06/06/13 02:32 PM, James Taylor wrote:
> >> I want to add Ray (a scalable de novo assembler for genomes and 
> >> metagenomes)
> >> to Galaxy.
> >
> > And I really want you to do this!
> 
> So we are at least two !

Joining the party! Make three out of it!

> >
> >> I will also have to write a wrapper for Ray to prepare the command line 
> >> from
> >> the options provided by the
> >> Galaxy API.
> >>
> >>
> >> But where is stored the executable (in my case, where is sdtored Ray) ?
> >>
> >> Does Galaxy include the specs to build all the tools available in
> >> Galaxy-Central ?
> >
> > No, we are gradually moving all the tools out of galaxy-central into
> > the Tool Shed. You probably want to look at this page:
> >
> >
> > http://wiki.galaxyproject.org/ToolShedToolFeatures#Automatic_third-party_tool_dependency_installation_and_compilation_with_installed_repositories
> >
> > Which describes how you can add a recipe to the toolshed that will
> > install the Ray binaries.
> >
> 
> So Ray needs a C++ 1998 compiler and a MPI library (let's say g++ and 
> openmpi-bin). Are those already installed in Galaxy deployments ?

You can assume that gcc is installed. Nevertheless, openmpi-bin needs to
be installed. I would suggest to create a orphan-tool-dependency for
openmpi-bin.  For example have a look at:
http://testtoolshed.g2.bx.psu.edu/view/bgruening/package_boost_1_53

And than make that orphan-tool-dep a requirement of your repository.

> Also, when is tool_dependencies.xml processed (I assume it is procesed when 
> re-loading the content of the shed into Galaxy ?

I don't understand the question, but if you install Ray the
tool_dependency file is read and at that time it will be installed and
the openmpi dependency.

Cheers,
Björn

> Thanks !
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] How do I add Ray to Galaxy Central in the tool shed ?

[Björn Grüning]

Am Donnerstag, den 06.06.2013, 15:19 -0400 schrieb Sébastien Boisvert:
> On 06/06/13 02:58 PM, Björn Grüning wrote:
> > Am Donnerstag, den 06.06.2013, 14:42 -0400 schrieb Sébastien Boisvert:
> >> On 06/06/13 02:32 PM, James Taylor wrote:
> >>>> I want to add Ray (a scalable de novo assembler for genomes and 
> >>>> metagenomes)
> >>>> to Galaxy.
> >>>
> >>> And I really want you to do this!
> >>
> >> So we are at least two !
> >
> > Joining the party! Make three out of it!
> >
> >>>
> >>>> I will also have to write a wrapper for Ray to prepare the command line 
> >>>> from
> >>>> the options provided by the
> >>>> Galaxy API.
> >>>>
> >>>>
> >>>> But where is stored the executable (in my case, where is sdtored Ray) ?
> >>>>
> >>>> Does Galaxy include the specs to build all the tools available in
> >>>> Galaxy-Central ?
> >>>
> >>> No, we are gradually moving all the tools out of galaxy-central into
> >>> the Tool Shed. You probably want to look at this page:
> >>>
> >>> 
> >>> http://wiki.galaxyproject.org/ToolShedToolFeatures#Automatic_third-party_tool_dependency_installation_and_compilation_with_installed_repositories
> >>>
> >>> Which describes how you can add a recipe to the toolshed that will
> >>> install the Ray binaries.
> >>>
> >>
> >> So Ray needs a C++ 1998 compiler and a MPI library (let's say g++ and 
> >> openmpi-bin). Are those already installed in Galaxy deployments ?
> >
> > You can assume that gcc is installed. Nevertheless, openmpi-bin needs to
> > be installed. I would suggest to create a orphan-tool-dependency for
> > openmpi-bin.  For example have a look at:
> > http://testtoolshed.g2.bx.psu.edu/view/bgruening/package_boost_1_53
> >
> > And than make that orphan-tool-dep a requirement of your repository.
> >
> >> Also, when is tool_dependencies.xml processed (I assume it is procesed 
> >> when re-loading the content of the shed into Galaxy ?
> >
> > I don't understand the question,
> 
> On some platforms (like DNANexus), when you launch an app, it launches an 
> instance from an
> image (let's say Debian). Then, the system install the software (let's say 
> MUMmer) on the instance,
> fetch the data (from S3 or Azure or something else), launch the software 
> (let's say MUMmer).
> When the software completes, the results are pushed by to cloud storage, and 
> the instance is killed.
> So in this kind of platform, the installation occurs independently for each 
> job you launch.
> 
> I don't know if Galaxy works like that -- that was my question (I am reading 
> the 3 important Galaxy papers
> today !).
> 
> >  but if you install Ray the
> > tool_dependency file is read and at that time it will be installed and
> > the openmpi dependency.
> >
> 
> So the question becomes "When Ray get installed ?" Answers may include:
> 
> A) Ray is installed once by a sysadmin.

I think that is the best answer. Replace sysadmin with galaxy-admin.
Because Ray will be installed by him. If you have different Ray versions
that will be handled by the toolshed to enable reproducibility.

> B) Ray is installed automatically by Galaxy when it starts if Ray is not 
> already installed.
> C) Ray is installed each time someone uses it because an instance is spawned.
> D) Ray is not installed because it ships with the operating system, just like 
> ls, pwd and so on.

Possible, but you loose reproducibility, but maybe a good starting point
to write the wrapper, the installation instruction can be hooked up
later.

> E) the Galaxy user needs to upload a static Ray executable just like he/she 
> uploads their data.

> > Cheers,
> > Björn
> 
> -Sébastien.
> 
> >
> >> Thanks !
> >> ___
> >> The Galaxy User list should be used for the discussion of
> >> Galaxy analysis and other features on the public server
> >> at usegalaxy.org.  Please keep all replies on the list by
> >> using "reply all" in your mail client.  For discussion of
> >> local Galaxy instances and the Galaxy source code, please
> >> use the Galaxy Development list:
> >>
> >>http://lists.bx.psu.edu/listinfo/galaxy-dev
> >>
> >> To manage your subscriptions to this and other Galaxy lists,
> >> plea

Re: [galaxy-user] Regarding galaxy wrappers: "lumi", "DESeq" "edgeR"

[Björn Grüning]

Hi Sachit,

we are working currently on a DESeq2 wrapper. Not yet finised sorry.
There is also a edgeR Test repository from Ross Lazarus under:

http://testtoolshed.g2.bx.psu.edu/view/fubar/edger_test

Work is in progress, help is welcome!
Ciao,
Bjoenr

> Hi,
> 
> 
> These are the R libraries. Have anyone written a wrapper for these
> libraries "lumi", "DESeq" "edgeR"? 
> 
> 
> Thanks,
> 
> 
> Sachit
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Galaxy error

[Björn Grüning]

Hi Toni,

to convert a bed file to a fasta file you need the genomic sequence. You
can specify a genome-build for every bed file in your history. You
probably don't have a genome build specified or its specified as
sacCer2. sacCer2 is not configured I would guess, so no genome is
available. Try to install a genome for your organism and set the bed
file to this genome-build.

Cheers,
Bjoern

> Hello,
> 
> I'm trying to convert a .bed file to a FASTA file. I get the following
> error when I do. 
> 
> "An error occurred with this dataset: No sequences are available for
> 'sacCer2', request them by reporting this error."
> 
> 
> I'm not sure what the issue is?
> 
> Thanks,
> Toni
> 
> -- 
> Toni Marie Delorey
> Regev Lab, 6175-OO
> The Broad Institute of MIT and Harvard
> 7 Cambridge Center
> Cambridge, MA 02141
> Email: delo...@broadinstitute.org
> Phone: 617-714-8225
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Fwd: About empty no peek problem

[Björn Grüning]

Hi Xiao,

can you show us the complete wrapper XML script?

Thanks,
Bjoern

> 
> 
> -- Forwarded message --
> From: XiaoTao Jiang 
> Date: 2013/9/2
> Subject: About empty no peek problem
> To: galaxy-user-requ...@lists.bx.psu.edu
> 
> 
> Dear all
> 
> 
> Today I embed one of my R script into local galaxy, I have encountered
> a strange problem.  The script can successfully in local. However,
> when I run it online in galaxy, the output file is empty and in
> history panel, it display empty and no peek.
> 
> 
> I searched the mailing list, but still can not find solutions to solve
> it.
> 
> 
> The command display in sever is : key part 
> 
> 
> galaxy.jobs.runners.local DEBUG 2013-09-02 17:29:49,297 executing: R
> CMD BATCH --slave
> "--args 
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat
>  
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat"
>  barchart.r
> galaxy.jobs.runners.local DEBUG 2013-09-02 17:29:49,493 execution
> finished: R CMD BATCH --slave
> "--args 
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat
>  
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat"
>  barchart.r
> galaxy.jobs DEBUG 2013-09-02 17:29:49,538 Tool did not define exit
> code or stdio handling; checking stderr for success
> galaxy.tools DEBUG 2013-09-02 17:29:49,697 Error opening galaxy.json
> file: [Errno 2] No such file or directory:
> '/Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/job_working_directory/000/71/galaxy.json'
> galaxy.jobs DEBUG 2013-09-02 17:29:49,759 job 71 ended
> 
> 
> I check the generated output file
>  
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat
> 
> 
> It is empty zero in size
> 
> 
> and then I run the command in local command
> 
> 
> R CMD BATCH --slave
> "--args 
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_44.dat
>  
> /Users/jiangxiaotao/Programe/galaxy-galaxy-dist-a4113cc1cb5e/database/files/000/dataset_64.dat"
>  barchart.r
> 
> 
> 
> The output is correct.
> 
> 
> 
> 
> Any suggestions will be appreciated !!
> 
> 
> Xiaotao JIANG 
> Regards,
> The University of HongKong
> Department of Civil Engineering
> 
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] RNA-DNA converter in Fasta format

[Björn Grüning]

Hi Thanh,

under "FASTA manipulation" I have one tool das is called "RNA/DNA
converter". If it is not available in your instance you need to install
the FASTX-toolkit wrappers. These are available in the Tool Shed.

Hope that helps,
Bjoern 


> Hi all,
> I want to to map my sequencing reads to miRNA reference database .
> Anyone know how to convert RNA to DNA in FASTA format ( U to T) .
> Thanks
> Thanh
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] problem running Augustus

[Björn Grüning]

Hi Claudio,

did you installed Augustus with the ToolShed?
The env variable $AUGUSTUS_SCRIPT_PATH need to be set and point to the
augustus wrapper folder containing the extract_features.py script.

Hope that helps!
Bjoern

> Hello,
> 
> 
> I am trying to use the genome Annotation tool Augustus on my locally
> installed copy of Galaxy. After loading the data file, all analyses
> stop and deliver the following:
> 
> 
> error
> an error occurred with this dataset: /bin/sh:1:augustus: not found
> python: can't open file: '/extract_features.py': [Errno 2] No such
> file or directory
> 
> 
> Python is installed on my system (Ubuntu 12.04, Python 2.7.3)
> 
> 
> It must be something very basic I'm missing, but more basic are my
> linux skills…
> 
> 
> Thanks a lot
> 
> 
> Claudio
> 
> 
> 
> ~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^
> Claudio Slamovits,
> Canadian Institute for Advanced Research
> Department of Biochemistry and Molecular Biology
> Dalhousie University
> 5850 College Street, Halifax, Nova Scotia
> B3H 4R2, Canada
> 
> Lab Webpage: http://slamo.biochem.dal.ca
> Lab: (902) 494 7894
> Office: (902) 494 8825
> Fax: (902) 494 1355
> ^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~^~
> 
> 
> "Reality is what it is, not what you want it to be." 
> - Frank Zappa 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Trackster Error: needLargeMem: trying to allocate 0 bytes (limit: 100000000000)

[Björn Grüning]

Hi Simon,

I had that error before, not with trackster ... somewhere else. I think
it's an error of one of these UCSC tools and it occurs if you supply
empty files. Can you check that none of your file is empty? Or your file
will be automatically converted during trackster visualisation and that
is resulting in an empty file. 

Just a guess ...
Cheers,
Bjoern


> I'm having problems getting Trackster working on my own Galaxy
> instance, so I thought I would check on the usegalaxy public server.
> 
> However, I'm getting the same Trackster Error: needLargeMem: trying to
> allocate 0 bytes (limit: 1000) that was reported on this list
> in July, but there was no followup:
> http://user.list.galaxyproject.org/Trackster-Error-td4655737.html
> 
> My history is at https://usegalaxy.org/u/simon-guest/h/trackster-error
> 
> This is just an artificial test I made using a fragment of a reference
> genome, but I thought it should work OK.
> 
> Any clues?
> 
> cheers,
> Simon
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Blast on Galaxy?

[Björn Grüning]

Hi Jorge,

> My name is J.Braun and I am a new user of galaxy... It is a great tool
> for biologists. I have some questions and I would appreciate you could
> help me.
> 
> 1) can I make a blast in Galaxy?

Yes!

> 2) If so,  can I download blast in galaxy?

Yes!

> 3) If so,  can I set up blast in my galaxy for analysis with only a
> particular species?

Yes!

But you need a local Galaxy instance, or a Galaxy instance where you can
convince the administrator to install the Blast Tools.

To install the Blast tools you can use the Tool Shed:

http://wiki.galaxyproject.org/Tool%20Shed

Here is the repository:
http://toolshed.g2.bx.psu.edu/view/devteam/ncbi_blast_plus

You can put arbitrary blast databases into Galaxy (have a look at the
location files - *.loc), you also can create your own databases with
Galaxy and search against that.

Cheers,
Bjoern

> Thank you very much 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] ChIP-Seq Normalization to total number of reads

[Björn Grüning]

Hi Catheryn,

for ChIP-seq analysis, normalisation and BAM file correlation we use
deeptTools. Here you can read more about it:

https://github.com/fidelram/deepTools

And here is the toolshed repository:
http://toolshed.g2.bx.psu.edu/view/bgruening/deeptools

Cheers,
Bjoern

> Dear Galaxy,
> 
>  
> 
> I am trying to analyze my ChIP-Seq data from Illumina using Galaxy. I
> have 2 datasets that I want to compare after normalizing each of them
> to their respective inputs, and these 2 datasets have very different
> number of reads to start with, is there a way to first normalize each
> dataset to total number of reads in Galaxy?
> 
>  
> 
> Thanks. Your help is very much appreciated.
> 
>  
> 
> Catheryn
> 
> 
> 
>  
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] GATK2 Galaxy wrapper available, testing and help needed

[Björn Grüning]

Hi all,

over the last month we developed a new version of GATK2 wrappers and are
now seeking for testers, users and overall feedback. 
We are currently targeting GATK 2.8. One of the big issues with GATK2 is
the new licence. Because of that we can't install GATK2 with the
wrappers, but we hope we have done it as easy as possible to plugin your
local installed version. Furthermore, we made it easy to disable the
'call home feature' of GATK2 (if you have a GATK keyfile). Read more
about it:

https://github.com/bgruening/galaxytools/blob/master/gatk2/readme.rst

The code is stored here:
https://github.com/bgruening/galaxytools/tree/master/gatk2

The ToolShed wrappers can be found here:
http://toolshed.g2.bx.psu.edu/view/iuc/gatk2

I would like to thank Jim Johnson, Nicola Soranzo, Dan Blankenberg and
the Galaxy Team. If you like the wrappers you know what to do during the
next GCC!

If you have feedback or patches please let us know.
Thanks,
Bjoern 



 

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] re

[Björn Grüning]

Hi Larry,

you can build custom genomes in Galaxy. 
More details in the Galaxy wiki:

https://wiki.galaxyproject.org/Learn/CustomGenomes

Cheers,
Bjoern

> Hi
> 
> 
> I have a question about the use of BedTools in Galaxy. I am trying to
> obtain a graph or table of the number of RNA reads mapped to different
> locations on my custom genome. When I try running "Create a Bedgraph
> of Genome Coverage" it requires selection of the "Genome Build" from a
> dropdown list. Is it possible for the program to utilize a custom
> genome not in this list?
> 
> 
> 
> 
> 
> 
> Larry Simpson
> UCLA
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] special character $ gets converted to X in tool

[Björn Grüning]

Hi Ketan!

it sounds like your input is sanitized. You can disable it for your
whole wrapper or you can write a special sanitizer for your input field:

https://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax#A.3Csanitizer.3E_tag_set

Cheers,
Bjoern

> Hi,
> 
> 
> In a test tool that I am working on, I need to enter text preceded by
> a $ sign to be interpreted as an environment variable by the
> underlying running script. However, it seems that the $ sign gets
> converted to X when it gets passed to the tool executable.
> 
> 
> Is there a way to work around this or should I be doing something else
> to pass environment variables via Galaxy tool UI.
> 
> 
> Thanks,
> Ketan
> 
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] remove versions of tool

[Björn Grüning]

Hi Ketan,

have you installed your tool via the Tool Shed?
If so, than you need to delete the old revision of your tool.

Cheers,
Bjoern

> Hi,
> 
> 
> I renamed my tool name in  but when I restart Galaxy
> server, I see a dropdown in front of the tool title with two versions
> with same value. When I select one it gives current name and when
> selecting other it gives the older name of the tool.
> 
> 
> My intention here was to rename the tool and I did not do anything
> that would tell Galaxy to preserve versions. After looking into the
> past mailing list posts, I tried to :
> 
> 
> 1. Restart Galaxy server.
> 2. Deleted integrated_tool_panel.xml
> 3. cleared my browser cache and cookies
> 
> 
> None of the above worked though. Any suggestions?
> 
> 
> Attached is a snapshot of what I am seeing.
> 
> 
> Best,
> -- 
> Ketan
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

[galaxy-user] NGS Fastq Trimmer error

[Björn Grüning]

Hi Wang,

please check if your fastq file is associated with the correct fastq
format, fastqsanger probably.

Cheers,
Bjoern

> Hi,
> 
> I just notice that NGS FASTQ Trimmer by column can't detect the fastq
> file I loaded. Anyone knows why. thanks a lot.
> 
> 
> 
> On Fri, Jan 24, 2014 at 11:00 AM,
>  wrote:
> Send galaxy-user mailing list submissions to
> galaxy-user@lists.bx.psu.edu
> 
> To subscribe or unsubscribe via the World Wide Web, visit
> http://lists.bx.psu.edu/listinfo/galaxy-user
> or, via email, send a message with subject or body 'help' to
> galaxy-user-requ...@lists.bx.psu.edu
> 
> You can reach the person managing the list at
> galaxy-user-ow...@lists.bx.psu.edu
> 
> When replying, please edit your Subject line so it is more
> specific
> than "Re: Contents of galaxy-user digest..."
> 
> 
> HEY!  This is important!  If you reply to a thread in a
> digest, please
> 1. Change the subject of your response from "Galaxy-user
> Digest Vol ..." to the original subject for the thread.
> 2. Strip out everything else in the digest that is not part of
> the thread you are responding to.
> 
> Why?
> 1. This will keep the subject meaningful.  People will have
> some idea from the subject line if they should read it or not.
> 2. Not doing this greatly increases the number of emails that
> match search queries, but that aren't actually informative.
> 
> Today's Topics:
> 
>1. Re: Creating a Trackster visualisation from a
> reference in
>   your history (Jeremy Goecks)
> 
> 
> --
> 
> Message: 1
> Date: Thu, 23 Jan 2014 15:49:44 -0500
> From: Jeremy Goecks 
> To: graham etherington (TSL)
> 
> Cc: galaxy-user@lists.bx.psu.edu
> Subject: Re: [galaxy-user] Creating a Trackster visualisation
> from a
> reference in your history
> Message-ID:
> 
> Content-Type: text/plain; charset="windows-1252"
> 
> > Is it possible to create a custom build and use it to view a
> SAM file without adding the .len and .2bit files in to the
> Galaxy file system as an administrator?
> 
> Yes, it definitely is.
> 
> > If so, what am I doing wrong?
> 
> 
> This is a Galaxy bug which has been fixed in this commit:
> 
> 
> https://bitbucket.org/galaxy/galaxy-central/commits/117fef56513fc563dd231516196cfd601c1635e2
> 
> We have a release coming up, so this fix will be included in
> the release and will make it to our public server soon. In the
> meantime, note that you can use the genome fasta file rather
> than the len file to create a custom build and everything
> should work.
> 
> Thanks,
> J.
> 
> -- next part --
> An HTML attachment was scrubbed...
> URL:
> 
> 
> 
> --
> 
> ___
> galaxy-user mailing list
> galaxy-user@lists.bx.psu.edu
> http://lists.bx.psu.edu/listinfo/galaxy-user
> 
> To search Galaxy mailing lists use the unified search at:
>   http://galaxyproject.org/search/mailinglists/
> 
> End of galaxy-user Digest, Vol 91, Issue 21
> ***
> 
> 
> 
> -- 
> Gang Wang
> Ph.D. student
> Veterinary Integrative Bioscience
> College of Veterinary Medicine & Biomedical Sciences 
> Texas A&M University
> College Station, TX  77843-4458
> 
> 
> 
>  
> 
> 
> 
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and ot

Re: [galaxy-user] Bisulfite seq

[Björn Grüning]

Hi Mathew,

I have a mapper (bismark) and my own tools (+wrapper) and was able to do
an entire analysis with it. The bismark wrapper is in the toolshed. The
other tools can be found in my github repository.

https://github.com/bgruening

galaxytools and methtools

Hope that helps,
Bjoern

> Do we have any tool which can be used for analyzing and QC check for
> bisulfite sequencing. I have FASTq files.
> 
> 
> Thanks
> 
> 
> Mathew
> ___
> The Galaxy User list should be used for the discussion of
> Galaxy analysis and other features on the public server
> at usegalaxy.org.  Please keep all replies on the list by
> using "reply all" in your mail client.  For discussion of
> local Galaxy instances and the Galaxy source code, please
> use the Galaxy Development list:
> 
>   http://lists.bx.psu.edu/listinfo/galaxy-dev
> 
> To manage your subscriptions to this and other Galaxy lists,
> please use the interface at:
> 
>   http://lists.bx.psu.edu/
> 
> To search Galaxy mailing lists use the unified search at:
> 
>   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] matlab + galaxy

[Björn Grüning]

Hi,

I think you should start here:

https://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax

Furthermore, Peters Blast wrappers are always a good start to learn 
writing Galaxy Tools.

https://github.com/peterjc/galaxy_blast

Here you can find a variety of small to complex wrappers:
https://github.com/bgruening/galaxytools

All of them should be a good start to integrate your matlab script. But 
the first step would be to make your script commandline accessible. If 
its possible consider to use octave as alternative. In that way you can 
share you wrapper with everyone, also with peoples that do not have a 
matlab license.


Cheers,
Bjoern



Hi,
How can I call Matlab command in Galaxy ?
I refer this link, but don't know how to use it.

https://wiki.galaxyproject.org/HelpOnParsers?action=fullsearch&context=180&value=mutsig&fullsearch=Text

I am learning Galaxy, hence don't know much about it.

Can i write that command in xml file to integrate it as tool ?

I am using below website to create xml files for Matlab. Is it good 
website to create xml files ?

http://cli-mate.lumc.nl/define#

Waiting for positive reply.


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] upload more than 2GB data from local computer to local installation of galaxy

[Björn Grüning]

Hi Do,

If you are running a loacl instance and you are admin you can use the 
data library and upload or even better link your data into a data library.


https://wiki.galaxyproject.org/Admin/DataLibraries/UploadingLibraryFiles

Cheers,
Bjoern


Hi,
I am unable to upload more than 3 GB data from local computer to local 
installation of galaxy.

How can I do that ?
I saw many of the tutorials which says about online upload.

My Galaxy is running on 127.0.0.7:8080 
I tried FileZilla to upload file, but its says
"Connection established, waiting for welcome message"
and after some time



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] large data to upload problem

[Björn Grüning]

Hi Do,

the link I send you yesterday, contains a section about linking file. 
Have a close look at the upload form in the admin section. There should 
be an option to link the file into Galaxy.
As a side note, I really think you will need an additional harddrive, 
100GB free space would be not enough, imho.


Cheers,
Bjoern


Hi,
Thank You for answers, I am able to learn everyday.

I am having 500 GB hard disk, I am trying to integrate 'x' tool to galaxy
for local lab purpose.
'x' tool require bam files which are of 400 GB file size. When I used Admin
section to upload file my computer hang because of no space.

Is it way that I can tell Galaxy that use these files directly or may be I
can convert files to Galaxy required format so that galaxy will not create
files by itself.

As you can see in my example, I am having 500 GB HDD, and ~400 GB BAM
files, replication of data by Galaxy its not possible for me.

Some option like tell Galaxy about extension and properties of file, so
that it should not replicate.

By command line 'x' is working fine.


Need some really good solution.
Waiting for positive reply.
Thank You.
--
Reagrds,
Chetan
doka...@gmail.com



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] large data to upload problem

[Björn Grüning]

Hi,


Hi,
Thank you very much for link.
I was able to solve the issue (whatever images shown are out dated may be.
In my system its dropdown menu insted of checkbox to show "link to files
without copy").


Yes, can be but the idea is the same?


So can i do same for result ?


???


Another Question:

My 'x' software takes tab delimited list of files,
as we all know, Galaxy follows its own file name. My 'x' software unable to
look for those file.
I have tried to upload all fresh so that my have little more impact but
same error.
I don't know why its unable to look for that.


Please have a look at the basic Galaxy Tutorials. For example here:
http://vimeo.com/79356949

You will find many more videos. In short you need to change the filetype 
that is associated with your dataset, probably from txt to tabular.



The folder from where I am uploading got all the files in that.
Now when I am running my 'x' tool through galaxy, is it possible that its
looking for default location of galaxy instead of ( path / folder) which i
am using ?


???


Waiting for positive reply.

So in short can I have something like,
Galaxy, you dont use your location for uploading, searching and writing
results of command. Just use my folder and run my commands in that folder
only,
so that looking for files will be easy, also i will get to know the result
at same place.


No, unless you are using the Galaxy API. With that you can archive 
partially what you want.

Please read the wiki carefully, most of your questions are covered there.

Cheers,
Bjoern



On Tue, Feb 25, 2014 at 9:01 PM, Martin Čech  wrote:


Hello Chetan,

Björn sent you a different link yesterday. Please read through it -
especially this part: *Upload files from filesystem paths*.

https://wiki.galaxyproject.org/Admin/DataLibraries/UploadingLibraryFiles

M.


On Tue, Feb 25, 2014 at 5:37 AM, do kadya  wrote:


Hi,
Thank You for reply.
I am still not clear about this website.

https://wiki.galaxyproject.org/Admin/Config/Upload%20via%20FTP

There are total 4 main points highlighted in this website.
Do I have to follow all 4 points ?
I have tried just on second point which is
Configuring Galaxy

As I just need same folder for galaxy where I can put my content directly.
Now after sometime I will all of the points mentioned.


Next Question is WHY GALAXY IS NOT ACCEPTING .bai files?
.bai is indexed form of .bam files.

I tried uploading using admin section upload, which not worked.
next normal file upload as .bai file is just 6 MB., but not worked.
next I write xml file to incorporate samtools index into galaxy. Program
run successfully but output file is 0 KB.

in all of my try .bai file is 0 KB.

I need to upload because my 'x' program is not accepting normal BAM
format hence it needs Indexed BAM.


Waiting for positive reply.


On Tue, Feb 25, 2014 at 1:08 PM, Björn Grüning 
wrote:



Hi Do,

the link I send you yesterday, contains a section about linking file.
Have a close look at the upload form in the admin section. There should be
an option to link the file into Galaxy.
As a side note, I really think you will need an additional harddrive,
100GB free space would be not enough, imho.

Cheers,
Bjoern

  Hi,

Thank You for answers, I am able to learn everyday.

I am having 500 GB hard disk, I am trying to integrate 'x' tool to
galaxy
for local lab purpose.
'x' tool require bam files which are of 400 GB file size. When I used
Admin
section to upload file my computer hang because of no space.

Is it way that I can tell Galaxy that use these files directly or may
be I
can convert files to Galaxy required format so that galaxy will not
create
files by itself.

As you can see in my example, I am having 500 GB HDD, and ~400 GB BAM
files, replication of data by Galaxy its not possible for me.

Some option like tell Galaxy about extension and properties of file, so
that it should not replicate.

By command line 'x' is working fine.


Need some really good solution.
Waiting for positive reply.
Thank You.
--
Reagrds,
Chetan
doka...@gmail.com



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

http://galaxyproject.org/search/mailinglists/



--

Regards,
Chetan

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public 

Re: [galaxy-user] unable to find the file

[Björn Grüning]

Hi Chetan,

try to use the  feature to create file4.txt ...

https://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax#A.3Cconfigfiles.3E_tag_set

Cheers,
Bjoern

Am 04.03.2014 15:04, schrieb do kadya:

Respected Sir / Ma'am,

'x' tool having 3 commands,
1) command takes files from path. ex
perl x.pl --mode 1   file1.bam  file2.bam  file3.fasta --output result1.txt

2)  file4 must have name of result1.txt, file1.bam, file2.bam
perl x.pl  --mode 2 file4.txt --output-directory ~/result2/

for this second command how can i tell galaxy that i need to see the output
file name and other 2 bam file name inside single text file.

whenever I try to run this command it says file not found.
I am uploading bam files by linking galaxy to that file hence when I
specify full path, file1.bam and file2.bam are found.

But I need result of 1st command. I want its file name in file4.txt

How can I do this in galaxy ?

Waiting for positive reply.
Thank You.
--
Chetan



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Exome seq work flow

[Björn Grüning]

Hi,

we are currently working on one pipeline. I can share if you are 
interested, but its not yet finished, parameter wise, but all tools 
should be there.


We tried to stick to the GATK2 best-practise guide and are using snpeff 
for annotation.


Cheers,
Bjoern

Am 15.03.2014 01:55, schrieb Mathew Bunj:

No I have not received any feedback as yet.

Thanks



On Friday, March 14, 2014 7:42 AM, Kristin Kernohan  
wrote:

Hi

did anyone answer this? Id be curious to know as well

thanks

Kristin



On Thu, Mar 13, 2014 at 10:22 PM, Mathew Bunj  wrote:

I was wondering if Galaxy has any work flow for calling mutations in Exome seq 
and then annotating. Alignment can be done by BWA.



Thanks


Mathew
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Base Recalibration tool on usegalaxy

[Björn Grüning]

Hi Kaz,

you are searching for GATK tools, right? Please have a look at the GATK 
suites in the Tool Shed.


Cheers,
Bjoern

Am 12.04.2014 00:16, schrieb KS:

Dear all,

I can't find either of Table Recalibration or Base Recalibrator on
usegalaxy public server. I am defident this is right place to ask, but
seqanswers is clouded with many other pipelines.

Is there an update of base recalibration tool on usegalaxy?

Best,
Kaz
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] please delete me from the mailing list!!!!

[Björn Grüning]

Hi Anna,

you can unsubscribe yourself, following the steps on:

https://wiki.galaxyproject.org/MailingLists#Subscribing_and_Unsubscribing

Cheers,
Bjoern

Am 21.05.2014 01:37, schrieb Anna J.:

please delete me from the mailing list



___
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014.  In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014.  In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/

Re: [galaxy-user] Summary Statistics

[Björn Grüning]

Hi,

"Summary Statistics" is ok, but before you need to use the tool 'Compute 
sequence length'.


Ciao,
Bjoern

Am 23.05.2014 13:29, schrieb Dominique Cowart:


  Hello,



  I am attempting to use Galaxy to calculate the mean sequence read
  length and identify the range of read lengths for my 454 data. The
  data has already been divided into columns:


   >HD4AU5D01BHBCQC TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC
   >HD4AU5D01A093MC TCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT


  I have attempted to use the "Summary Statistics" button, however it
  appears to only be for numerical data and not sequence data. Is this
  tool/task available
  via Galaxy?

  Thank you in advance,


  Dominique Cowart







___
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014.  In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

   http://galaxyproject.org/search/mailinglists/


___
The Galaxy User List is being replaced by the Galaxy Biostar
User Support Forum at https://biostar.usegalaxy.org/

Posts to this list will be disabled in May 2014.  In the
meantime, you are encouraged to post all new questions to
Galaxy Biostar.

For discussion of local Galaxy instances and the Galaxy
source code, please use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

 http://galaxyproject.org/search/mailinglists/