Re: [ANN]VTD-XML 2.9
On Thu, 2010-08-19 at 17:40 -0700, dontcare wrote: VTD-XML 2.9, the next generation XML Processing API for SOA and Cloud computing, has been released. Please visit https://sourceforge.net/projects/vtd-xml/files/ to download the latest version. * Strict Conformance # VTD-XML now fully conforms to XML namespace 1.0 spec * Performance Improvement # Significantly improved parsing performance for small XML files * Expand Core VTD-XML API # Adds getPrefixString(), and toNormalizedString2() * Cutting/Splitting # Adds getSiblingElementFragment() * A number of bug fixes and code enhancement including: # Fixes a bug for reading very large XML documents on some platforms # Fixes a bug in parsing processing instruction # Fixes a bug in outputAndReparse() So, correct me if I'm wrong, but it doesn't look like this project even has a python version. So, why is it on the python-announce list? -- John Krukoff Land Title Guarantee Company jkruk...@ltgc.com -- http://mail.python.org/mailman/listinfo/python-announce-list Support the Python Software Foundation: http://www.python.org/psf/donations/
IDLSave 0.9.7 released
I am happy to announce the availability of IDLSave 0.9.7. IDLSave is a pure Python module to import variables from IDL ‘save’ files into Python, and does not require IDL to work. I am also happy to announce that IDLSave is now also available via scipy.io. More information and download/installation instructions are available at http://idlsave.sourceforge.net/ Please let me know if you encounter any problems, or have any suggestions, Best regards, Thomas Robitaille -- http://mail.python.org/mailman/listinfo/python-announce-list Support the Python Software Foundation: http://www.python.org/psf/donations/
Re: String substitution VS proper mysql escaping
Στις 20/8/2010 8:22 πμ, ο/η Cameron Simpson έγραψε: [...snip...] | Why does the page variable which is actually a string needs to be a | tuple or a list and not just as a string which is what it actually | is? With regard to the % operator, it considers the string on the left to be a format string with multiple %blah things in it to replace. The thing on the right is a sequence of items to place into the format string. I didn't undersatnd. So the thing on the right is_supposed_ to | I have a strong desire to use it like this: | cursor.execute( '''SELECT hits FROM counters WHERE page = %s''' , page ) | opposed to tuple. Hmm. This isn't the python % format operator at all. This is the database API's .execute() method. If it expects its second argument to be a sequence of parameters (which is does) then you need to supply a sequence of parameters. It is that simple! In you usage above you're supplying page instead of (page,). The latter matches the .execute() method's requirements. I don't follow either. -- http://mail.python.org/mailman/listinfo/python-list
Re: expression in an if statement
On 8/18/2010 3:12 PM, Thomas Jollans wrote: On Wednesday 18 August 2010, it occurred to John Nagle to exclaim: On 8/18/2010 11:24 AM, ernest wrote: Hi, In this code: if set(a).union(b) == set(a): pass Does Python compute set(a) twice? CPython does. Shed Skin might optimize. Don't know about Iron Python. I doubt any actual Python implementation optimizes this -- how could it? The object set is clearly being called twice, and it happens to be called with the object a as a sole argument twice. What if set has side effects? A compiler could only exclude this possibility if it knew exactly what set will be at run time, which it can't. That just reflects the rather lame state of Python implementations. For some other languages, there are JIT compilers that can optimize such things. If you rebind a function at run time, the compiled code has to be invalidated and recompiled with the new binding. The HotSpot Java JIT compiler did this. See http://books.google.com/books?id=GBISkhhrHh8Cpg=PA786lpg=PA786dq=JIT+compiler+rebindingsource=blots=GhZa3XbrNusig=OVBOnu0vwlVN_B1QC6jc2ltHk_whl=enei=IhluTLCXOIymsQOW6vy1Cwsa=Xoi=book_resultct=resultresnum=9ved=0CDsQ6AEwCA#v=onepageqf=false It's really tough to get this right. There's a huge overhead in either performance or complexity for allowing rebinding of functions during execution. It's also a feature very seldom used after program startup. I was talking to the Facebook guys doing the compiler for PHP, and they said that it was a huge win for them that PHP doesn't allow dynamically replacing a function. John Nagle -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Russ P. wrote: A simple example: Using zero-based indexing, suppose you want to indent the string spam so it starts at column 4. How many spaces to you prepend? No, you won't want to indent a string so it starts at column 4. You simply want to indent the string by four spaces. Like in PEP 8: /Use 4 spaces per indentation level./ 0123456789 spam And of course your text editor will number the columns beginning with one, so the string starts at column 5. 123456789 spam -- Kai Borgolte, Bonn -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 19, 8:25 am, c...@tiac.net (Richard Harter) wrote: On Wed, 18 Aug 2010 01:39:09 -0700 (PDT), Nick Keighley nick_keighley_nos...@hotmail.com wrote: On 17 Aug, 18:34, Standish P stnd...@gmail.com wrote: How are these heaps being implemented ? Is there some illustrative code or a book showing how to implement these heaps in C for example ? any book of algorithms I'd have thought http://en.wikipedia.org/wiki/Dynamic_memory_allocation http://www.flounder.com/inside_storage_allocation.htm I've no idea how good either of these is The wikipedia page is worthless. The flounder page has substantial meat, but the layout and organization is a mess. A quick google search didn't turn up much that was general - most articles are about implementations in specific environments. I second your assessment. What we have is blind leading the blind. Keith Thompson A CORPORATE MINDER - with multiple accounts - on a Crusade to limit discussions of useful nature on the usenet, must be giving anti-education, pro- illiteracy corporatists (who did much of studies and development on TAX-PAYER MONEY, maybe from now on we should fund Indian/Chinese/ Vietnamese/Russian/Cuban companies that have a tradition of sharing knowledge from the socialist value system) ,lots of joy because that means more market for their user-friendly , thought-killing products and high priced courses. You will see how consistently, she gives short replies, that have ZILCH educational contents, compared to the volume of details they boast on their websites they claim know. -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Sorry about my previous posting with wrong references, this one should be better. Steven D'Aprano wrote: A simple example: Using zero-based indexing, suppose you want to indent the string spam so it starts at column 4. How many spaces to you prepend? No, you won't want to indent a string so it starts at column 4. You simply want to indent the string by four spaces. Like in PEP 8: /Use 4 spaces per indentation level./ 0123456789 spam And of course your text editor will number the columns beginning with one, so the string starts at column 5. 123456789 spam -- Kai Borgolte, Bonn -- http://mail.python.org/mailman/listinfo/python-list
Re: Assert statements in python 3.1
On Aug 20, 6:13 am, genxtech jrmy.l...@gmail.com wrote: This is more of a curiosity question then anything else... I was just wondering why in version 3 of python assertions weren't converted to use parenthesis, since print was. I am just asking because it seems the following line of code would seem more readable as a function: assert 2 + 2 == 5, Only for very large values of 2. Well, part of the idea of asserts is that when you're running with optimizations turned on (python -O), asserts should be disabled. But if assert were a normal function then in assert(expensive_check) the argument expensive_check would be evaluated both with 'python' and with 'python -O'. -- Mark -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On 08/20/2010 02:26 AM, Steven D'Aprano wrote: On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? Is this a sincere surprise or are you just boasting? If I remember correctly, my puzzlement about recursion lasted about 15 seconds. I remember thinking How does the function foo know that there is a function foo when foo doesn't fully exist yet?, but once I accepted the fact that it just does it all just seemed obvious. Getting recursion *right* is sometimes tricky, but the idea itself isn't. Well there's two things where I remember, that at least quite some people in our class (at least the ones who didn't do maths or programming in their spare time) had problems with. This were recursion and Mathematical induction. (quite the same though) The fact, that you didn't have the issue doens't mean it's easy for others. -- http://mail.python.org/mailman/listinfo/python-list
A question to experienced Pythoneers
Here's the story : I've been hired by a company as a consultant to reorganise there development department. The actual situation is : The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. I basicaly have 'carte blanche' :) One of my plans is to introduce Python as development tool. They mostly develop back-office software, and at the moment they do it all in C with MFC. Another new requirement they have, is that the new product should run on Win Mac. So, my strategie would be : - Use Python and wxpython for the GUI - Develop critical routines in Pyrex or in C and make PYD's from it which will be imported by the main Python programm. - Distribute with py2exe on Win py2app for Mac. What do you think of this ? Another point of attention is that the software isn't Open Source, it is a commercial package. So protection of sources is important. Now I know that anything can be decompiled, even C. The only question is, how hard is it and how much effort must someone do to decompile and retro engineer code to understand it. I think by putting all program logic in Pyd files that I would be quite secure ? On a side note : Is it harder to decompile PYD files then PYC files ? I allready had a meeting with the developpers and did a presentation of python with wxwindow, mostly with an open source project where I contribute to the development. They didn't see any big problems to learn Python fast and they allready know C. All opinions, advice here is welcome :) Tia Rony -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On 20-Aug-2010, at 1:17 PM, News123 wrote: On 08/20/2010 02:26 AM, Steven D'Aprano wrote: On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? Is this a sincere surprise or are you just boasting? If I remember correctly, my puzzlement about recursion lasted about 15 seconds. I remember thinking How does the function foo know that there is a function foo when foo doesn't fully exist yet?, but once I accepted the fact that it just does it all just seemed obvious. Getting recursion *right* is sometimes tricky, but the idea itself isn't. Well there's two things where I remember, that at least quite some people in our class (at least the ones who didn't do maths or programming in their spare time) had problems with. This were recursion and Mathematical induction. (quite the same though) The fact, that you didn't have the issue doens't mean it's easy for others. -- http://mail.python.org/mailman/listinfo/python-list Well I guess why you did not have a problem understanding recursion is because you took for granted that it is the way it is. Most people, like me, try to reason why something is the way it is ! Hence, the delay in understanding the concept fully. -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On Fri, Aug 20, 2010 at 12:47 AM, News123 news1...@free.fr wrote: On 08/20/2010 02:26 AM, Steven D'Aprano wrote: On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? Is this a sincere surprise or are you just boasting? I think his point is that the confusion is on how to do it right, not the concept of it. Geremy Condra -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
On Thu, Aug 19, 2010 at 07:13:50PM +, Steven D'Aprano wrote: Mathematics is an ancient art that values tradition and convention. It doesn't matter how hard it was to come up with a proof, or how difficult to verify it. Mathematicians value logical correctness and some undefinable sense of elegance over how easy it is to verify, the readability of the notation, resistance to errors, and the ability of mediocre mathematicians to make useful contributions. Mathematical notation and conventions are not, by any stretch of the imagination, designed to reduce errors. Mathematicians consider it a good thing that they are still mostly using the same notation invented by (say) Leibniz. Another thing worth mentioning (I guess here is a good a place as any other) is the fact that programming and mathematics are still pretty different things, despite how much we programmers would like to think ourselves as some kind of mathematician. Fields-medal winners are not likely to be writing database applications in their spare time, or to save up money for blackboards and pencils. But mathematics is a wide field, and one area I'm very familiar in is signal processing, which has taken a lot of mathematics to make our algorithms work. In fact, of all electrical engineering disciplines, signal processing is probably the most mathematical. I find this thread extremely interesting, but what surprised me that everyone seems to agree that mathematics is 1-based, but we Pythoneers should stick to zero-based. I disagree. To make sure I'm not going crazy, I took the top five books lying on my desk, which were the DSP book by Oppenheim/Schafer, two books by Stephen M. Kay (Spectral Estimation and Estimation Theory) and the Channel Coding book by Lin Costello. This is isn't pure mathematics (as in proving the Goldbach conjecture), but nevertheless, this is serious mathematics and, surprise, they most exclusively use zero-based notation. You probably don't have those books in grabbing distance, so here's some examples for zero-based stuff: - The definition of the FFT and one-sided z-transform (practically everywhere I've seen) - Time indices for time-discrete signals usually start at 0 for causal signals, same goes for filters (impulse responses) - Vector representation of polynomials - The Levinson-Durbin recursion algorithm is way more readable with zero-based indices (step 0 is an initialisation step) - Even most matrices used in the context for coding use zero-based indexing (i.e., the left-most column is column zero). I would like to add that dealing with linear algebra in GF2 is a bit different from handling complex signals as in the previous examples, so this is something to consider. I realize a lot of this has it's root in the application, e.g. shift-registers (index 0 means it's run through 0 shift registers). But it's been adopted for the mathematics because it's useful there as well (e.g. because x^0 = 1 for any non-zero value of x). Both mathematics and programming have two kinds of iterations: where index matters, and where it doesn't (why not iterate 'apple', 'banana', 'cherry' etc.). In practically all cases I deal with where the index matters, zero-based suits me better. The one-based indexing Matlab uses drives me crazy, and that's specifically designed for engineers. Martin -- Karlsruhe Institute of Technology (KIT) Communications Engineering Lab (CEL) Dipl.-Ing. Martin Braun Research Associate Kaiserstraße 12 Building 05.01 76131 Karlsruhe Phone: +49 721 608-3790 Fax: +49 721 608-6071 www.cel.kit.edu KIT -- University of the State of Baden-Württemberg and National Laboratory of the Helmholtz Association pgp8yPohaXQUF.pgp Description: PGP signature -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
On Fri, Aug 20, 2010 at 1:16 AM, Rony k...@kara-moon.com wrote: Here's the story : I've been hired by a company as a consultant to reorganise there development department. The actual situation is : The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. I basicaly have 'carte blanche' :) One of my plans is to introduce Python as development tool. They mostly develop back-office software, and at the moment they do it all in C with MFC. Another new requirement they have, is that the new product should run on Win Mac. So, my strategie would be : - Use Python and wxpython for the GUI - Develop critical routines in Pyrex or in C and make PYD's from it which will be imported by the main Python programm. - Distribute with py2exe on Win py2app for Mac. What do you think of this ? Another point of attention is that the software isn't Open Source, it is a commercial package. So protection of sources is important. Now I know that anything can be decompiled, even C. The only question is, how hard is it and how much effort must someone do to decompile and retro engineer code to understand it. I think by putting all program logic in Pyd files that I would be quite secure ? On a side note : Is it harder to decompile PYD files then PYC files ? I allready had a meeting with the developpers and did a presentation of python with wxwindow, mostly with an open source project where I contribute to the development. They didn't see any big problems to learn Python fast and they allready know C. All opinions, advice here is welcome :) 1) Don't take this the wrong way, but get in the habit of using proper grammar and spelling. Especially as a consultant. It will make the job of convincing people to take you seriously that much easier. 2) Use the tools at hand. If your developers don't know Python, you could wind up wasting a lot of talent turning a top-notch C developer into a bottom-tier Python developer, assuming you don't lose them altogether. 3) Don't rewrite critical code in a new language unless you have somebody who really knows what the hell they're doing. All you've done is turn programming's usual first-order ignorance into a much harder second-order problem. 4) Don't fool yourself into thinking that your code can't be decompiled. Odds are your code isn't worth decompiling, but it isn't hard, and a surprising number of people have the requisite skills. It certainly isn't 'secure'. Also- in my experience when people say 'I don't see a problem' to a consultant, what they really mean is 'I don't think you'll be around long enough for this to be a problem for me', but you may have the tools to deal with that. Happy hunting, Geremy Condra -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
On Aug 20, 11:25 am, geremy condra debat...@gmail.com wrote: 1) Don't take this the wrong way, but get in the habit of using proper grammar and spelling. Especially as a consultant. It will make the job of convincing people to take you seriously that much easier. I don't take it the wrong way but have an answer :) I'm French and doing my best to write understandable English... Thank you for your answers. Also- in my experience when people say 'I don't see a problem' to a consultant, what they really mean is 'I don't think you'll be around long enough for this to be a problem for me', but you may have the tools to deal with that. I'll keep this in mind Thank you Rony -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 != 0x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf = tarfile.open( file, r:gz ) for locFile in xf: logfile = xf.extractfile( locFile ) validFileFlag = True # iterate through each log file, grab the first and the last lines lines = iter( logfile ) firstLine = lines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag = False msg = \nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag = False lTime = extractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
In message 8d1b76b7-1ba3-49c5-97cf-dc3837050...@y11g2000yqm.googlegroups.com, Rony wrote: The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. http://groups.google.co.nz/groups?selm=i4ku71$fd...@lust.ihug.co.nz -- http://mail.python.org/mailman/listinfo/python-list
Re: OpenCV_Problem
On Thu, Aug 19, 2010 at 13:47, arihant nahata forever.arih...@gmail.com wrote:
I m new to python and openCV. i installed openCV and python and copied the
necessary folder. and even appended the sys.path. but then too the same error.
from opencv import cv
File C:\Python26\lib\site-packages\opencv\__init__.py, line 74, in
module
from cv import *
File C:\Python26\lib\site-packages\opencv\cv.py, line 25, in module
_cv = swig_import_helper()
File C:\Python26\lib\site-packages\opencv\cv.py, line 21, in
swig_import_helper
_mod = imp.load_module('_cv', fp, pathname, description)
ImportError: DLL load failed: The specified module could not be found.
can you help me with this??
[next message]
This is what i have,
print sys.path
['', 'C:\\Windows\\system32\\python27.zip', 'C:\\Python27\\DLLs',
'C:\\Python27\
\lib', 'C:\\Python27\\lib\\plat-win', 'C:\\Python27\\lib\\lib-tk',
'C:\\Python27
', 'C:\\Python27\\lib\\site-packages',
'C:\\OpenCV2.0\\Python2.6\\Lib\\site-pack
ages']
[next message]
There is no file named _cv.dll file in the directory that you mentioned
what to do now.???
Well, we've established that the '_cv' module really isn't present.
Which makes me wonder if the OpenCV installation went correctly, or if
you've added the right paths. However, as I'm not an OpenCV expert, I
don't know where to look next.
If no one on the Python mailing list can help, you could also try the
OpenCV mailing list: http://tech.groups.yahoo.com/group/OpenCV/
HTH,
Rami
--
Rami Chowdhury
Never assume malice when stupidity will suffice. -- Hanlon's Razor
408-597-7068 (US) / 07875-841-046 (UK) / 0189-245544 (BD)
--
http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 != 0x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf = tarfile.open( file, r:gz ) for locFile in xf: logfile = xf.extractfile( locFile ) validFileFlag = True # iterate through each log file, grab the first and the last lines lines = iter( logfile ) firstLine = lines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag = False msg = \nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag = False lTime = extractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
On Fri, Aug 20, 2010 at 15:25, geremy condra debat...@gmail.com wrote: On Fri, Aug 20, 2010 at 1:16 AM, Rony k...@kara-moon.com wrote: Here's the story : I've been hired by a company as a consultant to reorganise there development department. [snip] One of my plans is to introduce Python as development tool. They mostly develop back-office software, and at the moment they do it all in C with MFC. Another new requirement they have, is that the new product should run on Win Mac. [snip] 2) Use the tools at hand. If your developers don't know Python, you could wind up wasting a lot of talent turning a top-notch C developer into a bottom-tier Python developer, assuming you don't lose them altogether. 3) Don't rewrite critical code in a new language unless you have somebody who really knows what the hell they're doing. All you've done is turn programming's usual first-order ignorance into a much harder second-order problem. +1 to both of these, personally. If the developers are used to C and MFC, but you need to make the product run on the Mac as well, have you considered C / C++ GUI frameworks like GTK, WxWidgets, or Qt? Porting your GUI to those might be a better use of time than porting the software to Python... -- Rami Chowdhury Never assume malice when stupidity will suffice. -- Hanlon's Razor 408-597-7068 (US) / 07875-841-046 (UK) / 0189-245544 (BD) -- http://mail.python.org/mailman/listinfo/python-list
Re: 79 chars or more?
In article 4c6dfb31$0$1$c3e8...@news.astraweb.com, Steven D'Aprano st...@remove-this-cybersource.com.au wrote: Of course source code is written in a monospaced typeface, which is a little wider and consequently fewer characters per page. There was a fling a while ago with typesetting code in proportional spaced type. I think some of the Effective C++ series from Addison-Wesley did that. Yuck. -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 19, 2:14 pm, spinoza spinoza1...@yahoo.com wrote: All the rest [how to implement heaps] is detail for the little techies to normally, get wrong. That's a fundamental feature of structured programming. If we maintain the interface malloc(), realloc(), and free(), then we could have a fairly simple or a fairly complicated scheme, and the user doesn't care or need to know. The problem is that a lot of techniques we can use to speed up memory management, such as allocating from a stack, can't be used with this interface. Designing good interfaces is hard. -- http://mail.python.org/mailman/listinfo/python-list
Re: 79 chars or more?
On 2010-08-20, Roy Smith r...@panix.com wrote: In article 4c6dfb31$0$1$c3e8...@news.astraweb.com, Steven D'Aprano st...@remove-this-cybersource.com.au wrote: Of course source code is written in a monospaced typeface, which is a little wider and consequently fewer characters per page. There was a fling a while ago with typesetting code in proportional spaced type. I think some of the Effective C++ series from Addison-Wesley did that. Yuck. It's probably influenced by The C++ Programming Language. Stroustrup likes it. -- Neil Cerutti -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
On Aug 20, 6:57 am, m_ahlenius ahleni...@gmail.com wrote: On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 != 0x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf = tarfile.open( file, r:gz ) for locFile in xf: logfile = xf.extractfile( locFile ) validFileFlag = True # iterate through each log file, grab the first and the last lines lines = iter( logfile ) firstLine = lines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag = False msg = \nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag = False lTime = extractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark Oh and what's stored currently in The file var us just the unopened pathname to the Target file I want to open -- http://mail.python.org/mailman/listinfo/python-list
Get authentication error while using 'smtplib'
I have this script to send an email via SMTP:
import smtplib
smtpserver = 'smtp.server.com'
AUTHREQUIRED = 1# if you need to use SMTP AUTH set to 1
smtpuser = username# for SMTP AUTH, set SMTP username here
smtppass = password# for SMTP AUTH, set SMTP password here
RECIPIENTS ='recipi...@server.com'
SENDER = 'sen...@server.com'
mssg = open('filename.txt', 'r').read()
session = smtplib.SMTP(smtpserver)
if AUTHREQUIRED:
session.login(smtpuser, smtppass)
smtpresult = session.sendmail(SENDER, RECIPIENTS, mssg)
After running the script I get this error:
Traceback (most recent call last):
File my_mail.py, line 14, in module
session.login(smtpuser, smtppass)
File /usr/lib/python2.6/smtplib.py, line 589, in login
raise SMTPAuthenticationError(code, resp)
smtplib.SMTPAuthenticationError: (535, '5.7.0 Error: authentication failed:
authentication failure')
However there is no problem with my user/pass because I can login to my mail
account.
Thanks for any idea.
// Naderan *Mahmood;
--
http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
Hi Lawrence, On 2010-08-20 13:11, Lawrence D'Oliveiro wrote: In message 8d1b76b7-1ba3-49c5-97cf-dc3837050...@y11g2000yqm.googlegroups.com, Rony wrote: The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. http://groups.google.co.nz/groups?selm=i4ku71$fd...@lust.ihug.co.nz I can't get the page; all I get is an error message: Not Found The requested message, i4ku71$fd...@lust.ihug.co.nz, could not be found. Can you please give a part of the message to search for or even better, an URL that works? :-) Thanks, Stefan -- http://mail.python.org/mailman/listinfo/python-list
Re: 79 chars or more?
Stefan Schwarzer a écrit : Hi Neil, On 2010-08-17 14:42, Neil Cerutti wrote: (snip) Looking through my code, the split-up lines almost always include string literals or elimination of meaningless temporary variables, e.g.: self.expiration_date = translate_date(find(response, 'MPNExpirationDate').text, '%Y-%m-%d', '%m%d%Y') I'd probably reformat this to self.expiration_date = translate_date( find(response, 'MPNExpirationDate').text, '%Y-%m-%d', '%m%d%Y') or even self.expiration_date = translate_date( find(response, 'MPNExpirationDate').text, '%Y-%m-%d', '%m%d%Y') make this : self.expiration_date = translate_date( find(response, 'MPNExpirationDate').text, '%Y-%m-%d', '%m%d%Y' ) I just HATE closing parens on the same line when the args don't fit on one single line. Significant indentation only solves one single issue when it comes to coding conventions war !-) -- http://mail.python.org/mailman/listinfo/python-list
Re: 79 chars or more?
On 2010-08-20, Bruno Desthuilliers bruno.42.desthuilli...@websiteburo.invalid wrote: make this : self.expiration_date = translate_date( find(response, 'MPNExpirationDate').text, '%Y-%m-%d', '%m%d%Y' ) I just HATE closing parens on the same line when the args don't fit on one single line. It's been interesting to see my code scrutinized like this. Thanks all. As a result of the discussion, I changed translate_date to trans_date_from_to to make the order of arguments clear. find is just a small wrapper around Element.find calls, inserting the namespace. -- Neil Cerutti -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
m_ahlenius wrote: On Aug 20, 6:57 am, m_ahlenius ahleni...@gmail.com wrote: On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 !=x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf =arfile.open( file, r:gz ) for locFile in xf: logfile =f.extractfile( locFile ) validFileFlag =rue # iterate through each log file, grab the first and the last lines lines =ter( logfile ) firstLine =ines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag =alse msg =\nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag =alse lTime =xtractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark Oh and what's stored currently in The file var us just the unopened pathname to the Target file I want to open No, on Linux, there should be no such problem. And I have to assume that if you pass the filename as a string, the library would use 'rb' anyway. It's just if you pass a fileobj, AND are on Windows. Sorry I wasted your time, but nobody else had answered, and I hoped it might help. DaveA -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
Hi Rony, On 2010-08-20 10:16, Rony wrote: Here's the story : I've been hired by a company as a consultant to reorganise there development department. The actual situation is : The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. I guess the most important issue will be to find out what was wrong with the development process and fix the problems, i. e. don't repeat them. Keep in mind that what was wrong can mean any number of reasons. Until you haven't dealt with this, thinking about changing the programming language in my opinion makes little sense. I basicaly have 'carte blanche' :) Um, yes ... with the corresponding responsibilities and risks. :-) So, my strategie would be : - Use Python and wxpython for the GUI - Develop critical routines in Pyrex or in C and make PYD's from it which will be imported by the main Python programm. - Distribute with py2exe on Win py2app for Mac. You plan to change a process (and people) used to developing with C to developing with Python and the associated tools. For a developer experienced with both C and Python, using the latter usually will result in faster development. On the other hand, switching to a tool you (i. e. an individual developer) never used before adds some risk (- uncertainty in effort estimation). If the project you're dealing with now is based on the project you mentioned above, you better not start from scratch in a different language. Very likely the existing code will have subtle though important fixes for subtle problems which were encountered during development. If you start from scratch you risk losing these fixes and having to re-discover the problems and fixes which can take a lot of time. Even if you have all programmers of the old team available, it's risky because they might have forgotten the parts of the code or they may no longer be around when you're about to implement the functionality of these critical parts of the code. If you haven't already, I recommend to read these books: Steve McConnell Rapid Development http://www.amazon.com/x/dp/0072850604/ Tom DeMarco, Timothy Lister Waltzing With Bears: Managing Risk on Software Projects http://www.amazon.com/x/dp/0932633609/ Stefan -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 9:36 am, Tim Golden m...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
m_ahlenius wrote: On Aug 20, 6:57 am, m_ahlenius ahleni...@gmail.com wrote: On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 != 0x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf = tarfile.open( file, r:gz ) for locFile in xf: logfile = xf.extractfile( locFile ) validFileFlag = True # iterate through each log file, grab the first and the last lines lines = iter( logfile ) firstLine = lines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag = False msg = \nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag = False lTime = extractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark Oh and what's stored currently in The file var us just the unopened pathname to the Target file I want to open Random questions: What python version are you using? If you have other python versions around, do they exhibit the same problem? If you extract and compress your data using the external tool, does the resulting file make problems in Python, too? If so, can you reduce data size and put a small demo online for others to experiment with? Peter -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
It looks like I forgot to specify that the product is a totaly new product build from scratch, not an upgrade from an existing product. Interesting answers ! Rony -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 9:36 am, Tim Golden m...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 4:26 pm, vsoler vicente.so...@gmail.com wrote: On Aug 20, 9:36 am, Tim Golden m...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. Tim, It works!!! or at least, should I say, it runs!!! wonderful. Now, would it be possible to have a hint/suggestion as to some lines that I should include in my script? I find this exercice very interesting. Thank you for your help. Vicente Soler -- http://mail.python.org/mailman/listinfo/python-list
Re: Looking for an appropriate encoding standard that supports all languages
On Aug 19, 11:48 am, Steven D'Aprano steve-REMOVE- t...@cybersource.com.au wrote: On Thu, 19 Aug 2010 01:29:51 -0700, ata.jaf wrote: On Aug 17, 11:55 pm, Thomas Jollans tho...@jollybox.de wrote: On Tuesday 17 August 2010, it occurred to ata.jaf to exclaim: I am developing a little program in Mac with wxPython. But I have problems with the characters that are not in ASCII. Like some special characters in French or Turkish. So I am looking for a way to solve this. Like an encoding standard that supports all languages. Or some other way. Anything that supports all of Unicode will do. Like UTF-8. If your text is mostly Latin, then just go for UTF-8, if you use other alphabets extensively, you might want to consider UTF-16, which might the use a little less space. OK, I used UTF-8. I write a line of strings in the source code Do you have a source code encoding line at the start of your script? http://www.python.org/dev/peps/pep-0263/ and I want my program to show that as an output on GUI. And this line of strings includes a character like ü. But I see that in GUI this character is replaced with another strange characters. I mean it doesn't work. And when I try to use UTF-16, I get an syntax error that declares UTF-16 stream does not start with BOM. What GUI are you using? Please COPY AND PASTE (do not retype) the EXACT error message you get, including the entire traceback. -- Steven Yes I have a source code encoding line. Here it is: # -*- coding: utf_16 -*- I am using WxPython. And the error that I get about using utf-16 is:\ Traceback (most recent call last): File stdin, line 1, in module File z.py, line 2 SyntaxError: UTF-16 stream does not start with BOM -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On 20/08/2010 15:49, vsoler wrote: On Aug 20, 4:26 pm, vsolervicente.so...@gmail.com wrote: On Aug 20, 9:36 am, Tim Goldenm...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. Tim, It works!!! or at least, should I say, it runs!!! wonderful. Now, would it be possible to have a hint/suggestion as to some lines that I should include in my script? Depends what, exactly, you want your script to do :) The simplest way to get an ad-hoc look at what permissions are applied to a file is: code import os, sys from winsys import fs # # Just using sys.executable as a file I know will exist; # obviously you put your own file name in there... # fs.file (sys.executable).security ().dump () /code To get that in the more compact but more esoteric MS SDDL format: code import os, sys from winsys import fs print (fs.file (sys.executable).security ()) /code To decode the permission bit-strings to vaguely meaningful names: code import os, sys from winsys import fs dacl = fs.file (sys.executable).security ().dacl for permission in dacl: print (d.trustee, (Inherited ) if d.inherited else ) for name in fs.FILE_ACCESS.names_from_value (d.access): print ( , name) /code TJG -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
Rony a écrit : It looks like I forgot to specify that the product is a totaly new product build from scratch, not an upgrade from an existing product. Still the advice to first find out what went wrong with the previous project is a very sensible one. Technical problems do exist, but from experience they rarely are the main source of failure. -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
Steven D'Aprano a écrit : On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? I onced worked in a shop (Win32 desktop / accouting applications mainly) where I was the only guy that could actually understand recursion. FWIW, I also was the only guy around that understood hairy (lol) concepts like callback functions, FSM, polymorphism, hashtables, linked lists, ADTs, algorithm complexity etc... Needless to say, I didn't last long !-) -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
Salut ! C'est cela, la solitude du programmeur génial... @-salutations -- Michel Claveau -- http://mail.python.org/mailman/listinfo/python-list
Re: urllib quote problem
In article 4c5eef7f$0$1609$742ec...@news.sonic.net, John Nagle na...@animats.com wrote: This looks like code that will do the wrong thing in Python 2.6 for characters in the range 128-255. Those are illegal in type str, but this code is constructing such values with chr. WDYM illegal? -- Aahz (a...@pythoncraft.com) * http://www.pythoncraft.com/ ...if I were on life-support, I'd rather have it run by a Gameboy than a Windows box. --Cliff Wells -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
Michel Claveau - MVP a écrit : Salut ! C'est cela, la solitude du programmeur génial... @-salutations Moi aussi je t'aime, Michel !-) -- http://mail.python.org/mailman/listinfo/python-list
Re: requirements in writing an email/rss/usenet client?
In article eb32afd4-a231-4582-89c8-e927c2ff6...@t5g2000prd.googlegroups.com, George Oliver georgeolive...@gmail.com wrote: I'd like to know what to consider when writing an email/rss/usenet client. Apologies for such a broad question, but I've never attempted a project of this scope and I'm currently feeling out the requirements. About the only advice I can give you to such a broad question is the aphorism Be strict about what you send; be generous about what you receive. IOW, follow the standards very very carefully in sending messages but be very very lenient with what you accept (just make sure you don't crash). Overall, you probably will get discouraged eventually, so I suggest that you try to have as much fun as possible along the way. -- Aahz (a...@pythoncraft.com) * http://www.pythoncraft.com/ ...if I were on life-support, I'd rather have it run by a Gameboy than a Windows box. --Cliff Wells -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
In article 8d1b76b7-1ba3-49c5-97cf-dc3837050...@y11g2000yqm.googlegroups.com, Rony k...@kara-moon.com wrote: The manager of the development has been fired, main reason (what they told me) is that they have big big troubles in keeping deadlines ! For there last product, for which they estimated 3 man years of development they had 9 months extra effort, and the product was delivered a year to late. Keep in mind that the real problem may have been that upper management forced a completely unrealistic deadline. They may also have had difficulty translating development effort into Real World Timing [tm]. (For example, when I tell my boss that something will take three days of development effort, I also make clear that between support and production issues that I need to help with, not to mention meetings, mentoring other people on my team, etc -- those three days will almost inevitably expand into six business days BEST CASE.) Try to have some quiet, off-campus discussions with developers to gather information. NOTE VERY CAREFULLY: if you promise to keep a conversation private, KEEP THE PROMISE. -- Aahz (a...@pythoncraft.com) * http://www.pythoncraft.com/ ...if I were on life-support, I'd rather have it run by a Gameboy than a Windows box. --Cliff Wells -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 5:10 pm, Tim Golden m...@timgolden.me.uk wrote: On 20/08/2010 15:49, vsoler wrote: On Aug 20, 4:26 pm, vsolervicente.so...@gmail.com wrote: On Aug 20, 9:36 am, Tim Goldenm...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. Tim, It works!!! or at least, should I say, it runs!!! wonderful. Now, would it be possible to have a hint/suggestion as to some lines that I should include in my script? Depends what, exactly, you want your script to do :) The simplest way to get an ad-hoc look at what permissions are applied to a file is: code import os, sys from winsys import fs # # Just using sys.executable as a file I know will exist; # obviously you put your own file name in there... # fs.file (sys.executable).security ().dump () /code To get that in the more compact but more esoteric MS SDDL format: code import os, sys from winsys import fs print (fs.file (sys.executable).security ()) /code To decode the permission bit-strings to vaguely meaningful names: code import os, sys from winsys import fs dacl = fs.file (sys.executable).security ().dacl for permission in dacl: print (d.trustee, (Inherited ) if d.inherited else ) for name in fs.FILE_ACCESS.names_from_value (d.access): print ( , name) /code TJG Tim, in your last piece of code, the definition of d is missing. missed anything when copying? Vicente Soler -- http://mail.python.org/mailman/listinfo/python-list
Re: Looking for an appropriate encoding standard that supports all languages
On Fri, Aug 20, 2010 at 21:02, ata.jaf a.j.romani...@gmail.com wrote: On Aug 19, 11:48 am, Steven D'Aprano steve-REMOVE- t...@cybersource.com.au wrote: On Thu, 19 Aug 2010 01:29:51 -0700, ata.jaf wrote: On Aug 17, 11:55 pm, Thomas Jollans tho...@jollybox.de wrote: On Tuesday 17 August 2010, it occurred to ata.jaf to exclaim: I am developing a little program in Mac with wxPython. But I have problems with the characters that are not in ASCII. Like some special characters in French or Turkish. So I am looking for a way to solve this. Like an encoding standard that supports all languages. Or some other way. Anything that supports all of Unicode will do. Like UTF-8. If your text is mostly Latin, then just go for UTF-8, if you use other alphabets extensively, you might want to consider UTF-16, which might the use a little less space. OK, I used UTF-8. I write a line of strings in the source code Do you have a source code encoding line at the start of your script? http://www.python.org/dev/peps/pep-0263/ Yes I have a source code encoding line. Here it is: # -*- coding: utf_16 -*- I am using WxPython. And the error that I get about using utf-16 is:\ Traceback (most recent call last): File stdin, line 1, in module File z.py, line 2 SyntaxError: UTF-16 stream does not start with BOM Which encoding are you saving your script in? Very few of the text editors I've used save to UTF-16 by default. -- Rami Chowdhury Never assume malice when stupidity will suffice. -- Hanlon's Razor 408-597-7068 (US) / 07875-841-046 (UK) / 0189-245544 (BD) -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 5:10 pm, Tim Golden m...@timgolden.me.uk wrote: On 20/08/2010 15:49, vsoler wrote: On Aug 20, 4:26 pm, vsolervicente.so...@gmail.com wrote: On Aug 20, 9:36 am, Tim Goldenm...@timgolden.me.uk wrote: I currently do not have subversion access in my PC. I could try to install a free copy of it. But it you could ptovide an installer, it certainly would do things easier. Please let me know if it is possible. Vicente, can you just confirm that you received the installer I sent offlist? I'll try to put winsys on PyPI with installers; just haven't got round to it yes :) TJG Tim, I just downloaded it, and am going to install it right away. Tim, It works!!! or at least, should I say, it runs!!! wonderful. Now, would it be possible to have a hint/suggestion as to some lines that I should include in my script? Depends what, exactly, you want your script to do :) The simplest way to get an ad-hoc look at what permissions are applied to a file is: code import os, sys from winsys import fs # # Just using sys.executable as a file I know will exist; # obviously you put your own file name in there... # fs.file (sys.executable).security ().dump () /code To get that in the more compact but more esoteric MS SDDL format: code import os, sys from winsys import fs print (fs.file (sys.executable).security ()) /code To decode the permission bit-strings to vaguely meaningful names: code import os, sys from winsys import fs dacl = fs.file (sys.executable).security ().dacl for permission in dacl: print (d.trustee, (Inherited ) if d.inherited else ) for name in fs.FILE_ACCESS.names_from_value (d.access): print ( , name) /code TJG it seems as though the definition of d is missing in your last piece of code -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
On Aug 20, 9:10 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: On Aug 20, 6:57 am, m_ahlenius ahleni...@gmail.com wrote: On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 !=x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf =arfile.open( file, r:gz ) for locFile in xf: logfile =f.extractfile( locFile ) validFileFlag =rue # iterate through each log file, grab the first and the last lines lines =ter( logfile ) firstLine =ines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag =alse msg =\nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag =alse lTime =xtractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark Oh and what's stored currently in The file var us just the unopened pathname to the Target file I want to open No, on Linux, there should be no such problem. And I have to assume that if you pass the filename as a string, the library would use 'rb' anyway. It's just if you pass a fileobj, AND are on Windows. Sorry I wasted your time, but nobody else had answered, and I hoped it might help. DaveA Hi Dave thanks for responding - you were not wasting my time but helping me to be aware of other potential issues. Appreciate it much. Its just weird that it works for most files and even finds corrupt ones, but some of the ones it marks as corrupt seem to be OK. thanks 'mark -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On 8/20/2010 12:47 AM, News123 wrote: On 08/20/2010 02:26 AM, Steven D'Aprano wrote: On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? Is this a sincere surprise or are you just boasting? If I remember correctly, my puzzlement about recursion lasted about 15 seconds. I remember thinking How does the function foo know that there is a function foo when foo doesn't fully exist yet?, but once I accepted the fact that it just does it all just seemed obvious. Getting recursion *right* is sometimes tricky, but the idea itself isn't. If you think about what the implementation has to do, it's quite complicated. Which objects are copied, and which are merely referenced? Is the recursion going to result in control being inside the same object instance twice? Is the recursion a closure? Is tail recursion possible, and does your language implement it? Python does not do tail recursion, so using recursion where iteration could do the job is generally a bad idea. Scheme, on the other hand, always does tail recursion where possible. Python does have generators, and I recently wrote a recursive generator for a production application. I needed to descend a specialized directory tree structure (the one used by the US Securities and Exchange Commission to store filings) and retrieve the last N days of filings. So I have a recursive generator that returns directory after directory, descending into the directories for years and quarters as necessary. The calling function stops calling the generator when it has found the information it needs, which happens before the generator runs out. That's a real-life use case for such a construct, and led to much shorter code than a non-recursive implementation. John Nagle -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
On Aug 20, 9:25 am, Peter Otten __pete...@web.de wrote: m_ahlenius wrote: On Aug 20, 6:57 am, m_ahlenius ahleni...@gmail.com wrote: On Aug 20, 5:34 am, Dave Angel da...@ieee.org wrote: m_ahlenius wrote: Hi, I am relatively new to doing serious work in python. I am using it to access a large number of log files. Some of the logs get corrupted and I need to detect that when processing them. This code seems to work for quite a few of the logs (all same structure) It also correctly identifies some corrupt logs but then it identifies others as being corrupt when they are not. example error msg from below code: Could not open the log file: '/disk/7-29-04-02-01.console.log.tar.gz' Exception: CRC check\ failed 0x8967e931 != 0x4e5f1036L When I manually examine the supposed corrupt log file and use tar -xzvof /disk/7-29-04-02-01.console.log.tar.gz on it, it opens just fine. Is there anything wrong with how I am using this module? (extra code removed for clarity) if tarfile.is_tarfile( file ): try: xf = tarfile.open( file, r:gz ) for locFile in xf: logfile = xf.extractfile( locFile ) validFileFlag = True # iterate through each log file, grab the first and the last lines lines = iter( logfile ) firstLine = lines.next() for nextLine in lines: continue logfile.close() ... xf.close() except Exception, e: validFileFlag = False msg = \nCould not open the log file: + repr(file) + Exception: + str(e) + \n else: validFileFlag = False lTime = extractFileNameTime( file ) msg = Warning + file + is NOT a valid tar archive \n print msg I haven't used tarfile, but this feels like a problem with the Win/Unix line endings. I'm going to assume you're running on Windows, which could trigger the problem I'm going to describe. You use 'file' to hold something, but don't show us what. In fact, it's a lousy name, since it's already a Python builtin. But if it's holding fileobj, that you've separately opened, then you need to change that open to use mode 'rb' The problem, if I've guessed right, is that occasionally you'll accidentally encounter a 0d0a sequence in the middle of the (binary) compressed data. If you're on Windows, and use the default 'r' mode, it'll be changed into a 0a byte. Thus corrupting the checksum, and eventually the contents. DaveA Hi, thanks for the comments - I'll change the variable name. I am running this on linux so don't think its a Windows issue. So if that's the case is the 0d0a still an issue? 'mark Oh and what's stored currently in The file var us just the unopened pathname to the Target file I want to open Random questions: What python version are you using? If you have other python versions around, do they exhibit the same problem? If you extract and compress your data using the external tool, does the resulting file make problems in Python, too? If so, can you reduce data size and put a small demo online for others to experiment with? Peter Hi, I am using Python 2.6.5. Unfortunately I don't have other versions installed so its hard to test with a different version. As for the log compression, its a bit hard to test. Right now I may process 100+ of these logs per night, and will get maybe 5 which are reported as corrupt (typically a bad CRC) and 2 which it reported as a bad tar archive. This morning I checked each of the 7 reported problem files by manually opening them with tar -xzvof and they were all indeed corrupt. Sign. Unfortunately due to the nature of our business, I can't post the data files online, I hope you can understand. But I really appreciate your suggestions. The thing that gets me is that it seems to work just fine for most files, but then not others. Labeling normal files as corrupt hurts us as we then skip getting any log data from those files. appreciate all your help. 'mark -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On 2010-08-20, John Nagle na...@animats.com wrote: Python does not do tail recursion, so using recursion where iteration could do the job is generally a bad idea. Scheme, on the other hand, always does tail recursion where possible. A tail-recursive function is usually easy to convert to a loop-style iteration. However, Scheme does tail-call optimization, I believe, which is slightly more general. -- Neil Cerutti -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On 20/08/2010 5:10 PM, vsoler wrote: On Aug 20, 5:10 pm, Tim Goldenm...@timgolden.me.uk wrote: To decode the permission bit-strings to vaguely meaningful names: code import os, sys from winsys import fs dacl = fs.file (sys.executable).security ().dacl for permission in dacl: print (d.trustee, (Inherited ) if d.inherited else ) for name in fs.FILE_ACCESS.names_from_value (d.access): print ( , name) /code TJG it seems as though the definition of d is missing in your last piece of code Whoops, changed tack mid-thingy. Try: dacl = ... for d in dacl: # .. as before -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Friday 20 August 2010, it occurred to Nobody to exclaim: Unix lacks the Append Data permission for files, and the Create Files, Create Folders and Delete Subfolders and Files correspond to having write permission on a directory. How does append differ from write? If you have appending permissions, but not writing ones, is it impossible to seek? Or is there a more complex block that bites you when you seek to before the old end of file and try writing there? Thank you for the insights, Nobody. Makes me wonder whether SELinux makes changes in this area, and if so, how far-reaching they are. On Unix, you can read permissions (and attributes if the filesystem has them) for any file which you can reach (i.e. have x permission on all ancestor directories). You can only change permissions (and some attributes) if you own the file, and only root can change ownership (and change some attributes). 2. Permissions can be inherited from the parent object (which isn't necessarily the parent folder). If you change a permission on the parent object, it automatically affects any file or folder which inherits the permission. 3. The owner can be either a user or a group. What about both? 4. On Windows, a file cannot be given away either by its owner or an administrator. You can grant the Take Ownership permission, but the recipient still has to explicitly change the ownership. Really? So the operating system actually places restrictions on what the administrator can do? Or is there a fine distinction here between administrator-accounts in general and the NT Administrator account that at least some versions of Windows (xp home edition springs to mind) appear to try to hide as best they can ? Well, this is probably just my UNIX conditioning, expecting a single all-powerful super-user, shining through here -- but it does seam strange to have a super- user that is not omnipotent. -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
m_ahlenius wrote: I am using Python 2.6.5. Unfortunately I don't have other versions installed so its hard to test with a different version. As for the log compression, its a bit hard to test. Right now I may process 100+ of these logs per night, and will get maybe 5 which are reported as corrupt (typically a bad CRC) and 2 which it reported as a bad tar archive. This morning I checked each of the 7 reported problem files by manually opening them with tar -xzvof and they were all indeed corrupt. Sign. So many corrupted files? I'd say you have to address the problem with your infrastructure first. Unfortunately due to the nature of our business, I can't post the data files online, I hope you can understand. But I really appreciate your suggestions. The thing that gets me is that it seems to work just fine for most files, but then not others. Labeling normal files as corrupt hurts us as we then skip getting any log data from those files. appreciate all your help. I've written an autocorruption script, import sys import subprocess import tarfile def process(source, dest, data): for pos in range(len(data)): for bit in range(8): new_data = data[:pos] + chr(ord(data[pos]) ^ (1bit)) + data[pos+1:] assert len(data) == len(new_data) out = open(dest, w) out.write(new_data) out.close() try: t = tarfile.open(dest) for f in t: t.extractfile(f) except Exception, e: if 0 == subprocess.call([tar, -xf, dest]): return pos, bit if __name__ == __main__: source, dest = sys.argv[1:] data = open(source).read() print process(source, dest, data) and I can indeed construct an archive that is rejected by tarfile, but not by tar. My working hypothesis is that the python library is a bit stricter in what it accepts... Peter -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
On Aug 20, 1:23 am, Martin Braun martin.br...@kit.edu wrote: I find this thread extremely interesting, but what surprised me that everyone seems to agree that mathematics is 1-based, but we Pythoneers should stick to zero-based. I disagree. To make sure I'm not going crazy, I took the top five books lying on my desk, which were the DSP book by Oppenheim/Schafer, two books by Stephen M. Kay (Spectral Estimation and Estimation Theory) and the Channel Coding book by Lin Costello. This is isn't pure mathematics (as in proving the Goldbach conjecture), but nevertheless, this is serious mathematics and, surprise, they most exclusively use zero-based notation. You probably don't have those books in grabbing distance, so here's some examples for zero-based stuff: That's interesting, but I think zero-based indexing is rare in the literature of mathematics, applied math, science and engineering. All the literature I've ever seen that uses vectors and matrices is one- based, and that includes text books and technical papers. It all boils down to personal preference, but I just find it strange that we would not try to make programming as consistent as possible with notational conventions in the literature. If I try to implement some algorithm I find in a technical book or paper, why should I have to mentally offset every index by one? That's very error prone, and I have more important things to think about. Then again, I don't do that very often, so maybe it's not a big deal. The zero-based indexing just seemed wrong to me when I first saw it. I'm used to it by now, but it still doesn't seem quite right to me. It's almost right -- but it's off by one. I still have a habit of taking the 1 element when I really want the 0 element. Most programmers probably never use vectors and matrices, so they don't care about the inconsistency with standard mathematical notation. And yes, I understand that zero-based indexing can be slightly more efficient. That's why I think it's appropriate for low-level languages such as C. However, I think one-based indexing is more appropriate for high-level languages. -- http://mail.python.org/mailman/listinfo/python-list
scope of variable
Hi, I try to learn python. I don't understand this: (running in idle) dept=0 def mud(): print dept mud() 0 def mud(): dept+=1 print dept mud() Traceback (most recent call last): File pyshell#7, line 1, in module mud() File pyshell#6, line 2, in mud dept+=1 UnboundLocalError: local variable 'dept' referenced before assignment Regards MB -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
On Fri, Aug 20, 2010 at 11:01 AM, Russ P. russ.paie...@gmail.com wrote: On Aug 20, 1:23 am, Martin Braun martin.br...@kit.edu wrote: I find this thread extremely interesting, but what surprised me that everyone seems to agree that mathematics is 1-based, but we Pythoneers should stick to zero-based. I disagree. To make sure I'm not going crazy, I took the top five books lying on my desk, which were the DSP book by Oppenheim/Schafer, two books by Stephen M. Kay (Spectral Estimation and Estimation Theory) and the Channel Coding book by Lin Costello. This is isn't pure mathematics (as in proving the Goldbach conjecture), but nevertheless, this is serious mathematics and, surprise, they most exclusively use zero-based notation. You probably don't have those books in grabbing distance, so here's some examples for zero-based stuff: That's interesting, but I think zero-based indexing is rare in the literature of mathematics, applied math, science and engineering. All the literature I've ever seen that uses vectors and matrices is one- based, and that includes text books and technical papers. Not sure what you read, but for me (mostly number theory, numerical analysis, and abstract algebra) zero-based indexing is quite common. It all boils down to personal preference, but I just find it strange that we would not try to make programming as consistent as possible with notational conventions in the literature. If I try to implement some algorithm I find in a technical book or paper, why should I have to mentally offset every index by one? That's very error prone, and I have more important things to think about. Then again, I don't do that very often, so maybe it's not a big deal. Ever read code by a mathematician? It's usually (obviously not always) a nightmare. I'm glad we break with convention, particularly when that convention is things like one-letter variables and 'reuse' of notation. Geremy Condra -- http://mail.python.org/mailman/listinfo/python-list
Re: scope of variable
On Fri, Aug 20, 2010 at 11:09 AM, M B zna...@telia.com wrote: Hi, I try to learn python. I don't understand this: snip dept=0 snip def mud(): dept+=1 print dept mud() Traceback (most recent call last): File pyshell#7, line 1, in module mud() File pyshell#6, line 2, in mud dept+=1 UnboundLocalError: local variable 'dept' referenced before assignment http://www.mail-archive.com/python-list@python.org/msg75263.html Cheers, Chris -- Google is your friend http://blog.rebertia.com -- http://mail.python.org/mailman/listinfo/python-list
Re: scope of variable
On Aug 20, 8:25 pm, Chris Rebert c...@rebertia.com wrote: On Fri, Aug 20, 2010 at 11:09 AM, M B zna...@telia.com wrote: Hi, I try to learn python. I don't understand this: snip dept=0 snip def mud(): dept+=1 print dept mud() Traceback (most recent call last): File pyshell#7, line 1, in module mud() File pyshell#6, line 2, in mud dept+=1 UnboundLocalError: local variable 'dept' referenced before assignment Just put a global dept at the start of your function and it will work Rony -- http://mail.python.org/mailman/listinfo/python-list
Re: A question to experienced Pythoneers
On Fri, 20 Aug 2010 17:16:14 +0200, Bruno Desthuilliers wrote: Rony a écrit : It looks like I forgot to specify that the product is a totaly new product build from scratch, not an upgrade from an existing product. Still the advice to first find out what went wrong with the previous project is a very sensible one. Technical problems do exist, but from experience they rarely are the main source of failure. And be sure to look into the estimation and costing methods the company is using. IOW are you sure whether design/build/test phases are overrunning a sensible estimate or if the initial costing and estimation is underestimating the project size? -- martin@ | Martin Gregorie gregorie. | Essex, UK org | -- http://mail.python.org/mailman/listinfo/python-list
Re: urllib quote problem
On 8/20/2010 8:41 AM, Aahz wrote: In article4c5eef7f$0$1609$742ec...@news.sonic.net, John Naglena...@animats.com wrote: This looks like code that will do the wrong thing in Python 2.6 for characters in the range 128-255. Those are illegal in type str, but this code is constructing such values with chr. WDYM illegal? Type str in Python 2.6 is ASCII, 0..127. John Nagle -- http://mail.python.org/mailman/listinfo/python-list
Re: Looking for an appropriate encoding standard that supports all languages
On 8/20/2010 9:07 AM, Rami Chowdhury wrote: On Fri, Aug 20, 2010 at 21:02, ata.jafa.j.romani...@gmail.com wrote: On Aug 19, 11:48 am, Steven D'Apranosteve-REMOVE- t...@cybersource.com.au wrote: On Thu, 19 Aug 2010 01:29:51 -0700, ata.jaf wrote: On Aug 17, 11:55 pm, Thomas Jollanstho...@jollybox.de wrote: Yes I have a source code encoding line. Here it is: # -*- coding: utf_16 -*- Try utf_8. I am using WxPython. And the error that I get about using utf-16 is:\ Traceback (most recent call last): File stdin, line 1, inmodule File z.py, line 2 SyntaxError: UTF-16 stream does not start with BOM Which encoding are you saving your script in? Very few of the text editors I've used save to UTF-16 by default. Most editors that will do Unicode save files as utf-8. Try that. John Nagle -- http://mail.python.org/mailman/listinfo/python-list
Re: Looking for an appropriate encoding standard that supports all languages
On Thursday 19 August 2010, it occurred to ata.jaf to exclaim: On Aug 17, 11:55 pm, Thomas Jollans tho...@jollybox.de wrote: On Tuesday 17 August 2010, it occurred to ata.jaf to exclaim: I am developing a little program in Mac with wxPython. But I have problems with the characters that are not in ASCII. Like some special characters in French or Turkish. So I am looking for a way to solve this. Like an encoding standard that supports all languages. Or some other way. Anything that supports all of Unicode will do. Like UTF-8. If your text is mostly Latin, then just go for UTF-8, if you use other alphabets extensively, you might want to consider UTF-16, which might the use a little less space. OK, I used UTF-8. I write a line of strings in the source code and I want my program to show that as an output on GUI. And this line of strings includes a character like ü. But I see that in GUI this character is replaced with another strange characters. I mean it doesn't work. And when I try to use UTF-16, I get an syntax error that declares UTF-16 stream does not start with BOM. I get the feeling you're not actually using the encoding you say you're using, or not telling every program involved what you're doing. 1. Save the file in the correct encoding. Either tell your text editor to use a specific encoding (UTF-8 would be a good choice), or find out what encoding your text editor is using and use that encoding during the rest of the process. 2. Tell Python which encoding you're using. The coding: line will do the trick, *provided* you don't lie, and the encoding your specify in the file is actually the encoding you're using to store the file on disk. 3. Instruct your GUI library to do the right thing. If you use unicode strings (either by using Python 3 or by using the uKäse syntax in Python 2), that should be enough, otherwise, if you're using byte strings, which you shouldn't be doing in this case, you might have to tell the library what you're doing, or use the customary encoding. (For GTK+, this is UTF-8. For other libraries, it might be Latin-1, or system-dependent) -- http://mail.python.org/mailman/listinfo/python-list
Re: urllib quote problem
On 8/20/10 1:50 PM, John Nagle wrote: On 8/20/2010 8:41 AM, Aahz wrote: In article4c5eef7f$0$1609$742ec...@news.sonic.net, John Naglena...@animats.com wrote: This looks like code that will do the wrong thing in Python 2.6 for characters in the range 128-255. Those are illegal in type str, but this code is constructing such values with chr. WDYM illegal? Type str in Python 2.6 is ASCII, 0..127. In Python 2.6, type str is comprised of bytes 0..255, not ASCII characters. -- Robert Kern I have come to believe that the whole world is an enigma, a harmless enigma that is made terrible by our own mad attempt to interpret it as though it had an underlying truth. -- Umberto Eco -- http://mail.python.org/mailman/listinfo/python-list
Re: [ANN]VTD-XML 2.9
On Thu, 2010-08-19 at 17:40 -0700, dontcare wrote: VTD-XML 2.9, the next generation XML Processing API for SOA and Cloud computing, has been released. Please visit https://sourceforge.net/projects/vtd-xml/files/ to download the latest version. * Strict Conformance # VTD-XML now fully conforms to XML namespace 1.0 spec * Performance Improvement # Significantly improved parsing performance for small XML files * Expand Core VTD-XML API # Adds getPrefixString(), and toNormalizedString2() * Cutting/Splitting # Adds getSiblingElementFragment() * A number of bug fixes and code enhancement including: # Fixes a bug for reading very large XML documents on some platforms # Fixes a bug in parsing processing instruction # Fixes a bug in outputAndReparse() So, correct me if I'm wrong, but it doesn't look like this project even has a python version. So, why is it on the python-announce list? -- John Krukoff Land Title Guarantee Company jkruk...@ltgc.com -- http://mail.python.org/mailman/listinfo/python-list
Re: urllib quote problem
John Nagle wrote: On 8/20/2010 8:41 AM, Aahz wrote: In article4c5eef7f$0$1609$742ec...@news.sonic.net, John Naglena...@animats.com wrote: This looks like code that will do the wrong thing in Python 2.6 for characters in the range 128-255. Those are illegal in type str, but this code is constructing such values with chr. WDYM illegal? Type str in Python 2.6 is ASCII, 0..127. Actually 'str' in Python 2.6 is bytestring, or ASCII + other characters, by which I mean that the other characters aren't affected by .lower, etc. -- http://mail.python.org/mailman/listinfo/python-list
Re: scope of variable
M B zna...@telia.com writes: Hi, dept=0 def mud(): print dept mud() 0 def mud(): dept+=1 print dept You should add a global statement or else python thinks a variable used is a local: def mud(): global dept dept+=1 print dept -- Burton Samograd -- http://mail.python.org/mailman/listinfo/python-list
How to Customize the New 2.7 ArgumentParser Library Class (module argparse)?
I have converted from OptionParser to ArgumentParser (new in version 2.7) to great advantage, and I think it's a great improvement! But now I want to customize the help formatting just a bit. The documentation is sketchy here, but I started by subclassing ArgumentParser and attempted to redefine format_usage, but after looking at the detailed instructions with pydoc I see the API of the formatter objects is still considered an implementation detail. I take that to mean I should abandon such efforts at the moment. So, using the defined class as is, and following instructions in the online docs, I have been able to get my output to look like this: == $ test_argparser.py -h usage: test_argparser.py [options] A program to manipulate user programs. optional arguments: -h, --help Show this help message and exit. -v, --version Show program's version number and exit. -s, --show Show a list of user post-processing programs. Version 2010-08-20.01 == To beautify things I would like to change two strings which are auto-generated by the standard parser: 1. change usage: to Usage: # capitalize 'usage' 2. change optional arguments: to Optional arguments: # capitalize 'Optional' Does anyone know how to do it without modifying source code? Thanks, -Tom Thomas M. Browder, Jr. Niceville, Florida USA -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
On Aug 20, 11:19 am, geremy condra debat...@gmail.com wrote: Not sure what you read, but for me (mostly number theory, numerical analysis, and abstract algebra) zero-based indexing is quite common. My background is in aerospace control engineering. I am certainly not familiar with the literature in pure mathematics, but I assume that the math textbooks I used on college used standard mathematical notation. If one-based indexing is becoming more common in the literature, I'll bet that is only because it is so widely used in computer programming -- not because the writers decided independently that it is a better notation. But that's just a guess on my part. -- http://mail.python.org/mailman/listinfo/python-list
Re: How to convert bytearray into integer?
On Tuesday 17 August 2010, it occurred to Jacky to exclaim: On Aug 17, 3:38 am, Thomas Jollans tho...@jollybox.de wrote: On Monday 16 August 2010, it occurred to Jacky to exclaim: it's hard to image why socket object provides the interface: socket.recv_from(buf[, num_bytes[, flags]]) but forget the more generic one: socket.recv_from(buf[, offset[, num_bytes[, flags]]]) Well, that's what pointer arithmetic (in C) or slices (in Python) are for! There's an argument to be made for sticking close to the traditional (originally C) interface here - it's familiar. Hi Thomas, - I'm not quite follow you. It will be great if you could show me some code no this part... When I originally wrote that, I didn't check the Python docs, I just had a quick look at the manual page. This is the signature of the BSD-socket recv function: (recv(2)) ssize_t recv(int sockfd, void *buf, size_t len, int flags); so, to receive data into a buffer, you pass it the buffer pointer. len = recv(sock, buf, full_len, 0); To receive more data into another buffer, you pass it a pointer further on: len = recv(sock, buf+len, full_len-len, 0); /* or, this might be clearer, but it's 100% the same: */ len = recv(sock, buf[len], full_len-len, 0); Now, in Python. I assume you were referring to socket.recv_into: socket.recv_into(buffer[, nbytes[, flags]]) It's hard to imagine why this method exists at all. I think the recv method is perfectly adequate: buf = bytearray() buf[:] = sock.recv(full_len) # then: lngth = len(buf) buf[lngth:] = sock.recv(full_len - lngth) But still, nothing's stopping us from using recv_into: # create a buffer large enough. Oh this is so C... buf = bytearray([0]) * full_len lngth = sock.recv_into(buf, length_of_first_bit) # okay, now let's fill the rest ! sock.recv_into(memoryview(buf)[lngth:]) In C, you can point your pointers where ever you want. In Python, you can point your memoryview at buffers in any way you like, but there tend to be better ways of doing things. Cheers, Thomas -- http://mail.python.org/mailman/listinfo/python-list
Re: scope of variable
fre 2010-08-20 klockan 13:19 -0600 skrev Burton Samograd: M B zna...@telia.com writes: Hi, dept=0 def mud(): print dept mud() 0 def mud(): dept+=1 print dept You should add a global statement or else python thinks a variable used is a local: def mud(): global dept dept+=1 print dept -- Burton Samograd Ok. Thanks for the answers. :) I was a bit puzzled of the fact that I could read but not assign to a global variable. -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
On Fri, Aug 20, 2010 at 12:31 PM, Russ P. russ.paie...@gmail.com wrote: On Aug 20, 11:19 am, geremy condra debat...@gmail.com wrote: Not sure what you read, but for me (mostly number theory, numerical analysis, and abstract algebra) zero-based indexing is quite common. My background is in aerospace control engineering. I am certainly not familiar with the literature in pure mathematics, but I assume that the math textbooks I used on college used standard mathematical notation. If one-based indexing is becoming more common in the literature, I'll bet that is only because it is so widely used in computer programming -- not because the writers decided independently that it is a better notation. But that's just a guess on my part. I can't speak for the motivation for selecting that notation, but I'm not sure it matters anyway- if the rationale for a switch is to become consistent with mathematical notation and the 0-based indexing is becoming a common notation in that field then we achieve consistency by standing still. Geremy Condra -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
John Nagle na...@animats.com writes: Python does not do tail recursion, so using recursion where iteration could do the job is generally a bad idea. Scheme, on the other hand, always does tail recursion where possible. I think you mean tail recursion optimization / elimination. Python does tail recursion: def x(n): ... if n == 10: return ... print n ... x(n + 1) ... x(1) 1 2 3 4 5 6 7 8 9 -- John Bokma j3b Blog: http://johnbokma.com/Facebook: http://www.facebook.com/j.j.j.bokma Freelance Perl Python Development: http://castleamber.com/ -- http://mail.python.org/mailman/listinfo/python-list
Re: How to Customize the New 2.7 ArgumentParser Library Class (module argparse)?
Tom Browder wrote:
I have converted from OptionParser to ArgumentParser (new in version
2.7) to great advantage, and I think it's a great improvement! But
now I want to customize the help formatting just a bit.
The documentation is sketchy here, but I started by subclassing
ArgumentParser and attempted to redefine format_usage, but after
looking at the detailed instructions with pydoc I see the API of the
formatter objects is still considered an implementation detail.
I take that to mean I should abandon such efforts at the moment.
So, using the defined class as is, and following instructions in the
online docs, I have been able to get my output to look like this:
==
$ test_argparser.py -h
usage: test_argparser.py [options]
A program to manipulate user programs.
optional arguments:
-h, --help Show this help message and exit.
-v, --version Show program's version number and exit.
-s, --show Show a list of user post-processing programs.
Version 2010-08-20.01
==
To beautify things I would like to change two strings which are
auto-generated by the standard parser:
1. change usage:
to Usage: # capitalize 'usage'
2. change optional arguments:
to Optional arguments: # capitalize 'Optional'
Does anyone know how to do it without modifying source code?
You can use internationalization via
http://docs.python.org/library/gettext.html
or take a shortcut:
$ cat tmp.py
lookup = {
usage: : Usage: ,
optional arguments: Optional arguments}
def gettext(s):
return lookup.get(s, s)
import argparse
argparse._ = gettext
if __name__ == __main__:
p = argparse.ArgumentParser()
p.parse_args()
$ python tmp.py -h
Usage: tmp.py [-h]
Optional arguments:
-h, --help show this help message and exit
Peter
--
http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 18, 6:23 pm, Standish P stnd...@gmail.com wrote: On Aug 17, 6:38 pm, John Passaniti john.passan...@gmail.com wrote: You asked if Forth borrowed lists from Lisp. It did not. In Lisp, lists are constructed with pair of pointers called a cons cell. That is the most primitive component that makes up a list. Forth has no such thing; in Forth, the dictionary (which is traditionally, but not necessarily a list) is a data structure that links to the previous word with a pointer. Would you show me a picture, ascii art or whatever for Forth ? I know what lisp lists look like so I dont need that for comparison. Forth must have a convention and a standard or preferred practice for its dicts. However, let me tell you that in postscript the dictionaries can be nested inside other dictionaries and any such hiearchical structure is a nested associative list, which is what linked list, nested dictionaries, nested tables are. You can see an example of lists in my novice package (in the list.4th file): http://www.forth.org/novice.html Also in there is symtab, which is a data structure intended to be used for symbol tables (dictionaries). Almost nobody uses linked lists for the dictionary anymore (the FIG compilers of the 1970s did, but they are obsolete). I must say, I've read through this entire thread and I didn't understand *anything* that *anybody* was saying (especially the OP). I really recommend that people spend a lot more time writing code, and a lot less time with all of this pseudo-intellectual nonsense. This whole thread (and most of what I see on C.L.F. these days) reminds me of the dialectic method of the early Middle Ages --- a lot of talk and no substance. Write some programs! Are we not programmers? -- http://mail.python.org/mailman/listinfo/python-list
Re: Reading the access attributes of directories in Windows
On Aug 20, 7:42 pm, Tim Golden m...@timgolden.me.uk wrote: On 20/08/2010 5:10 PM, vsoler wrote: On Aug 20, 5:10 pm, Tim Goldenm...@timgolden.me.uk wrote: To decode the permission bit-strings to vaguely meaningful names: code import os, sys from winsys import fs dacl = fs.file (sys.executable).security ().dacl for permission in dacl: print (d.trustee, (Inherited ) if d.inherited else ) for name in fs.FILE_ACCESS.names_from_value (d.access): print ( , name) /code TJG it seems as though the definition of d is missing in your last piece of code Whoops, changed tack mid-thingy. Try: dacl = ... for d in dacl: # .. as before Tim, I'am testing your library. I am mainly interested in knowing the access attributes of directories in the local(C:\) or shared unit(W:\) of my system. Using your script with 'c:\\' I get an error message saying... 'file exists but it is a directory' and I cannot go any further. Of course, the problem is that I am using fs.file when I should be using something different. Reading the doc I have found that I should be using os.walk(...), which works, but then I cannot use fs.file Could you please give me a hint as to what metghod I should be using? Thank you Vicente Soler -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 18, 6:13 pm, Standish P stnd...@gmail.com wrote: Mostly it had a snowball's chance because it was never picked up by the CS gurus who, AFAIK, never really took a serious look at it. Its quite possible that the criticism is unfair, but dont you think that in part some responsibility must be borne by your organization in not doing a good job of education ? ... She is quite humble. Take a look at this page, http://www.forth.com/resources/evolution/index.html That is actually pretty humorous; she managed to describe herself as a leading expert twice in a single short paragraph. LOL See! I do have a sense of humor! http://groups.google.com/group/comp.lang.forth/browse_thread/thread/4c4dba9135bcf03e/8086ee13095bf78c -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
Steven D'Aprano st...@remove-this-cybersource.com.au writes: On Thu, 19 Aug 2010 22:00:16 +, Martin Gregorie wrote: Recursion can be quite a trick to get your mind round at first Really? Do people actually find the *concept* of recursion to be tricky? Evidently so. It's folk wisdom that some adults find recursion an easy concept, and those people will find programming significantly easier; and the majority of people have a great deal of difficulty with recursion and so find programming correspondingly difficult. There is evidence that the phenomenon is at least significant and measurable URL:http://portal.acm.org/citation.cfm?id=53033. There is all manner of speculation as to what might cause this divide in capability, but precious little scientific research has been done on the differences between such people AFAICT. -- \ “Two possibilities exist: Either we are alone in the Universe | `\ or we are not. Both are equally terrifying.” —Arthur C. Clarke, | _o__) 1999 | Ben Finney -- http://mail.python.org/mailman/listinfo/python-list
make install DESTDIR
I am trying to install python with make install DESTDIR=/home/blah ./python -E ./setup.py install \ --prefix=/ \ --install-scripts=//bin \ --install-platlib=//lib/python2.6/lib-dynload \ --root=//home/blah running install running build running build_ext INFO: Can't locate Tcl/Tk libs and/or headers Failed to find the necessary bits to build these modules: _tkinter bsddb185 dl imageopsunaudiodev To find the necessary bits, look in setup.py in detect_modules() for the module's name. running build_scripts running install_lib creating /lib/python2.6 error: could not create '/lib/python2.6': Permission denied make: *** [sharedinstall] Error 1 -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
Hi Martin Thanks for your post. This basic but fundamental computation is a great example when trying to understand the concept of recursion for the first time. Also thanks to John for the stackoverflow link where i found a very good summarised definition completing some of the posts left here. For future readers of this post who want to learn to programm (just like myself) let me re-state the basics i have learned now: - a procedure is said to be recursive when it contains a statement that calls itself - there must be a condition where the recursion has to stop otherwise the routine will continue to call itself infinitely. This is called the Base Case - every time the procedure calls itself the memory gradually fills up with the copies until the whole thing winds down again as the return statements start being executed. - the above point means that a recursive approach is expensive on resources so in the practical world it should be avoided. (Thanks John for giving me a real life example where recursion is recommended) For the purposes of learning programming i think it's a must to understand Recursion so thanks all for your help! Ok so now i hope you all agree that my code is also correct :) def r_countSubStringMatch(target,key): counter=0 if len(key)len(target): fsi=target.find(key) if fsi!=-1: # BASE CASE counter=1+r_countSubStringMatch(target[fsi+1:],key) return counter else: return counter elif len(key)==len(target): if key==target: counter+=1 return counter else: return counter return counter print r_countSubStringMatch(atgacatgcacaagtatgcat,atgc) tnx Baba -- http://mail.python.org/mailman/listinfo/python-list
Re: make install DESTDIR
On Saturday 21 August 2010, it occurred to aj to exclaim: I am trying to install python with make install DESTDIR=/home/blah --prefix=/ ... creating /lib/python2.6 error: could not create '/lib/python2.6': Permission denied make: *** [sharedinstall] Error 1 Obviously, the flags you specified didn't have the effect you intended. --prefix=$HOME should do the trick. -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On Aug 19, 11:00 pm, Martin Gregorie mar...@address-in-sig.invalid wrote: By way of a hint, here are two versions of the classic example of recursion: calculating factorials. Recursion can be quite a trick to get your mind round at first, so compare the two and follow through their operation step by step... Hi Martin Thanks for your post. This basic but fundamental computation (calculating factorials) is a great example when trying to understand the concept of recursion for the first time. Also thanks to John for the stackoverflow link where i found a very good summarised definition completing some of the posts left here. For future readers of this post who want to learn to programm (just like myself) let me re-state the basics i have learned now: - a procedure is said to be recursive when it contains a statement that calls itself - there must be a condition where the recursion has to stop otherwise the routine will continue to call itself infinitely. This is called the Base Case - every time the procedure calls itself the memory gradually fills up with the copies until the whole thing winds down again as the return statements start being executed. - the above point means that a recursive approach is expensive on resources so in the practical world it should be avoided. (Thanks John for giving me a real life example where recursion is recommended) For the purposes of learning programming i think it's a must to understand Recursion so thanks all for your help! Ok so now i hope you all agree that my code is also correct :) def r_countSubStringMatch(target,key): counter=0 if len(key)len(target): fsi=target.find(key) if fsi!=-1: # BASE CASE counter=1+r_countSubStringMatch(target[fsi+1:],key) return counter else: return counter elif len(key)==len(target): if key==target: counter+=1 return counter else: return counter return counter print r_countSubStringMatch(atgacatgcacaagtatgcat,atgc) tnx Baba -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On Saturday 21 August 2010, it occurred to Baba to exclaim: - every time the procedure calls itself the memory gradually fills up with the copies until the whole thing winds down again as the return statements start being executed. - the above point means that a recursive approach is expensive on resources so in the practical world it should be avoided. (Thanks John for giving me a real life example where recursion is recommended) This is only partly true. In most programming languages typical today, this is true: each recursion is a normal function call which allocates space on the stack. Thus, the maximum recursion depth is severely limited. However, in most functional programming languages, recursion is recognized as a highly expressive, powerful, and idiomatic tool that can often be optimized. Languages like haskell or scheme compile tail-end recursive functions in a manner that is just as efficient as a loop would have been. In general, if you could rewrite a recursive scheme function to use a loop, then a decent scheme compiler will be able to do it for you behind the scenes. -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Lawrence D'Oliveiro wrote: That is not some kind of ordinal numbering of the terms, that is the power of the variable involved. It's both. Convention is to make the power and the index of the coefficent the same, because it would be pointlessly confusing to do anything else. -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Martin Gregorie wrote:
On Mon, 16 Aug 2010 12:33:51 +1200, Gregory Ewing wrote:
Ian Kelly wrote:
On Fri, Aug 13, 2010 at 11:53 AM, Martin Gregorie
mar...@address-in-sig.invalid wrote:
real sample[-500:750];
Ugh, no. The ability to change the minimum index is evil.
Not always; it can have its uses, particularly when you're using the
array as a mapping rather than a collection.
Say you have intensity data captured from an X-ray goniometer from 160
degrees to 30 degrees at 0.01 degree resolution. Which is most evil of
the following?
1) real intensity[16000:3000]
for i from lwb intensity to upb intensity
plot(i/100, intensity[i]);
2) double angle[13000];
double intensity[13000];
for (int i = 0; i 13000; i++)
plot(angle[i], intensity[i]);
3) struct
{
double angle;
double intensity
} measurement;
measurement m[13000];
for (int i = 0; i 13000; i++)
plot(m[i].angle, m[i].intensity);
4) double intensity[13000];
for (int i = 0; i 13000; i++)
plot((16000 - i)/100, intensity[i])
To my mind (1) is much clearer to read and far less error-prone to write,
while zero-based indexing forces you to use code like (2), (3) or (4),
all of which obscure rather than clarify what the program is doing.
This might be true if the only thing you ever do with your
indices is use them to iterate over the array. However, if
you need to do any arithmetic with them, you may find yourself
thinking again.
Also, in Python you wouldn't write iteration loops that way
in the first place. You would write things such as
for x, y in zip(angle, intensity):
plot(x, y)
which avoids dealing with indexes altogether. The only time
you really need to use indexes in Python is when you want to
do arithmetic with them, or take slices, both of which turn
out to be less confusing most of the time with 0-based indexing.
--
Greg
--
http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Robert Kern wrote: On 8/16/10 9:29 PM, Roy Smith wrote: In articlei4cqg0$ol...@lust.ihug.co.nz, Lawrence D'Oliveirol...@geek-central.gen.new_zealand wrote: In messageroy-ee1b7f.21001716082...@news.panix.com, Roy Smith wrote: 5) real intensity[160.0 : 30.0 : 0.01] How many elements in that array? c) neither of the above. More specifically, 13,001 (if I counted correctly). 13000, actually. Floating point is a bitch. Or 12999.999 if you're unlucky. Floating point is a *real* bitch! -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
J.B. Brown wrote: Then users of my class (mainly my research lab coworkers) could specify whichever behavior they wanted. In terms of providing readable code and removing beginning programmer confusion, But having some arrays indexed from 0 and others from 1 can be a recipe for confusion in its own right. -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Iterative vs. Recursive coding
On Fri, 20 Aug 2010 16:22:44 -0700, Baba wrote: For the purposes of learning programming i think it's a must to understand Recursion so thanks all for your help! That depends on the language and/or hardware. COBOL wouldn't understand recursion if hit on the head with a recursion brick and early computer hardware (those without a stack) made it VERY hard work. If you don't follow this, look at the CODASYL language specification for COBOL or the hardware design of ICL 1900 or IBM System/360 mainframes (which are still the heart of the financial world) and work out how to implement a recursive function for any of them. Its not easy but it can be done. Ok so now i hope you all agree that my code is also correct :) Yes: it runs and does what I'd expect. A good result. A basic skill for a programmer is to understand the specification for a piece of code and write test cases. This is a set of inputs (both expected/sensible and totally out of order) and the expected outputs from each set of inputs. Then you write the code and run it against the test cases to show that it does what the specification requires. Never bullshit yourself or anybody else about this conformance to spec: either you screwed up or, hopefully less often, the designer wrote an ambiguous or plain wrong requirement. Either way, the problem must be resolved and the code be made to do what is wanted. while (results don't match the spec): Rince, wash, repeat. -- martin@ | Martin Gregorie gregorie. | Essex, UK org | -- http://mail.python.org/mailman/listinfo/python-list
Re: make install DESTDIR
On Aug 20, 4:39 pm, Thomas Jollans tho...@jollybox.de wrote: On Saturday 21 August 2010, it occurred to aj to exclaim: I am trying to install python with make install DESTDIR=/home/blah --prefix=/ ... creating /lib/python2.6 error: could not create '/lib/python2.6': Permission denied make: *** [sharedinstall] Error 1 Obviously, the flags you specified didn't have the effect you intended. --prefix=$HOME should do the trick. The whole point of DESTDIR is that it should be prepended to all installed paths, but the binaries should not contain any references to it.DESTDIR is commonly used by packagers, for example, to allow installation without superuser privileges. -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Martin Braun wrote: Another thing worth mentioning (I guess here is a good a place as any other) is the fact that programming and mathematics are still pretty different things, despite how much we programmers would like to think ourselves as some kind of mathematician. Although when it comes to indexing, mathematics and programming have remarkably similar issues. I've seen mathematics texts that made a poor choice of index base and ended up with formulas confusingly littered with plus and minus ones, or where I've had to scratch my head a few times and look back to find out whether a particular index was meant to start from 0 or 1. Also it doesn't help that the sigma notation lends itself more to closed than half-open intervals, which can lead to a Hobson's choice between i-1 in the formulas and n-1 in the summation range. -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Python why questions
Russ P. wrote: It all boils down to personal preference, but I just find it strange that we would not try to make programming as consistent as possible with notational conventions in the literature. It doesn't matter how much mathematical convention you quote, your assertion that 1-based indexing is better won't convince me, because it flies in the face of my own personal experience. The zero-based indexing just seemed wrong to me when I first saw it. I'm used to it by now, but it still doesn't seem quite right to me. It's almost right -- but it's off by one. I still have a habit of taking the 1 element when I really want the 0 element. That may be because you haven't fully adopted 0-based indexing into your thinking. You're trying to think in terms of 1-based indexes and convert to 0-based when you code. If you think in 0-based indexes in the first place, many things become simpler. -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Pop return from stack?
bvdp wrote: The whole problem I was having is that I was trying to tie a small application (an helper to the main application) to use a bit of the existing code as a pseudo-library. This is precisely the reason that it's a bad idea to directly terminate the program from somewhere deep inside the code. It makes it hard to re-use the code in another context. It's much better to raise an exception containing an appropriate error message, catch it at the top level of the application and print the message and exit there. Then you can easily re-use any of the code in a context where it's not appropriate to have it exit out from under you. -- Greg -- http://mail.python.org/mailman/listinfo/python-list
Re: Simple Python Sandbox
On 8/16/10 7:01 AM, Roland Koebler wrote: On Sat, Aug 14, 2010 at 08:01:00PM -0700, Stephen Hansen wrote: As you can see, black listing isn't the best approach here. But I have a two pronged strategy: the black list is only half of the equation. One, I'm blacklisting all the meta functions out of builtins. But blacklists are *never* secure. Sorry, but you should fully understand this before even thinking about more detailed security. And whitelists are never secure, either. There is no such thing as perfectly secure, no. But that is not a goal that I've set for this at all. There's more secure, less secure, more likely to provide a vector for attack, less likely to provide a vector for attack. Every security precaution does end up having a cost: every one weakens the resulting environment or makes something someone wants to do legitimately more hard. Security is always a trade off. The goal is secure enough -- and what 'enough' is is going to vary a lot depending on different people's needs. If I were in a situation where I'm executing arbitrary code gathered off of the 'net, that'd be a very different demand and I'd be a lot more keen on finding a perfect sand box (and thus would simply not use Python). That isn't the case here; my relatively untrusted users are uniquely and specifically identifyable and trackable, their interface to the system is logged and actions recorded. There's no money involved in this system, nor possibility that someone could use it to get higher tier access on the parent machine: if someone gets through the sandbox, it'll be a nuisance, hurt some people's enjoyment, harm a community, but really-- it should be able to be fixed pretty rapidly, and then that person utterly locked out. I just want a sandbox that is good enough that it'd be really hard for someone to do that. That's all. Minimize how many times I have to go fix up something. :) Why are you blacklisting the known-bad functions instead of whitelising the allowed ones?? Because that would annoy some of the other users, who think the status quo isn't really all that bad and that I'm paranoid :) Me, I'm going to go farther on my own installation and kill import entirely, and do a sort of require() which returns a special proxied version of an imported module only if its on a pre-allowed white-list, and even then each individual member of said module will have to be white-listed specifically, too. But in general, I just want a better sandbox that starts things off without getting in anyone's way to do totally legitimate sorts of things. -- Stephen Hansen ... Also: Ixokai ... Mail: me+list/python (AT) ixokai (DOT) io ... Blog: http://meh.ixokai.io/ signature.asc Description: OpenPGP digital signature -- http://mail.python.org/mailman/listinfo/python-list
Re: Problem with tarfile module to open *.tar.gz files - unreliable ?
On Aug 20, 12:55 pm, Peter Otten __pete...@web.de wrote: m_ahlenius wrote: I am using Python 2.6.5. Unfortunately I don't have other versions installed so its hard to test with a different version. As for the log compression, its a bit hard to test. Right now I may process 100+ of these logs per night, and will get maybe 5 which are reported as corrupt (typically a bad CRC) and 2 which it reported as a bad tar archive. This morning I checked each of the 7 reported problem files by manually opening them with tar -xzvof and they were all indeed corrupt. Sign. So many corrupted files? I'd say you have to address the problem with your infrastructure first. Unfortunately due to the nature of our business, I can't post the data files online, I hope you can understand. But I really appreciate your suggestions. The thing that gets me is that it seems to work just fine for most files, but then not others. Labeling normal files as corrupt hurts us as we then skip getting any log data from those files. appreciate all your help. I've written an autocorruption script, import sys import subprocess import tarfile def process(source, dest, data): for pos in range(len(data)): for bit in range(8): new_data = data[:pos] + chr(ord(data[pos]) ^ (1bit)) + data[pos+1:] assert len(data) == len(new_data) out = open(dest, w) out.write(new_data) out.close() try: t = tarfile.open(dest) for f in t: t.extractfile(f) except Exception, e: if 0 == subprocess.call([tar, -xf, dest]): return pos, bit if __name__ == __main__: source, dest = sys.argv[1:] data = open(source).read() print process(source, dest, data) and I can indeed construct an archive that is rejected by tarfile, but not by tar. My working hypothesis is that the python library is a bit stricter in what it accepts... Peter Thanks - that's cool. A friend of mine was suggesting that he's seen similar behaviour when he uses Perl on these types of files when the OS (Unix) has not finished writing them. We have an rsync process which sync's our servers for these files and then come down somewhat randomly. So its conceivable I think that this process could be trying to open a file as its being written. I know it sounds like a stretch but my guess is that its a possibility. I could verify that with the timestamps of the errors in my log and the mod time on the original file. 'mark -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 20, 6:51 pm, Hugh Aguilar hughaguila...@yahoo.com wrote: You can see an example of lists in my novice package (in the list.4th file):http://www.forth.org/novice.html Also in there is symtab, which is a data structure intended to be used for symbol tables (dictionaries). Almost nobody uses linked lists for the dictionary anymore (the FIG compilers of the 1970s did, but they are obsolete). Thanks for pointing this out, Hugh. After reading the code in your novice package and symtab, I am confused: With code of that caliber and the obvious stunning intellect behind it, why hasn't everyone adapted your awesome symtab for symbol tables instead? Any why hasn't there been an effort to translate symtab into other languages so users outside of Forth can also experience the sheer speed and hyper- efficient use of memory and CPU? Let me say I find it refreshing that a great programmer like yourself doesn't bother with stupid fads like testing algorithms against large data sets and measuring performance relative to competitive algorithms. That's all academic nonsense. The only test and measurement anyone needs are the comments at the top of symtab where you state your algorithm is better. You clearly wouldn't have written that if it wasn't true. Write some programs! Are we not programmers? Amen! All this academic talk is useless. Who cares about things like the big-O notation for program complexity. Can't people just *look* at code and see how complex it is?! And take things like the years of wasted effort computer scientists have put into taking data structures (like hashes and various kinds of trees) and extending them along various problem domains and requirements. Real programmers don't waste their time with learning that junk. What good did any of that ever do anyone?! Thanks Hugh for a refreshing stance on what it means to be a programmer. -- http://mail.python.org/mailman/listinfo/python-list
Re: 79 chars or more?
In message mailman.2230.1282037319.1673.python-l...@python.org, Jean-Michel Pichavant wrote: Saying that, if one intend to distribute its code, he should stick to 80 chars per line. Why? -- http://mail.python.org/mailman/listinfo/python-list
OI VEY, I AGREE -was once [Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?]
John Passaniti wrote: On Aug 20, 6:51 pm, Hugh Aguilarhughaguila...@yahoo.com wrote: You can see an example of lists in my novice package (in the list.4th file):http://www.forth.org/novice.html Also in there is symtab, which is a data structure intended to be used for symbol tables (dictionaries). Almost nobody uses linked lists for the dictionary anymore (the FIG compilers of the 1970s did, but they are obsolete). Thanks for pointing this out, Hugh. After reading the code in your novice package and symtab, I am confused: With code of that caliber and the obvious stunning intellect behind it, why hasn't everyone adapted your awesome symtab for symbol tables instead? Any why hasn't there been an effort to translate symtab into other languages so users outside of Forth can also experience the sheer speed and hyper- efficient use of memory and CPU? Let me say I find it refreshing that a great programmer like yourself doesn't bother with stupid fads like testing algorithms against large data sets and measuring performance relative to competitive algorithms. That's all academic nonsense. The only test and measurement anyone needs are the comments at the top of symtab where you state your algorithm is better. You clearly wouldn't have written that if it wasn't true. Write some programs! Are we not programmers? Amen! All this academic talk is useless. Who cares about things like the big-O notation for program complexity. Can't people just *look* at code and see how complex it is?! And take things like the years of wasted effort computer scientists have put into taking data structures (like hashes and various kinds of trees) and extending them along various problem domains and requirements. Real programmers don't waste their time with learning that junk. What good did any of that ever do anyone?! Thanks Hugh for a refreshing stance on what it means to be a programmer. Never thought I I'd agree wholeheartedly with very verbose John. Hugh, you are complete idiot! (and other less complementary ...) -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 18, 8:05 pm, Elizabeth D Rather erat...@forth.com wrote: On 8/18/10 2:23 PM, Standish P wrote: On Aug 17, 6:38 pm, John Passanitijohn.passan...@gmail.com wrote: You asked if Forth borrowed lists from Lisp. It did not. In Lisp, lists are constructed with pair of pointers called a cons cell. That is the most primitive component that makes up a list. Forth has no such thing; in Forth, the dictionary (which is traditionally, but not necessarily a list) is a data structure that links to the previous word with a pointer. Would you show me a picture, ascii art or whatever for Forth ? I know what lisp lists look like so I dont need that for comparison. Forth must have a convention and a standard or preferred practice for its dicts. However, let me tell you that in postscript the dictionaries can be nested inside other dictionaries and any such hiearchical structure is a nested associative list, which is what linked list, nested dictionaries, nested tables are. You indicated that you have a copy of Forth Application Techniques. Sections 8.1 and 8.2 cover this topic, with some drawings. Can someone send me a scan copy of sec 8.1 to 8.2 within the exemption in the copyright law for my personal study and evaluation of the book only. I have only looked at the book cover on forth site and its table of contents on amazon. why elase would I ask where it is if I had a copy and would go directly to index assuming it has a good indexing. Alternative, a link to an open source of explanation would be requested. -- http://mail.python.org/mailman/listinfo/python-list
Re: How far can stack [LIFO] solve do automatic garbage collection and prevent memory leak ?
On Aug 20, 3:51 pm, Hugh Aguilar hughaguila...@yahoo.com wrote: On Aug 18, 6:23 pm, Standish P stnd...@gmail.com wrote: On Aug 17, 6:38 pm, John Passaniti john.passan...@gmail.com wrote: You asked if Forth borrowed lists from Lisp. It did not. In Lisp, lists are constructed with pair of pointers called a cons cell. That is the most primitive component that makes up a list. Forth has no such thing; in Forth, the dictionary (which is traditionally, but not necessarily a list) is a data structure that links to the previous word with a pointer. Would you show me a picture, ascii art or whatever for Forth ? I know what lisp lists look like so I dont need that for comparison. Forth must have a convention and a standard or preferred practice for its dicts. However, let me tell you that in postscript the dictionaries can be nested inside other dictionaries and any such hiearchical structure is a nested associative list, which is what linked list, nested dictionaries, nested tables are. You can see an example of lists in my novice package (in the list.4th file):http://www.forth.org/novice.html Also in there is symtab, which is a data structure intended to be used for symbol tables (dictionaries). Almost nobody uses linked lists for the dictionary anymore (the FIG compilers of the 1970s did, but they are obsolete). I must say, I've read through this entire thread and I didn't understand *anything* that *anybody* was saying (especially the OP). You didnt understand anything because no one explained anything coherently. Admittedly, I am asking a question that would be thought provoking to those who claim to be experts but these experts are actually very stingy and mean business people, most certainly worse than Bill Gates, only it did not occur to them his ideas and at the right time. I really recommend that people spend a lot more time writing code, and a lot less time with all of this pseudo-intellectual nonsense. You have to have a concept to write code. This whole thread (and most of what I see on C.L.F. these days) reminds me of the dialectic method of the early Middle Ages --- a lot of talk and no substance. Write some programs! Are we not programmers?- Hide quoted text - - Show quoted text - -- http://mail.python.org/mailman/listinfo/python-list
