Re: [R] Postscript graphs
On Mon, 2010-01-25 at 14:05 -0800, Lu Wang wrote: Hi, I tried to use the following commands to create a postscript pie chart using R: postscript(file=H:/piechart.eps) # then I wrote my commands to generate the pie chart pie(filename,labels=,col=,radius=0.6) dev.off() After I ran those commands, instead of giving the pie chart, it showed dev.off() postscript 2 In my H drive, there is a file called piechart.eps, but I want to look at it. Is there any way I can see the figure and import it to word or pdf file? I am writing a paper that needs this graph. It would be more helpful If I can see it. Word accepts eps files - did you try importing it? (It may look rubbish on screen as it displays a low-res preview of the figure and in my experience doesn't do a very good job on the preview, but it will print on a postscript printer at high quality, as it will on any printer when converted your word files is converted to PDF.) You also need to add some arguments to your postscript call to get EPS: postscript(file=H:/piechart.eps, height = X, width = Y, onefile = FALSE, paper = special) With X and Y your desired heights in inches. GSView is a application that also runs on Windows that allows you to open, view and convert postscript and EPS files. It requires the Ghostscript interpreter to be installed as well. How are you producing a pdf? Without knowing that it is difficult to say how to import your postscript figure into it. HTH G Thanks, John [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- %~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~% Dr. Gavin Simpson [t] +44 (0)20 7679 0522 ECRC, UCL Geography, [f] +44 (0)20 7679 0565 Pearson Building, [e] gavin.simpsonATNOSPAMucl.ac.uk Gower Street, London [w] http://www.ucl.ac.uk/~ucfagls/ UK. WC1E 6BT. [w] http://www.freshwaters.org.uk %~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~%~% __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R2WinBUGS/ trap
2010/1/26 Ben Bolker bol...@ufl.edu julien martin julemartin0320 at gmail.com writes: I am generating 1000 replicate data sets in R, each data set is then analyzed with WinBUGS in batch mode using R2WinBUGS. Unfortunately, occasionally some data sets lead WinBUGS to open a trap window; and the simulations are interrupted as result of the message. Is there any ways to set R2WinBUGS so that it would ignore the trap message and proceed with the simulations? I'm not sure -- I don't think so -- I don't remember if R hangs or returns an error on a trap -- but you could try (1) try() and (2) JAGS/R2jags A practical suggestion - run this in a loop, and save the output to a file at the end of each loop. Also, if you're getting several trap messages with 100 replicates, you might want to tweak the what you're doing. e.g. set up initial values close to the posterior, and make sure your priors aren't too vague. Bob -- Bob O'Hara Biodiversity and Climate Research Centre Senckenberganlage 25 D-60325 Frankfurt am Main, Germany Tel: +49 69 798 40216 Mobile: +49 1515 888 5440 WWW: http://www.RNI.Helsinki.FI/~boh/ Blog: http://network.nature.com/blogs/user/boboh Google Wave: rni@googlewave.com Journal of Negative Results - EEB: www.jnr-eeb.org [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Help
Dear All
I have data as follows.
D TM L
0.20 1 03 141
0.321 07 62
0.50 1 05 49
0.80 1 04 46
0.20 2 14 130
0.322 17 52
0.50 2 13 41
0.80 2 14 36
0.20 3 24 120
0.323 28 41
0.50 3 24 30
0.80 3 22 28
0.20 4 31 113
0.324 44 25
0.50 4 39 15
0.80 4 36 14
0.20 5 35 109
0.325 47 22
0.50 5 43 11
0.80 5 44 06
0.20 6 38 106
0.326 49 20
0.50 6 45 09
0.80 6 46 04
I want to fit a negative binomial regression model where M is the
required success and L is number of units to have the required
success.
I want to fit the following model
GLM link, log(1-M / (M+L)) = constant + theta 1 * log(D) + theta 2 *
1/T + theta 3 * log(D) * 1 / T
I wrote the function as
dat = read.table(N_d_t_F.txt,header=T)
N_D = 4
N_T = 6
dat$x= log(dat$D)
dat$p= dat$M / (dat$L+dat$M)
dat$InvT = 1/dat$T
dat$glm1= log(1-dat$p)
negloglike = function(parms, dat){
pp = design%*%parms
p= 1-exp(pp)
obj = 0
t_D = 0
for(d in 1:N_D){
for(t in 1:N_T){
t_D = t_D+1
obj = obj + dat$M[t_D]*log(p[t_D])
obj = obj + dat$L[t_D]*log(1-p[t_D])
}
}
-obj
}
design = cbind(1, dat$x, dat$InvT, dat$x*dat$InvT)
g = lm(glm1~design-1, dat, subset=c(p0))
mle.fit = optim(coef(g), negloglike,
dat=dat, hessian=T)
However, this function does not optimize properly. It always creates
some errors.
How can I optimize this model?
This is not a count data. That's why I can not use the function
glm.nb or aod package.
Would you please give me some suggestions so that I can optimize the
function?
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] StructTS hang?
On 25.01.2010 11:03, richard.kie...@rwe.com wrote: Hi! You have probably sorted out your problem a different way. However I have tried dealing with the same problem for a while and writing down the reason for this here may be of use to someone. In some other help-mail I read that time series objects behave unexpectedly in some situations if the frequency is too high. As a result of this, a call of StructTS (with seasonality) hangs if and only if the frequency is larger than 24 (if I remember the number right). This is what I found with my own time series using several frequencies. So, this may not be helpful using StructTS on a time series, but it may save somebody some time. Even better: report a reproducible example to the package maintainer who is certainly happy to fix bugs in the package. Best wishes, Uwe Ligges Regards, Richard Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] question on sqldf syntax
Maybe that's a problem with the RSQLite package , probably detaching the package help. detach(package:RSQLite) HTH, Christian trying to structure sql to merge two datasets. structure follows: dbs.possible.combos (all possible combinations of dates and places) Date Place 1/1/10 N-01 1/1/10 S-02 1/2/10 N-01 1/2/10 S-02 etc... dbs.aggregate (the raw data aggregated by date and location) Date Place Days 1/1/10 N-01 6 1/1/10 S-02 10 1/2/10 S-02 5 Trying to merge so I look-up the values for each possible combo dbs.final - sqldf(select dbs.possible.combos$Date, dbs.possible.combos$Place, dbs.possible.combos$Days FROM dbs.possible.combos LEFT JOIN dbs.aggregate ON (dbs.possible.combos$Place = dbs.aggregate$Place) AND (dbs.possible.combos$Date = dbs.aggregate$Date)) Resulting in: Error in sqliteExecStatement(con, statement, bind.data) : RS-DBI driver: (error in statement: near .: syntax error) What am I getting wrong in the syntax? __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R Output and ArcGIS
Dear all, Thanks for the replies so far. Just to emphasise, I'm not using Excel in any way. I have many many files to output, so it'd take considerable time to export from R, reprocess in Excel, then load into Arc! On a PC I'm able to go directly from R to ArcMap (9.3) without having to go via Excel. I've simply been viewing the data in Notepad, which was fine for observing the removal of the end-of-line characters and general format of the data (3 columns). My data are structured as follows: str(mrunoff) 'data.frame': 61538 obs. of 3 variables: $ Latitude : chr 5.75 6.25 6.75 7.25 ... $ Longitude: Factor w/ 720 levels 0.25,0.75,..: 1 1 1 1 1 1 1 1 1 1 ... $ Runoff : num 0.687 2.661 0 0 0 ... I can't use col.names=NA, as I do have column names! These are also required by Arc as identifiers. Also, as you can see, there are no complications in the variable names which, as you rightly say, can cause problems in Arc. If anyone has any further suggestions regarding how to overcome this problem of generating data from R on a Mac for input to ArcGIS on a PC, then I'd be very grateful to hear them. Many thanks again, Steve _ Got a cool Hotmail story? Tell us now __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] StructTS hang?
No problem! Working: z-ts(sin(1:1000), start=1, freq=10) x-StructTS(z, type='BSM') Hang: z-ts(sin(1:1000), start=1, freq=100) x-StructTS(z, type='BSM') (Both on WinXP, R 2.9.2) I don't, however, know who the package maintainer is, nor can I track down where exactly the hang is caused. Maybe somebody else can help me with that. Cheers, Richard Kiefer -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 10:32 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: [R] StructTS hang? On 25.01.2010 11:03, richard.kie...@rwe.com wrote: Hi! You have probably sorted out your problem a different way. However I have tried dealing with the same problem for a while and writing down the reason for this here may be of use to someone. In some other help-mail I read that time series objects behave unexpectedly in some situations if the frequency is too high. As a result of this, a call of StructTS (with seasonality) hangs if and only if the frequency is larger than 24 (if I remember the number right). This is what I found with my own time series using several frequencies. So, this may not be helpful using StructTS on a time series, but it may save somebody some time. Even better: report a reproducible example to the package maintainer who is certainly happy to fix bugs in the package. Best wishes, Uwe Ligges Regards, Richard Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Same y-axis on multiple plots?
On 01/26/2010 01:52 AM, Andreas Bergstrøm wrote: Greetings, I am attempting to use R throug PL/R in PostgreSQL to make several graphs (they show usage over time for radiochannels). However, as some never go above 100 in a 24 hour period, and others go well over 500, they get different y-axis values (which normally would be a good thing). However, as I want to overlay the graphs to add/remove channels in CSS on a webpage, I need a set y-axis. I have looked through the documentation, google and the mailinglist as ylim, setting xpd=F and modifying clip, plot.window, but I can't seem to find what I am looking for. I am certain that it is something simple, and would be gratefull if someone could point me in the right direction. Hi Andreas, I didn't see an answer to your question, so I'll suggest that you take these warnings seriously: Warning messages: 1: In plot.window(...) : ylim.max is not a graphical parameter 2: In plot.xy(xy, type, ...) : ylim.max is not a graphical parameter 3: In title(...) : ylim.max is not a graphical parameter and try this: plot(str,type=b,main=mymain,xlab=myxlab,ylab=myylab,lwd=2, axes=F,ylim=c(0,600)) as the plot command. Jim __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] [Fwd: Re: question on sqldf syntax]
Sorry mistake from me. This was another problem in my mind , but with RMySQL. Christian library(RMySQL) library(sqldf) sqldf(Select * from mtcars) Fehler in mysqlNewConnection(drv, ...) : RS-DBI driver: (Failed to connect to database: Error: Access denied for user 'user'@'localhost' (using password: NO) ) Fehler in if (dbname == :memory:) dbDisconnect(connection) else if (!dbPreExists : Argument hat Länge 0 detach(package:RMySQL) sqldf(Select * from mtcars) mpg cyl disp hp dratwt qsec vs am gear carb 1 21.0 6 160.0 110 3.90 2.620 16.46 0 144 2 21.0 6 160.0 110 3.90 2.875 17.02 0 144 3 22.8 4 108.0 93 3.85 2.320 18.61 1 141 4 21.4 6 258.0 110 3.08 3.215 19.44 1 031 5 18.7 8 360.0 175 3.15 3.440 17.02 0 032 . ---BeginMessage--- Maybe that's a problem with the RSQLite package , probably detaching the package help. detach(package:RSQLite) HTH, Christian trying to structure sql to merge two datasets. structure follows: dbs.possible.combos (all possible combinations of dates and places) Date Place 1/1/10 N-01 1/1/10 S-02 1/2/10 N-01 1/2/10 S-02 etc... dbs.aggregate (the raw data aggregated by date and location) Date Place Days 1/1/10 N-01 6 1/1/10 S-02 10 1/2/10 S-02 5 Trying to merge so I look-up the values for each possible combo dbs.final - sqldf(select dbs.possible.combos$Date, dbs.possible.combos$Place, dbs.possible.combos$Days FROM dbs.possible.combos LEFT JOIN dbs.aggregate ON (dbs.possible.combos$Place = dbs.aggregate$Place) AND (dbs.possible.combos$Date = dbs.aggregate$Date)) Resulting in: Error in sqliteExecStatement(con, statement, bind.data) : RS-DBI driver: (error in statement: near .: syntax error) What am I getting wrong in the syntax? ---End Message--- __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] StructTS hang?
On 26.01.2010 10:55, richard.kie...@rwe.com wrote: No problem! Working: z-ts(sin(1:1000), start=1, freq=10) x-StructTS(z, type='BSM') Hang: z-ts(sin(1:1000), start=1, freq=100) x-StructTS(z, type='BSM') (Both on WinXP, R 2.9.2) I don't, however, know who the package maintainer is, nor can I track down where exactly the hang is caused. Maybe somebody else can help me with that. Apologies, thought that code was from a contributed package rather than from the base distribution of R. In this case, and given the code, we should try to debug a little bit. My first impression is that it will take some time given experiments with smaller numbers it looks roughly exponential in runtime. I'll be off for a meeting now and will look at results in 1-2 hours (when I expect them to appear on my machine). Uwe Ligges Cheers, Richard Kiefer -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 10:32 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: [R] StructTS hang? On 25.01.2010 11:03, richard.kie...@rwe.com wrote: Hi! You have probably sorted out your problem a different way. However I have tried dealing with the same problem for a while and writing down the reason for this here may be of use to someone. In some other help-mail I read that time series objects behave unexpectedly in some situations if the frequency is too high. As a result of this, a call of StructTS (with seasonality) hangs if and only if the frequency is larger than 24 (if I remember the number right). This is what I found with my own time series using several frequencies. So, this may not be helpful using StructTS on a time series, but it may save somebody some time. Even better: report a reproducible example to the package maintainer who is certainly happy to fix bugs in the package. Best wishes, Uwe Ligges Regards, Richard Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R Output and ArcGIS
On Tue, Jan 26, 2010 at 11:42 AM, Steve Murray smurray...@hotmail.comwrote: Dear all, Thanks for the replies so far. Just to emphasise, I'm not using Excel in any way. I have many many files to output, so it'd take considerable time to export from R, reprocess in Excel, then load into Arc! On a PC I'm able to go directly from R to ArcMap (9.3) without having to go via Excel. I've simply been viewing the data in Notepad, which was fine for observing the removal of the end-of-line characters and general format of the data (3 columns). My data are structured as follows: str(mrunoff) 'data.frame':61538 obs. of 3 variables: $ Latitude : chr 5.75 6.25 6.75 7.25 ... $ Longitude: Factor w/ 720 levels 0.25,0.75,..: 1 1 1 1 1 1 1 1 1 1 ... $ Runoff : num 0.687 2.661 0 0 0 ... what about changing the class from Longitude and Latitude to numeric? This could probably solve the problem? I can't use col.names=NA, as I do have column names! These are also required by Arc as identifiers. Also, as you can see, there are no complications in the variable names which, as you rightly say, can cause problems in Arc. If anyone has any further suggestions regarding how to overcome this problem of generating data from R on a Mac for input to ArcGIS on a PC, then I'd be very grateful to hear them. In addition, as far as I know, Arc can read dbf and from R, you can export to dbf, via the package foreign - might be worth a try. Cheers, Rainer Many thanks again, Steve _ Got a cool Hotmail story? Tell us now __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- NEW GERMAN FAX NUMBER!!! Rainer M. Krug, PhD (Conservation Ecology, SUN), MSc (Conservation Biology, UCT), Dipl. Phys. (Germany) Centre of Excellence for Invasion Biology Natural Sciences Building Office Suite 2039 Stellenbosch University Main Campus, Merriman Avenue Stellenbosch South Africa Cell: +27 - (0)83 9479 042 Fax:+27 - (0)86 516 2782 Fax:+49 - (0)321 2125 2244 email: rai...@krugs.de Skype: RMkrug Google: r.m.k...@gmail.com [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Data Manipulation
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
+ }
+ )
[1] C:/ab/AccidentHealthInsurance.txt
Error in `[.data.frame`(a, , 3, drop = FALSE) :
undefined columns selected
Best,
Peter
--
View this message in context:
http://n4.nabble.com/Data-Manipulation-tp1018249p1290191.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Same y-axis on multiple plots?
On 26. jan. 2010, at 11:07, Jim Lemon wrote: On 01/26/2010 01:52 AM, Andreas Bergstrøm wrote: Hi Andreas, I didn't see an answer to your question, so I'll suggest that you take these warnings seriously: Warning messages: 1: In plot.window(...) : ylim.max is not a graphical parameter 2: In plot.xy(xy, type, ...) : ylim.max is not a graphical parameter 3: In title(...) : ylim.max is not a graphical parameter and try this: plot(str,type=b,main=mymain,xlab=myxlab,ylab=myylab,lwd=2, axes=F,ylim=c(0,600)) Thank you. I got two replies offlist where the gist was the same as your reply, and it now works. I see now that I don't get those warnings when I run R though pl/R in postgresql, so I'll try running it through the R binary next time I am stuck. Thank you for your assistance. -- Andreas Bergstrøm Østfold University College Dept. of Computer Sciences Tel: +47 69 21 53 71 http://media.hiof.no/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R-forge getting the wrong package
On Sun, Jan 24, 2010 at 10:09 AM, Barry Rowlingson b.rowling...@lancaster.ac.uk wrote: After accusing someone of typing 'install.packages(weather)' instead of 'install.packages(webmaps)', I discovered that R-forge really is currently returning the wrong source tarball for packages after 'Repitools' in the alphabet. I'm hypothesizing it's in the way the PACKAGES file is being constructed, but haven't tested that hypothesis yet - I'm sure the R-forge admins will fix this. Stefan Theussl has now fixed this, so if anyone wants to try install.packages(webmaps,repos=http://R-Forge.R-project.org;) they now can, without getting the 'weather' package installed instead. Barry __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Data Manipulation
Peter Rote wrote:
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
+ }
+ )
[1] C:/ab/AccidentHealthInsurance.txt
Error in `[.data.frame`(a, , 3, drop = FALSE) :
undefined columns selected
The message says that you haven't got three columns in a, so try
inserting print(dim(a)). Perhaps what you showed earlier was rownames
plus two columns?
--
O__ Peter Dalgaard Øster Farimagsgade 5, Entr.B
c/ /'_ --- Dept. of Biostatistics PO Box 2099, 1014 Cph. K
(*) \(*) -- University of Copenhagen Denmark Ph: (+45) 35327918
~~ - (p.dalga...@biostat.ku.dk) FAX: (+45) 35327907
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Data Manipulation
On 01/26/2010 09:15 PM, Peter Rote wrote:
I still struggling with this:
error massage:
by(AlexETF,AlexETF$Industry,function(a) {filename = paste(C:/ab/,gsub(
,,a$Industry[1]),.txt,sep=)
+ print(filename)
+ write.table(a[,3,drop=FALSE],quote=FALSE,col.names=FALSE,row.names=FALSE)
+ }
+ )
[1] C:/ab/AccidentHealthInsurance.txt
Error in `[.data.frame`(a, , 3, drop = FALSE) :
undefined columns selected
Hi Peter,
I would suggest that you print the first say 10 rows of a and see if
it has three columns.
Jim
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Two == expressions in bquote
You are rigth Bert. Thanks for the clarification. On Mon, Jan 25, 2010 at 7:00 PM, Bert Gunter gunter.ber...@gene.com wrote: I think that careful examination will show that Henrique's solution is not quite right: the text '=' character is slightly different than the symbol font character. This is admittedly nitpicking, but ... try instead: text(2,8,bquote(paste(delta==mu^2,phantom()==.(mu^2 Cheers, Bert Gunter Genentech Nonclinical Biostatistics -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On Behalf Of Henrique Dallazuanna Sent: Monday, January 25, 2010 12:10 PM To: Larry Hotchkiss Cc: r-help@r-project.org Subject: Re: [R] Two == expressions in bquote Try this: text(2,8, bquote(delta~'='~mu^2 == .(mu^2))) On Mon, Jan 25, 2010 at 6:00 PM, Larry Hotchkiss lar...@udel.edu wrote: Hi, I want to put text on a plot containing something like: a = b^2 = squared numeric value of b using bquote. Example: mu = 5 plot(1:10,1:10) text(2,8, bquote(delta == mu^2)) # This works text(2.5,8, bquote(phantom(0) == .(mu^2))) # but is unpredictable text(2,8, bquote(delta == mu^2 == .(mu^2))) # This doesn't work The last text function returns the error: Error: unexpected '==' in text(2,8, bquote(delta == mu^2 == The first two text functions work in this example, using a default graphics window on a 64-bit Windows machine, and either R 2.11.0 development edition for 64-bit Windows or R 9.2.2 on the same machine ((x 86)). I don't mind the two statements except that when trying to automate this by using the base x coordinate + epsilon*max(x), for example -- x - 1:10 epsilon=0.05 text(2+esilon*max(x),8, bquote(phantom(0) == .(mu^2))) for the x position on the 2nd text function, the position of the additional text is not predictable. Thanks, Larry Hotchkiss __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40 S 49° 16' 22 O __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40 S 49° 16' 22 O __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] StructTS hang?
Exponential, you say? Maybe I am just not patient enough. After being unresponsive for several minutes, which in the larger examples that I work with has probably appeared like a hang, the code I just mentioned has given a result (a convergence error, but still). So, I must say I can no longer reproduce the hang. I remember to be able to reproduce a significant change in behaviour upon the frequency passing some threshold. Maybe by chance, this threshold parting hang from normal operation agreed with a number someone claimed ts-objects could not handle properly. But I can't reproduce this now. I'm sorry... -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 11:15 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: AW: [R] StructTS hang? On 26.01.2010 10:55, richard.kie...@rwe.com wrote: No problem! Working: z-ts(sin(1:1000), start=1, freq=10) x-StructTS(z, type='BSM') Hang: z-ts(sin(1:1000), start=1, freq=100) x-StructTS(z, type='BSM') (Both on WinXP, R 2.9.2) I don't, however, know who the package maintainer is, nor can I track down where exactly the hang is caused. Maybe somebody else can help me with that. Apologies, thought that code was from a contributed package rather than from the base distribution of R. In this case, and given the code, we should try to debug a little bit. My first impression is that it will take some time given experiments with smaller numbers it looks roughly exponential in runtime. I'll be off for a meeting now and will look at results in 1-2 hours (when I expect them to appear on my machine). Uwe Ligges Cheers, Richard Kiefer -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 10:32 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: [R] StructTS hang? On 25.01.2010 11:03, richard.kie...@rwe.com wrote: Hi! You have probably sorted out your problem a different way. However I have tried dealing with the same problem for a while and writing down the reason for this here may be of use to someone. In some other help-mail I read that time series objects behave unexpectedly in some situations if the frequency is too high. As a result of this, a call of StructTS (with seasonality) hangs if and only if the frequency is larger than 24 (if I remember the number right). This is what I found with my own time series using several frequencies. So, this may not be helpful using StructTS on a time series, but it may save somebody some time. Even better: report a reproducible example to the package maintainer who is certainly happy to fix bugs in the package. Best wishes, Uwe Ligges Regards, Richard Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] AIC for comparing GLM(M) with (GAM(M)
Hello I'm analyzing a dichotomous dependent variable (dv) with more than 100 measurements (within-subjects variable: hours24) per subject and more than 100 subjects. The high number of measurements allows me to model more complex temporal trends. I would like to compare different models using GLM, GLMM, GAM and GAMM, basically do demonstrate the added value of GAMs/GAMMs relative to GLMs/GLMMs, by fitting splines. GLMMs/GAMMs are used to possibly improve fits from GLMs/GAMs by accounting for serial dependence. My idea is to use AIC to compare the different models. Ive noticed that when setting up two seemingly identical models using the two functions gam (of the package mgcv) and gamm4 (of the package with same name), the AIC turns out to be different: gam.0-gam(dv ~ s(hours24,fx=F,k=-1,bs=cc),method=ML,data=sdata, family=binomial) gamm.0-gamm4(dv ~ s(hours24,fx=F,k=-1,bs=cc),method=ML,data=sdata, family=binomial) Fit indices using the commands as shown are: logLik(gam.0)[1];deviance(gam.0);AIC(gam.0) logLik(gamm.0$mer);deviance(gamm.0$mer);attributes(summary(gamm. 0$mer))$AICtab[1] gam.0: logLik=1149.6, deviance=2299.3, AIC=2316.0 gamm.0: logLik=1169.0, deviance=2338.0, AIC=2342.0 The differences between the two AIC values seem to be based on two factors. First, gam uses the effective degrees of freedom sum(gam.0$edf) [1] 8.372517 whereas gamm4 uses the value 2. Second the two log-likelihood values already differ, probably because different estimation methods are used but here is were my understanding ends. In any case from gamm4 I can get the same value for the deviance as for gam by referring to the deviance slot: gamm.0$...@deviance[disc], which returns the value 2299.3, which is the deviance without compensation for the null deviance. My questions are: - Is my suggested method of comparing fits among GLM, GLMM, GAM and GAMM using AIC legitimate? Of course I will do additional model plotting using residuals etc. as well but it seems important to me to have a more direct method of comparing these models (Im aware of the fact that AIC is a rough estimate when it comes to generalized mixed models). - If so, how can I compute the AICs using gam and gamm4 such that they can be compared A) with each other and B) with AICs obtained from GLM/ GLMM? Any suggestions are welcome Andrea [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Formatting cgroup and factor level labels in Hmisc latex function
I'm trying to typeset at simple crosstable with the Hmisc latex function. And I have two problems. 1. How do I make all columns the same width? The Latex function seems very unwilling to break the 'cgroup' labels and the factor level labels. Please have look at this screenshot that shows my problem: http://hem.passagen.se/stpe9096/table.png So, how can I make sure that the cgroup labels and the factor level labels are sufficiently line breaked and/or hyphenated to make the columns evenly spaced? 2. Is there something like a 'widetable' package that can break a wide table into several tables with repeated 'rgroup' labels? As You can see in the screenshot, the table runs way off the page. And I know that there is a 'longtable' package that can do exactly this, but for tables with long rgroup lists. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] StructTS hang?
On 26.01.2010 11:52, richard.kie...@rwe.com wrote: Exponential, you say? Maybe I am just not patient enough. After being unresponsive for several minutes, which in the larger examples that I work with has probably appeared like a hang, the code I just mentioned has given a result (a convergence error, but still). So, I must say I can no longer reproduce the hang. I remember to be able to reproduce a significant change in behaviour upon the frequency passing some threshold. Maybe by chance, this threshold parting hang from normal operation agreed with a number someone claimed ts-objects could not handle properly. But I can't reproduce this now. I'm sorry... Right, your example takes roughly 30 minutes on my machine. Uwe -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 11:15 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: AW: [R] StructTS hang? On 26.01.2010 10:55, richard.kie...@rwe.com wrote: No problem! Working: z-ts(sin(1:1000), start=1, freq=10) x-StructTS(z, type='BSM') Hang: z-ts(sin(1:1000), start=1, freq=100) x-StructTS(z, type='BSM') (Both on WinXP, R 2.9.2) I don't, however, know who the package maintainer is, nor can I track down where exactly the hang is caused. Maybe somebody else can help me with that. Apologies, thought that code was from a contributed package rather than from the base distribution of R. In this case, and given the code, we should try to debug a little bit. My first impression is that it will take some time given experiments with smaller numbers it looks roughly exponential in runtime. I'll be off for a meeting now and will look at results in 1-2 hours (when I expect them to appear on my machine). Uwe Ligges Cheers, Richard Kiefer -Ursprüngliche Nachricht- Von: Uwe Ligges [mailto:lig...@statistik.tu-dortmund.de] Gesendet: Dienstag, 26. Januar 2010 10:32 An: Kiefer, Richard Cc: r-help@r-project.org Betreff: Re: [R] StructTS hang? On 25.01.2010 11:03, richard.kie...@rwe.com wrote: Hi! You have probably sorted out your problem a different way. However I have tried dealing with the same problem for a while and writing down the reason for this here may be of use to someone. In some other help-mail I read that time series objects behave unexpectedly in some situations if the frequency is too high. As a result of this, a call of StructTS (with seasonality) hangs if and only if the frequency is larger than 24 (if I remember the number right). This is what I found with my own time series using several frequencies. So, this may not be helpful using StructTS on a time series, but it may save somebody some time. Even better: report a reproducible example to the package maintainer who is certainly happy to fix bugs in the package. Best wishes, Uwe Ligges Regards, Richard Irgendwann kommt jeder drauf! WWW.ENERGIEWELT.DE --- Vorsitzender des Aufsichtsrates: Dr. Rolf Martin Schmitz Vorstand: Dr. Johannes Lambertz (Vorsitzender), Prof. Dr. Gerd Jaeger, Antonius Voss, Erwin Winkel Sitz der Gesellschaft: Essen und Koeln Eingetragen beim Amtsgericht Essen Handelsregister-Nr. HRB 17420 Eingetragen beim Amtsgericht Koeln Handelsregister-Nr. HRB 117 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R Output and ArcGIS
Yes, R thinks the coordinates are characters, that needs to change. Also, alternatively you could use the write .dbf function in the foreign() library, ArcGis likes dbf files (just no long names) Corey - Corey Sparks, PhD Assistant Professor Department of Demography and Organization Studies University of Texas at San Antonio 501 West Durango Blvd Monterey Building 2.270C San Antonio, TX 78207 210-458-3166 corey.sparks 'at' utsa.edu https://rowdyspace.utsa.edu/users/ozd504/www/index.htm -- View this message in context: http://n4.nabble.com/R-Output-and-ArcGIS-tp1289606p1290310.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Error with toString
Hello there, I want to create a string from strings and numbers, here is my code: str - name toString(20) but it returns me this error: Error in toString(20) : could not find function .jcall what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] R Output and ArcGIS
Dear all, Just to let you know that thanks to your help, I've managed to solve it. For future reference, if anyone's interested (!), if you're having problems reading R-generated data from a Mac, into ArcMap on a PC, then ensure that you're using eol=\r\n in the write.table command and that you don't have factor or character data when they're really meant to be numeric! To overcome the latter, I did: mrunoff$Longitude - as.numeric(levels(mrunoff$Longitude))[mrunoff$Longitude] Hope this is of use to someone, somewhere, someday! Thanks again for your advice, Steve _ Got a cool Hotmail story? Tell us now __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Formatting cgroup and factor level labels in Hmisc latex function
Hi Stefan,
See comments in line below.
On Tue, Jan 26, 2010 at 6:21 AM, Stefan Petersson
stefan.peters...@inizio.se wrote:
I'm trying to typeset at simple crosstable with the Hmisc latex function. And
I have two problems.
1. How do I make all columns the same width?
Use cgroup.just=p{widthunit} For example, for column groups 2
inches wide, use cgroup.just=p{2in}
The Latex function seems very unwilling to break the 'cgroup' labels
and the factor level labels. Please have look at this screenshot that
shows my problem:
The latex() function will do whatever you tell it to...
http://hem.passagen.se/stpe9096/table.png
So, how can I make sure that the cgroup labels and the factor level labels
are sufficiently line breaked and/or hyphenated to make the columns evenly
spaced?
2. Is there something like a 'widetable' package that can break a wide table
into several tables with repeated 'rgroup' labels? As You can see in the
screenshot, the table runs way off the page. And I know that there is a
'longtable' package that can do exactly this, but for tables with long rgroup
lists.
I would stick with long table. Use R to re-organize you data so that
it is long instead of wide, and use longtable.
HTH,
Ista
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
--
Ista Zahn
Graduate student
University of Rochester
Department of Clinical and Social Psychology
http://yourpsyche.org
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] Graph color
Hi all I want to apply different colors on a simple plot: If I type par(br=gray) before a plot it puts all the image in gray but (imagine I run a simple plot) want to let the centrall box (where the dots are plotted) in white or image in lightblue. Can anyone guide me to apply this second step (make the box where the series are plotted in different colours). Thanks in advance. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
On 01/26/2010 03:09 PM, anna wrote: Hello there, I want to create a string from strings and numbers, here is my code: str- name toString(20) Where did you get that syntax from ? You need to use paste. paste( name, 20 ) [1] name 20 but it returns me this error: Error in toString(20) : could not find function .jcall what did I do wrong? I couldn't find this error anywhere... .jcall is in rJava, but rJava never calls toString. Can you attach a bit more information as requested by the posting guide : http://www.r-project.org/posting-guide.html Romain -- Romain Francois Professional R Enthusiast +33(0) 6 28 91 30 30 http://romainfrancois.blog.free.fr |- http://tr.im/KfKn : Rcpp 0.7.2 |- http://tr.im/JOlc : External pointers with Rcpp `- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] update.packages on MS Windows with //server/share paths
Hi, update.packages(ask='graphics') gives me multiple warning (one per updated package?) similar to ... Warning: unable to move temporary installation '\\Server02\stats\R\library\2.10\file3de56e0d\locfit' to '\\Server02\stats\R\library\2.10\locfit' The final, updated, folders do not end up where they should be. I can move them 'by hand', but it is an inconvenience. Checking the archives I find http://finzi.psych.upenn.edu/Rhelp08/2008-April/160963.html where Prof Ripley opines The issue appears to be that your OS is garbling file names, and it surely does seem to be a filename problem - in combination R and Windows don't seem to be handling the '//server/share' path construction. I have: .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library I can work around by mapping a drive letter to the '//server/share', but prefer not to (for local reasons). In CHANGES.R-2.10.1pat I find CHANGES IN R VERSION 2.7.2 patched o dir.create(recursive = TRUE) was not working on //server/share paths. In CHANGES.R-2.11.0dev I find CHANGES IN R VERSION 2.11.0 NEW FEATURES o file.rename() can work across volumes (by copy-and-delete) In another R function I've hit a similar problem and solved it using the construction: file.path(dirname(x), basename(x)) to convert '//server/share' to (printed as) 'server/share' which worked in that function. In this case: file.path(dirname(.libPaths()), basename(.libPaths())) [1] Server02/stats/R/library/2.10 Server02/stats/R/R-Current/library which looks OK but .libPaths(file.path(dirname(.libPaths()), basename(.libPaths( .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library doesn't actually change the internal paths. I don't see the problem in V2.9.2 . I do see the problem in V2.10.1, V2.10.1 Patched (2010-01-24 r51030) V2.11.0 Under development (unstable) (2010-01-24 r51030) Grateful for any suggestions, Keith Jewell - Version: platform = i386-pc-mingw32 arch = i386 os = mingw32 system = i386, mingw32 status = Patched major = 2 minor = 10.1 year = 2010 month = 01 day = 24 svn rev = 51030 language = R version.string = R version 2.10.1 Patched (2010-01-24 r51030) Windows Server 2003 x64 (build 3790) Service Pack 2 Locale: LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United Kingdom.1252;LC_MONETARY=English_United Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 Search Path: .GlobalEnv, package:stats, package:graphics, package:grDevices, package:utils, package:datasets, package:methods, Autoloads, package:base __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] reading a string vector
Hi, I need to read a string vector in R which is like this atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as a unique vector input when I read in like x - atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] create custom function to annotate a levelplot
Dear list users,
I modeled the probability of occurrence of one species: Cyperus
dilatatus.
I modeled the species using three different approaches:
c(random,target,index)
What I want to achieve is to make a plot of all prediction maps in a row
with to conditional variables, that is, with the species and the
approach
I prepared a data.frame to try with the 'levelplot' function. Please
find attached a file (levelplot.RData) where I saved the following
objects:
all.df a data frame with coordinates (s1 and s2), predictions (z),
approach used (name), species name (spname)
var a numeric vector with the validation value of each model
This is my initial code:
#
library(lattice);library(RColorBrewer)
load(levelplot.RData)
# gray colors for display
mypalette = brewer.pal(9, Greys)
# plot
levelplot(z ~ s1 + s2 | name * spname, data=df,
col.regions=mypalette, at=c(0,.1,.2,.3,.4,.5,.6,.7,.8,1), layout=c(3,1),
xlab=NULL, ylab=NULL,
scales=list(draw=FALSE))
# -
But now I would like to do some adjustments. For example, I would like
to make the font type of the strip where the species name is italic. So
I tried initially:
#
update(trellis.last.object(),
strip=function(...,style,par.strip.text)
strip.default(...,style=1,par.strip.text = list(cex=.8, font=3)))
#--
But then also the strip with the model approach turns into italic font
type. So I tried to customize my own strip function like this:
#--
mystrip -
function(which.given,which.panel,factor.levels,par.strip.text,...){
if (which.given == 1){
par.strip.text = list(cex=.8, font=3)
panel.text(x=0.1,y=0,pos=3,lab=factor.levels[which.panel[which.given]])
}
if (which.given == 2){
par.strip.text = list(cex=.6, font=1)
panel.text(x=0.5, y=0,lab=factor.levels[which.panel[which.given]])
}
}
update(trellis.last.object(), strip=mystrip)
#
And then everything started going crazy!!!
I would also like to add to each panel, as text, the validation value
for each prediction. So I tried something like this
#-
mypanel = function(x,y,z,subscripts,...){
panel.levelplot(x,y,z,subscripts,...)
ltext(15, 160, labels=paste(AUC =, var[subscripts], sep= ),
cex=.7)}
update(trellis.last.object(), panel=mypanel)
# --
but it displays only the value for the first map, so something is
telling me that the use of subscripts is not good. So I tried also with
which.packet insted of subscripts with no success.
Finally, I would like to make the strip where the name of the species is
to appear as a large unique strip and not three times repeated.
I hope I am making sense of what I want and looking forward for any
help or directions...
Best,
Jaime -R
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
?paste is a logical operator, not string concatenation. On Tue, Jan 26, 2010 at 9:09 AM, anna lippelann...@hotmail.com wrote: Hello there, I want to create a string from strings and numbers, here is my code: str - name toString(20) but it returns me this error: Error in toString(20) : could not find function .jcall what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Jim Holtman Cincinnati, OH +1 513 646 9390 What is the problem that you are trying to solve? __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] reading a string vector
Like this? strsplit(atgctctaatcgtcccaacaattatattactaccac, split=) -Ista On Tue, Jan 26, 2010 at 8:08 AM, bia.estat bia@live.com wrote: Hi, I need to read a string vector in R which is like this atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as a unique vector input when I read in like x - atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Ista Zahn Graduate student University of Rochester Department of Clinical and Social Psychology http://yourpsyche.org __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] reading a string vector
On 01/26/2010 02:08 PM, bia.estat wrote: Hi, I need to read a string vector in R which is like this atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as a unique vector input when I read in like x- atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz See ?strsplit strsplit( x, )[[1]] Romain -- Romain Francois Professional R Enthusiast +33(0) 6 28 91 30 30 http://romainfrancois.blog.free.fr |- http://tr.im/KfKn : Rcpp 0.7.2 |- http://tr.im/JOlc : External pointers with Rcpp `- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
name toString(20)
is from Excel or OpenOffice; means 'logical and' in R, not string
concatenation.
paste() is simpler; sprintf() is more precise as to decimal places and
format.
anna lippelann...@hotmail.com 26/01/2010 14:09:15
Hello there, I want to create a string from strings and numbers, here
is my
code:
str - name toString(20)
but it returns me this error:
Error in toString(20) : could not find function .jcall
what did I do wrong? I couldn't find this error anywhere...
--
***
This email and any attachments are confidential. Any use...{{dropped:8}}
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
thanks! I thought it was a concatenator like in vb -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1292949.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
Romain, I used the paste for numbers to as you told me and it worked. For the toString() function well I called it from the R console and that's what it returned me... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1293039.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] update.packages on MS Windows with //server/share paths
Try mapping a drive letter to \\Server02 and then use that. For more, google for: map network drive On Tue, Jan 26, 2010 at 10:01 AM, Keith Jewell k.jew...@campden.co.uk wrote: Hi, update.packages(ask='graphics') gives me multiple warning (one per updated package?) similar to ... Warning: unable to move temporary installation '\\Server02\stats\R\library\2.10\file3de56e0d\locfit' to '\\Server02\stats\R\library\2.10\locfit' The final, updated, folders do not end up where they should be. I can move them 'by hand', but it is an inconvenience. Checking the archives I find http://finzi.psych.upenn.edu/Rhelp08/2008-April/160963.html where Prof Ripley opines The issue appears to be that your OS is garbling file names, and it surely does seem to be a filename problem - in combination R and Windows don't seem to be handling the '//server/share' path construction. I have: .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library I can work around by mapping a drive letter to the '//server/share', but prefer not to (for local reasons). In CHANGES.R-2.10.1pat I find CHANGES IN R VERSION 2.7.2 patched o dir.create(recursive = TRUE) was not working on //server/share paths. In CHANGES.R-2.11.0dev I find CHANGES IN R VERSION 2.11.0 NEW FEATURES o file.rename() can work across volumes (by copy-and-delete) In another R function I've hit a similar problem and solved it using the construction: file.path(dirname(x), basename(x)) to convert '//server/share' to (printed as) 'server/share' which worked in that function. In this case: file.path(dirname(.libPaths()), basename(.libPaths())) [1] Server02/stats/R/library/2.10 Server02/stats/R/R-Current/library which looks OK but .libPaths(file.path(dirname(.libPaths()), basename(.libPaths( .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library doesn't actually change the internal paths. I don't see the problem in V2.9.2 . I do see the problem in V2.10.1, V2.10.1 Patched (2010-01-24 r51030) V2.11.0 Under development (unstable) (2010-01-24 r51030) Grateful for any suggestions, Keith Jewell - Version: platform = i386-pc-mingw32 arch = i386 os = mingw32 system = i386, mingw32 status = Patched major = 2 minor = 10.1 year = 2010 month = 01 day = 24 svn rev = 51030 language = R version.string = R version 2.10.1 Patched (2010-01-24 r51030) Windows Server 2003 x64 (build 3790) Service Pack 2 Locale: LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United Kingdom.1252;LC_MONETARY=English_United Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 Search Path: .GlobalEnv, package:stats, package:graphics, package:grDevices, package:utils, package:datasets, package:methods, Autoloads, package:base __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Error with toString
On 01/26/2010 04:19 PM, anna wrote: Romain, I used the paste for numbers to as you told me and it worked. For the toString() function well I called it from the R console and that's what it returned me... Yes. I understood that the first time. and I asked you to provide more details about your session to help diagnose the problem better. I can figure out on my own that you typed it at the console. What I cannot figure out is details of your session. Please read the posting guide, follow it and come back with the details if you want someone to help. You might want to read An Introduction to R too, because R is nothing like vb. Romain -- Romain Francois Professional R Enthusiast +33(0) 6 28 91 30 30 http://romainfrancois.blog.free.fr |- http://tr.im/KfKn : Rcpp 0.7.2 |- http://tr.im/JOlc : External pointers with Rcpp `- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Large dataset importing, columns merging and splitting
Dear All, I have a large data set that looks like this: CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 First, I would like to import it by merging column 3 4 and 5, since that is the timestamp. Then, I would like to aggregate the data by splitting them in bins of 5 minutes size, therefore from 93000 up to 93459 etc, givin as output the average price and volume in the 5 minutes bin. Hope this helps, Best, Marco -- View this message in context: http://n4.nabble.com/Large-dataset-importing-columns-merging-and-splitting-tp1294668p1294668.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] hdf files
hello,
I have a problem to open an hdf file. i have downloaded the package 'hdf5' as
it was advised on R seek. But when i try to load the file, the R console sends
me an eror message:
setwd(C:/Documents and Settings/Karine/Bureau/data/)
#install.packages('hdf5')
library(hdf5)
sea_ice - hdf5load(asi-s6250-20090704-v5i.hdf, load = TRUE, verbosity = 3,
tidy = FALSE)
Grid_ice - hdf5load(LongitudeLatitudeGrid-s6250-Antarctic.hdf, load = TRUE,
verbosity = 3, tidy = FALSE)
sea_ice - hdf5load(asi-s6250-20090704-v5i.hdf, load = TRUE, verbosity =
3, tidy = FALSE)
hdf5_global_verbosity=3 load=1
Erreur dans hdf5load(asi-s6250-20090704-v5i.hdf, load = TRUE, verbosity = 3,
:
unable to open HDF file: asi-s6250-20090704-v5i.hdf
Grid_ice - hdf5load(LongitudeLatitudeGrid-s6250-Antarctic.hdf, load =
TRUE, verbosity = 3, tidy = FALSE)
hdf5_global_verbosity=3 load=1
Erreur dans hdf5load(LongitudeLatitudeGrid-s6250-Antarctic.hdf, load = TRUE,
:
unable to open HDF file: LongitudeLatitudeGrid-s6250-Antarctic.hdf
Thanks a lot,
Karine HEERAH
Master 2 mention océanographie et environnements marins, parcours océanique
42 rue Salvador Allende
92000 Nanterre
06.61.50.97.47
_
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] reading a string vector
Try this: strsplit(atgctctaatcgtcccaacaattatattactaccac, NULL) On Tue, Jan 26, 2010 at 11:08 AM, bia.estat bia@live.com wrote: Hi, I need to read a string vector in R which is like this atgctctaatcgtcccaacaattatattactaccac, but R seems to understand it as a unique vector input when I read in like x - atgctctaatcgtcccaacaattatattactaccac. How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Henrique Dallazuanna Curitiba-Paraná-Brasil 25° 25' 40 S 49° 16' 22 O __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] problem with read.genepop function
I'm trying to use the package ARES to produce allelic richness estimates with extrapolation beyond the sample size. I've begun by testing the program with the butterfly_borneo data provided with the package, but I seem to be having a problem with the read.genepop function. Below, I've included my R code along with the error I receive after trying to read the genepop file. I'm not familiar with this error message and would appreciate any comments on how to resolve this problem, or interpret the error. Thank you, Adam path - system.file ( package = 'ARES'); file - paste (list (path, '/data/butterfly_borneo.txt'), collapse=); butterfly_data - read.genepop (filename=file); Error in read.genepop(filename = file) : trying to get slot title from an object of a basic class (list) with no slots In addition: Warning message: In readLines(con) : incomplete final line found on 'C:/PROGRA~1/R/R-29~1.2/library/ARES/data/butterfly_borneo.txt' __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] heatmap.2 color range
Hi, I'm trying to create a heatmap with color ranges for different values in my matrix. For example: If x 5 , use orange gradient if x 1.5, use red gradient . Right now I have the following: orgPal-brewer.pal(3,Oranges) bluPal-brewer.pal(3,Blues) redPal-brewer.pal(3,Reds) grad - ifelse(randMat 5,orgPal,ifelse(randMat1.5,redPal,bluPal)) hmap - heatmap(randMat,Rowv=NULL, Colv=NULL,dendrogram=none,col = grad, scale=column,...) the problem is that all the colors become very close to white on one end of the spectrum and the orange colors, for example, start approaching red when x reaches extreme values and the heatmap loses its effect. Is there an easy way to specify a start and end range for each of my colors so that the hue does not change dramatically within each spectrum. I'm sure that I can explicitly specify all the colors within my ifelse statement but this is rather time consuming. thanks, John -- View this message in context: http://n4.nabble.com/heatmap-2-color-range-tp1293498p1293498.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Strange tick in ggplot geom_area; and ordering, again
In the area plots below, I see 4 triangle ticks at both sides of the bar; I believe these are non-stacked values for p, but they are definitively confusing. In addition, I would like to get the order of the colors in the plot the same as in the legend, and not arranged alphabetically (the factor is ordered, don't touch my order). Hadley once mentioned an undocumented aestetics order, but I could not get it to work in the example. Dieter library(ggplot2) cf1 = structure(list(dur = c(10L, 10L, 10L, 10L, 10L, 150L, 150L, 150L, 150L, 150L), score = structure(c(3L, 1L, 4L, 5L, 2L, 3L, 1L, 4L, 5L, 2L), .Label = c(none, weak, moderate, severe, verysevere), class = c(ordered, factor)), p = c(0.04, 0.02, 0.26, 0.6, 0.07, 0.07, 0.05, 0.33, 0.42, 0.14)), .Names = c(dur, score, p), class = c(cast_df, data.frame)) # columns do not ad to 100% because of rounding; never mind qplot(dur,p,data=cf1, fill=score)+ geom_area() -- View this message in context: http://n4.nabble.com/Strange-tick-in-ggplot-geom-area-and-ordering-again-tp1294692p1294692.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Strange tick in ggplot geom_area; and ordering, again
Hi Dieter, It looks like a bug: Order works fine with bars: qplot(factor(dur),weight=p,data=cf1, fill=score, geom = bar, order = rev(score)) but not with areas: qplot(dur, p, data=cf1, fill=score, geom = area, order = rev(score)) I'll add it to my to do list. Hadley On Tue, Jan 26, 2010 at 10:05 AM, Dieter Menne dieter.me...@menne-biomed.de wrote: In the area plots below, I see 4 triangle ticks at both sides of the bar; I believe these are non-stacked values for p, but they are definitively confusing. In addition, I would like to get the order of the colors in the plot the same as in the legend, and not arranged alphabetically (the factor is ordered, don't touch my order). Hadley once mentioned an undocumented aestetics order, but I could not get it to work in the example. Dieter library(ggplot2) cf1 = structure(list(dur = c(10L, 10L, 10L, 10L, 10L, 150L, 150L, 150L, 150L, 150L), score = structure(c(3L, 1L, 4L, 5L, 2L, 3L, 1L, 4L, 5L, 2L), .Label = c(none, weak, moderate, severe, verysevere), class = c(ordered, factor)), p = c(0.04, 0.02, 0.26, 0.6, 0.07, 0.07, 0.05, 0.33, 0.42, 0.14)), .Names = c(dur, score, p), class = c(cast_df, data.frame)) # columns do not ad to 100% because of rounding; never mind qplot(dur,p,data=cf1, fill=score)+ geom_area() -- View this message in context: http://n4.nabble.com/Strange-tick-in-ggplot-geom-area-and-ordering-again-tp1294692p1294692.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- http://had.co.nz/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Large dataset importing, columns merging and splitting
Try this using the development version of read.zoo in zoo (which we source from the R-Forge on the fly). We use NULL in colClasses for those columns we don't need but in col.names we still have to include dummy names for them. Of what is left the index is the first three columns (1:3) which we convert to chron class times in FUN and then truncate to 5 seconds in FUN2. Finally we use aggregate = mean to average over the 5 second intervals. Lines - CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 40 51 73.25 100 0 CVX 20070201 9 40 52 73.25 100 0 CVX 20070201 9 40 53 73.25 300 0 library(zoo) source(http://r-forge.r-project.org/plugins/scmsvn/viewcvs.php/*checkout*/pkg/zoo/R/read.zoo.R?rev=611root=zoo;) library(chron) z - read.zoo(textConnection(Lines), colClasses = c(NULL, NULL, numeric, numeric, numeric, numeric, numeric, NULL), col.names = c(V1, V2, V3, V4, V5, Price, Volume, V8), index = 1:3, FUN = function(tt) times(paste(tt[,1], tt[,2], tt[,3], sep = :)), FUN2 = function(tt) trunc(tt, 00:00:05), aggregate = mean) The result of running the above is: z Price Volume 09:30:50 73.25 32660. 09:40:50 73.25 166.6667 On Tue, Jan 26, 2010 at 10:48 AM, Manta mantin...@libero.it wrote: Dear All, I have a large data set that looks like this: CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 First, I would like to import it by merging column 3 4 and 5, since that is the timestamp. Then, I would like to aggregate the data by splitting them in bins of 5 minutes size, therefore from 93000 up to 93459 etc, givin as output the average price and volume in the 5 minutes bin. Hope this helps, Best, Marco -- View this message in context: http://n4.nabble.com/Large-dataset-importing-columns-merging-and-splitting-tp1294668p1294668.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] tapply and more than one function, with different arguments
Dear R-users,
I am working with R version 2.10.1.
Say I have is a simple function like this:
my.fun - function(x, mult) mult*sum(x)
Now, I want to apply this function along with some other (say 'max') to a
simple data.frame, like:
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
Ideally, the result would look something like this (if mult = 10):
max my.fun
a 2 30
b 4 70
I have tried it that way:
apply.more.functions - function(dat, FUN = c(max, my.fun), ...) {
res - NULL
for(f in FUN) res[[f]] - tapply(dat$x, dat$grp, FUN = f, ...)
data.frame(res)
}
# let's test it:
apply.more.functions(dat, FUN = c(max, min))
max min
a 2 1
b 4 3
# perfect!
# now, with an additional argument:
apply.more.functions(dat, FUN = c(max, my.fun), mult = 10)
max my.fun
a 10 30
b 10 70
# uhuh!
Apparently, 'mult' has been used in the calculation of 'max' as well.
How can I modify apply.more.functions in order to avoid this?
Your advice would be appreciated;
Kind regards
Heinrich.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] update.packages on MS Windows with //server/share paths
Thanks Gabor, but expanding on my remark... I can work around by mapping a drive letter to the '//server/share', but prefer not to (for local reasons). R is installed on our network, used by others (with readonly access), maintained by me. In 'Renviron.site' I have... R_LIBS_SITE=//Server02/stats/R/library/%v ...which works for everyone else (and for me as long as I don't try update.packages). I (but not everyone else!) routinely have a drive (L:) mapped to //Server02/stats so that I can (and currently do) update.packages by a) altering 'Renviron.site' to R_LIBS_SITE=L://R/library/%v b) starting Rgui.exe from (e.g.) L:\R\R-2.10.1\bin BUT while 'Renviron.site' is altered, users who don't have the drive mapping don't get the site library, so I have to be quick and risk a couple of complaints. I've tried putting a '.Renviron' file in my personal home directory containing R_LIBS_SITE=L://R/library/%v hoping I could implement a 'personal' site library, but it doesn't seem to have any effect (not unreasonably?). As I outlined, my attempts to alter .libPaths() or .Library.site within my R session haven't worked. Anyway, (although I say this with trepidation) this does look to me like a minor bug. It seems to me that (for example)... shell.exec(.libPaths()[1]) and shell.exec(file.path(dirname(.libPaths()[1]), basename(.libPaths()[1]))) ...should give the same result, especially when (as in this case) the syntax of the file spec... .libPaths()[1] [1] //Server02/stats/R/library/2.10 ... is controlled by R (in this example the former fails with ...not found, the latter opens the folder in Windows Explorer). Best regards, Keith Jewell - Gabor Grothendieck ggrothendi...@gmail.com wrote in message news:971536df1001260714i430b9ddcm37ffa12642321...@mail.gmail.com... Try mapping a drive letter to \\Server02 and then use that. For more, google for: map network drive On Tue, Jan 26, 2010 at 10:01 AM, Keith Jewell k.jew...@campden.co.uk wrote: Hi, update.packages(ask='graphics') gives me multiple warning (one per updated package?) similar to ... Warning: unable to move temporary installation '\\Server02\stats\R\library\2.10\file3de56e0d\locfit' to '\\Server02\stats\R\library\2.10\locfit' The final, updated, folders do not end up where they should be. I can move them 'by hand', but it is an inconvenience. Checking the archives I find http://finzi.psych.upenn.edu/Rhelp08/2008-April/160963.html where Prof Ripley opines The issue appears to be that your OS is garbling file names, and it surely does seem to be a filename problem - in combination R and Windows don't seem to be handling the '//server/share' path construction. I have: .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library I can work around by mapping a drive letter to the '//server/share', but prefer not to (for local reasons). In CHANGES.R-2.10.1pat I find CHANGES IN R VERSION 2.7.2 patched o dir.create(recursive = TRUE) was not working on //server/share paths. In CHANGES.R-2.11.0dev I find CHANGES IN R VERSION 2.11.0 NEW FEATURES o file.rename() can work across volumes (by copy-and-delete) In another R function I've hit a similar problem and solved it using the construction: file.path(dirname(x), basename(x)) to convert '//server/share' to (printed as) 'server/share' which worked in that function. In this case: file.path(dirname(.libPaths()), basename(.libPaths())) [1] Server02/stats/R/library/2.10 Server02/stats/R/R-Current/library which looks OK but .libPaths(file.path(dirname(.libPaths()), basename(.libPaths( .libPaths() [1] //Server02/stats/R/library/2.10 //Server02/stats/R/R-Current/library doesn't actually change the internal paths. I don't see the problem in V2.9.2 . I do see the problem in V2.10.1, V2.10.1 Patched (2010-01-24 r51030) V2.11.0 Under development (unstable) (2010-01-24 r51030) Grateful for any suggestions, Keith Jewell - Version: platform = i386-pc-mingw32 arch = i386 os = mingw32 system = i386, mingw32 status = Patched major = 2 minor = 10.1 year = 2010 month = 01 day = 24 svn rev = 51030 language = R version.string = R version 2.10.1 Patched (2010-01-24 r51030) Windows Server 2003 x64 (build 3790) Service Pack 2 Locale: LC_COLLATE=English_United Kingdom.1252;LC_CTYPE=English_United Kingdom.1252;LC_MONETARY=English_United Kingdom.1252;LC_NUMERIC=C;LC_TIME=English_United Kingdom.1252 Search Path: .GlobalEnv, package:stats, package:graphics, package:grDevices, package:utils, package:datasets, package:methods, Autoloads, package:base __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal,
[R] (list) object cannot be coerced to type 'double'
Dear all,
My script returns the following error:
Error in storage.mode(test) - logical :
(list) object cannot be coerced to type 'double'
I've looked around and some suggest that it could be the way data have been
imported. For my case, I don't think it is such. Rather I think it has to be
the way I define x1 and in1. x1 is an object in which the values are written to
which in turn serve as input.
The object, x, contain 32 files of 2x2 matrix.
Any guidance would be appreciated.
Muhammad
-
# Cleans workspace
rm(list=ls())
# -- DATA -- #
# Load DATA[1]: Monthly anomalies
f - list.files(C:/Documents and Settings/shil3148/Desktop/dsi,
\\.txt$) # List files with pattern matching
x - lapply(f, read.table)# DATA[1]: Monthly anomalies
# Prepare DATA[2]: Rolling Sum
nt - 6
ed - nt - 1
fl - length(x)
y0 - list()
for (i in 1:(fl-ed))# Remove NA values
{
y0[[i]] - Reduce(+, x[c(i:(i+ed))]) # RAW: Rolling Sum
}
# Data conversion
xx - list()
for (z in 1:length(x))
{
xx[[z]] - as.matrix(x[[z]])# convert data to matrix
}
yy - list()
for (f in 1:length(y0))
{
yy[[f]] - as.matrix(y0[[f]])# convert data to matrix
}
# -- ALGORITHM -- #
x1 - list() # Error here
in1 - list() # Error here
for (t in 1:27) # This is the length of yy
{
in1[t+1] -
ifelse(x1[t] 0, (
ifelse(yy[t] 0, x1[t] + xx[t+5], 0)), (
ifelse(yy[t+1] = 0, 0, (
ifelse(xx[t+5] = 0, 0, xx[t+5])
))
)
)
x1[t+1] - in1[t+1]
}
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] [Fwd: Re: question on sqldf syntax]
On 1/26/10 2:11 AM, Christian Schulz wrote: Sorry mistake from me. This was another problem in my mind , but with RMySQL. Christian library(RMySQL) library(sqldf) sqldf(Select * from mtcars) Fehler in mysqlNewConnection(drv, ...) : RS-DBI driver: (Failed to connect to database: Error: Access denied for user 'user'@'localhost' (using password: NO) ) Fehler in if (dbname == :memory:) dbDisconnect(connection) else if (!dbPreExists : Argument hat Länge 0 detach(package:RMySQL) sqldf(Select * from mtcars) That sqldf only works if RMySQL is not attached seems like something worth investigating and fixing. It should be possible to avoid such conflicts by proper use of name spaces, but I have not looked into the details of what's going on. + seth -- Seth Falcon | @sfalcon | http://userprimary.net/user __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] PNG resolution
Hi, I expect that if I change only the resolution of an image, although the image would have more pixels, if viewed in the same physical size, the elements in the image would have the same physical size but with more detail. However, when I use the res parameter of png() this is not what I see. Would someone show me how I can just increase the resolution without changing the physical sizes of elements in my plot? Maybe an example would help? Below are three images. I expect that if I print them out, let's say scaled to fit the page, then items such as the words Title Text would appear the same size. Instead (for the last two) it appears that the same number of pixels are being used, thus the text size appears smaller. What should I do to just increase the resolution? png(72dpi.png, width=6+2/3, height=6+2/3, units=in, res=72) plot(0,0, main=Title Text) dev.off() png(300dpi.png, width=6+2/3, height=6+2/3, units=in, res=300) plot(0,0, main=Title Text) dev.off() png(600dpi.png, width=6+2/3, height=6+2/3, units=in, res=600) plot(0,0, main=Title Text) dev.off() Thanks in advance, Matthew Walker __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Strange tick in ggplot geom_area; and ordering, again
Hi, Hadley, can you also reproduce the âtrianglesâ problem? Is it just a trivial corollary of the order-bug? Dieter From: hadley wickham [via R] [mailto:ml-node+1294703-876505...@n4.nabble.com] Sent: Tuesday, January 26, 2010 5:18 PM To: Dieter Menne Subject: Re: [R] Strange tick in ggplot geom_area; and ordering, again Hi Dieter, It looks like a bug: Order works fine with bars: qplot(factor(dur),weight=p,data=cf1, fill=score, geom = bar, order = rev(score)) but not with areas: qplot(dur, p, data=cf1, fill=score, geom = area, order = rev(score)) I'll add it to my to do list. -- View this message in context: http://n4.nabble.com/Strange-tick-in-ggplot-geom-area-and-ordering-again-tp1294692p1294763.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] [Fwd: Re: question on sqldf syntax]
On Tue, Jan 26, 2010 at 11:55 AM, Seth Falcon s...@userprimary.net wrote: That sqldf only works if RMySQL is not attached seems like something worth investigating and fixing. It should be possible to avoid such conflicts by proper use of name spaces, but I have not looked into the details of what's going on. It does work without RMySQL and in fact that is the normal way it is used since MySQL support has not been tested and you are really on your own if you want to try sqldf with MySQL (as indicated in documentation and home page). The driver= argument of the sqldf function call determines which database is used. If you don't specify the driver= argument then it uses the global option sqldf.driver to determine which database to use. If you have not set that either then it checks if RMySQL is attached and uses the MySQL database if it is and uses the SQLite database otherwise. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Graph color
If I understand what you want correctly, you'll probably want to use the col argument in whatever base graphics function you're using, rather than changing something in the graphical parameters. For example, if I wanted to add red points to an existing plot, I would use something like points(c(1:10), col=red) Or, if I wanted to generate a barplot using a shading color other than gray, barplot(c(1:10), col=steelblue) Does that answer your question? Kyle H. Ambert Fellow, National Library of Medicine Department of Medical Informatics Clinical Epidemiology Oregon Health Science University On Tue, Jan 26, 2010 at 6:44 AM, Jose Narillos de Santos narillosdesan...@gmail.com wrote: Hi all I want to apply different colors on a simple plot: If I type par(br=gray) before a plot it puts all the image in gray but (imagine I run a simple plot) want to let the centrall box (where the dots are plotted) in white or image in lightblue. Can anyone guide me to apply this second step (make the box where the series are plotted in different colours). Thanks in advance. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] newb question: chron and hist()
Hi all, I'm just getting started in R so bear with my newbness. I am trying to create a very simple histogram of logins by time, with data coming in from a MYSQL query. the raw data looks like this: id user_id experience_given created_at ip_aton 1 XXX 2445626 0 2010-01-21 00:00:01 1123632036 2 XXX 2444945 0 2010-01-21 00:00:01 1123632036 After searching around for how to deal with the timestamp, I settled with converting to POSIXct, and creating a chron object with as.numeric(). So I managed to replace the timestamps with chron objects. command: bt$created_at = chron(as.numeric(as.POSIXct(bt$created_at))) Seems very roundabout, but gets the job done. I also see that I could just use the numerical value instead, if readability wasn't an issue. The problem is, when I try to hist(bt$created_at), I get errors: Error in axis(2, adj = adj, cex = cex, font = font, las = las, lab = lab, : 'labels' is supplied and not 'at' In addition: Warning messages: 1: In plot.window(xlim, ylim, log = log, ...) : histo is not a graphical parameter 2: In title(main = main, sub = sub, xlab = xlab, ylab = ylab, ...) : histo is not a graphical parameter and the histogram looks busted like this: http://n4.nabble.com/file/n1294762/picture236.png Any ideas? I'm quite lost here, and having trouble finding date-time specific info. I do get the gist that chron is supposed to be the key, but I'm having a hard time understanding an overview of all the different time related classes. thnx for any advice in advance. -- View this message in context: http://n4.nabble.com/newb-question-chron-and-hist-tp1294762p1294762.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Hypothsis simulation
You can use the rbinom function to generate the random data. What to feed that function depends on things that you did not state (is this a comparison of 2 groups?, a logistic regression?, etc.). -- Gregory (Greg) L. Snow Ph.D. Statistical Data Center Intermountain Healthcare greg.s...@imail.org 801.408.8111 -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-boun...@r- project.org] On Behalf Of Jim Silverton Sent: Monday, January 25, 2010 9:44 PM To: r-help@r-project.org Subject: Re: [R] Hypothsis simulation I wish to simulate: Ho: Odds Ratio =1 H1 Odds Ratio 1 Can any of the R users show me how to generate this data for say 20% from Ho and 80% from H1? Thanks, Jim [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting- guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] (no subject)
Something along these lines might do the trick:
orig - rep(sapply(seq(from=, to=, by=),
as.character), times=c(1, 2, 3, 4))
I've shortened the number of repetitions, so you can test it out and see if
it's what you're looking for (just change the values in the vector assigned
to the times argument). It might be helpful to know a bit more about the
specific problem you're trying to solve though.
Kyle H. Ambert
Fellow, National Library of Medicine
Department of Medical Informatics Clinical Epidemiology
Oregon Health Science University
On Mon, Jan 25, 2010 at 10:46 AM, Chuck White chuckwhi...@charter.netwrote:
Hello -- I would like to know of a more efficient way of writing the
following piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig -
c(rep('',10),rep('',20),rep('',30),rep('',40))
orig.unique - unique(orig)
system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig==x, 1, 0
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide
http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] tapply and more than one function, with different arguments
Try replacing 'max' with 'mean' and see what you get.
Then have a look at ?max and see what max() does with
extra arguments.
I'm not sure it's relevant, but it might be useful
to check what Hmisc::summarize does.
-Peter Ehlers
RINNER Heinrich wrote:
Dear R-users,
I am working with R version 2.10.1.
Say I have is a simple function like this:
my.fun - function(x, mult) mult*sum(x)
Now, I want to apply this function along with some other (say 'max') to a
simple data.frame, like:
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
Ideally, the result would look something like this (if mult = 10):
max my.fun
a 2 30
b 4 70
I have tried it that way:
apply.more.functions - function(dat, FUN = c(max, my.fun), ...) {
res - NULL
for(f in FUN) res[[f]] - tapply(dat$x, dat$grp, FUN = f, ...)
data.frame(res)
}
# let's test it:
apply.more.functions(dat, FUN = c(max, min))
max min
a 2 1
b 4 3
# perfect!
# now, with an additional argument:
apply.more.functions(dat, FUN = c(max, my.fun), mult = 10)
max my.fun
a 10 30
b 10 70
# uhuh!
Apparently, 'mult' has been used in the calculation of 'max' as well.
How can I modify apply.more.functions in order to avoid this?
Your advice would be appreciated;
Kind regards
Heinrich.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
--
Peter Ehlers
University of Calgary
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Strange tick in ggplot geom_area; and ordering, again
Hi, Hadley, In case you have a temporary workaround, it would be nice to have it. Itâs a show stopper for my report. Bars are not an option, because the curve looks too jaggy. âDieter From: hadley wickham [via R] [mailto:ml-node+1294703-876505...@n4.nabble.com] Sent: Tuesday, January 26, 2010 5:18 PM To: Dieter Menne Subject: Re: [R] Strange tick in ggplot geom_area; and ordering, again Hi Dieter, It looks like a bug: Order works fine with bars: qplot(factor(dur),weight=p,data=cf1, fill=score, geom = bar, order = rev(score)) but not with areas: -- View this message in context: http://n4.nabble.com/Strange-tick-in-ggplot-geom-area-and-ordering-again-tp1294692p1295444.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] sp package coordinates and gridded problems with as.list()
Dear All I hope that someone can help.
I am working with sp pakage and akima
library(akima)
library(sp)
imagine lots of different dataframes, of row = 100 columns = 3 of x and y
coordinates with z values I will call these data frames for the sake of this
example akima
akima-as.list(1:100)
producing 100 dataframes dataframes of the form akima[[i]]
I then wish to interp this list of coordinates:
akima.li-as.list(1:100)
for (i in 1:100) akima.li[[i]]-interp(akima[[i]]$x, akima[[i]]$y, akima
[[i]]$z)
so now I have 100 akima.li which I then transform into a dataframe of the
akima.li values
y-as.list(1:100)
x-as.list(1:100)
z-as.list(1:100)
for (i in 1:endofrun){
y[[i]]= rep(akima.li[[i]]$x, each = length(akima.li[[i]]$y))
x[[i]] = rep(akima.li[[i]]$y, length(akima.li[[i]]$x))
z[[i]] = as.numeric(akima.li[[i]]$z)
}
abc-as.list(1:100)
for (i in 1:endofrun){
abc[[i]]- data.frame(x[[i]], y[[i]], z[[i]])
abc[[i]][is.na(abc[[i]])] - 0}
so now I have 100 dataframes with x and y columns and corresponding z values
and any NAs are now 0.
This is where my problem starts I wish to use sp to state which columns are
coordinates of the form
for (i in 1:100) coordinates(abc[[i]])= ~x+y
and that all of the dataframes are a grid, such that.
for (i in 1:100) gridded(abc[[i]]) = TRUE
however I get error messeges such as:
Error in function (classes, fdef, mtable) : unable to find an inherited
method for function coordinates-, for signature integer
and I do not know what this means.
I will then want to then go on to overlay such:
datapoint = data.frame(x = 10, y = 20)
coordinates(datapoint) = ~x+y
gridded(datapoint)=TRUE
value-as.list(1:100)
for (i in 1:100) value [[i]]= abc[[...@data[overlay(abc[[i]], datapoint),]
then I will have a list of 100 value for each original dataframe
I would be appreciative if someone could tell me how I can allocate
coordinate and grided systems to an dataframes which are as.list.
I hope that is comprehendable and someone can help. I am very stuck
many thanks Sylvestre
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] heatmap.2 color range
evgeny55 wrote: I'm trying to create a heatmap with color ranges for different values in my matrix. For example: If x 5 , use orange gradient if x 1.5, use red gradient . Right now I have the following: orgPal-brewer.pal(3,Oranges) bluPal-brewer.pal(3,Blues) redPal-brewer.pal(3,Reds) I often use larger palettes (brewer.pal(7,...)) and remove the middle range. Dieter -- View this message in context: http://n4.nabble.com/heatmap-2-color-range-tp1293498p1305413.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] PNG resolution
Matthew Walker wrote: I expect that if I change only the resolution of an image, although the image would have more pixels, if viewed in the same physical size, the elements in the image would have the same physical size but with more detail. The sample you provided create figures with the same relative size of text and title on Windows and R 2.10.1. I remember, however, that I had similar problem before, so possibly it has been fixed and you are using an older version or a different operating system. Also have a look at the Cairo devices; I have used them with good success in similar cases. Dieter -- View this message in context: http://n4.nabble.com/PNG-resolution-tp1294757p1307877.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] tapply and more than one function, with different arguments
Hi:
Using the plyr package, we can get the result as follows:
library(plyr)
my.fun - function(x, mult) mult*sum(x)
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
ddply(dat, .(grp), summarize, max = max(x), myfun = my.fun(x, 10))
grp max myfun
1 a 230
2 b 470
HTH,
Dennis
On Tue, Jan 26, 2010 at 8:26 AM, RINNER Heinrich
heinrich.rin...@tirol.gv.at wrote:
Dear R-users,
I am working with R version 2.10.1.
Say I have is a simple function like this:
my.fun - function(x, mult) mult*sum(x)
Now, I want to apply this function along with some other (say 'max') to a
simple data.frame, like:
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
Ideally, the result would look something like this (if mult = 10):
max my.fun
a 2 30
b 4 70
I have tried it that way:
apply.more.functions - function(dat, FUN = c(max, my.fun), ...) {
res - NULL
for(f in FUN) res[[f]] - tapply(dat$x, dat$grp, FUN = f, ...)
data.frame(res)
}
# let's test it:
apply.more.functions(dat, FUN = c(max, min))
max min
a 2 1
b 4 3
# perfect!
# now, with an additional argument:
apply.more.functions(dat, FUN = c(max, my.fun), mult = 10)
max my.fun
a 10 30
b 10 70
# uhuh!
Apparently, 'mult' has been used in the calculation of 'max' as well.
How can I modify apply.more.functions in order to avoid this?
Your advice would be appreciated;
Kind regards
Heinrich.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide
http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] heatmap.2 color range
as a followup, I tried using the rainbow function to create the gradients but is there a way to do a reverse rainbow, ie. normally if I do: pie(rep(1,6), col=rainbow(6,start=0, end=.07)) I'll get a gradient from dark red to orangish but what if I want it to go the other way thanks -- View this message in context: http://n4.nabble.com/heatmap-2-color-range-tp1293498p1302571.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Formatting cgroup and factor level labels in Hmisc latex function
stefan.petersson wrote: I'm trying to typeset at simple crosstable with the Hmisc latex function. And I have two problems. 1. How do I make all columns the same width? The Latex function seems very unwilling to break the 'cgroup' labels and the factor level labels. Please have look at this screenshot that shows my problem: http://hem.passagen.se/stpe9096/table.png So, how can I make sure that the cgroup labels and the factor level labels are sufficiently line breaked and/or hyphenated to make the columns evenly spaced? To force a fixed width, use a custom latex column format and pass it to the latex function. If this does not solve the column break problem, manually pass the column titles and insert a \n. I have used the first version, the second one might not work. stefan.petersson wrote: 2. Is there something like a 'widetable' package that can break a wide table into several tables with repeated 'rgroup' labels? As You can see in the screenshot, the table runs way off the page. And I know that there is a 'longtable' package that can do exactly this, but for tables with long rgroup lists. A workaround is to rotate the output with latex, or to use a smaller font. Also, making the padding space columns in latex smaller can help. Dieter -- View this message in context: http://n4.nabble.com/Formatting-cgroup-and-factor-level-labels-in-Hmisc-latex-function-tp1290232p1310696.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Large dataset importing, columns merging and splitting
If you need more aggregations on the stock (I assume that's what the first column is), I'd use the data.table package. It allows fast indexing and merge operations. That's handy if you have other features of a stock (like company size or industry sector) that you'd like to include in the aggregation. Like Gabor, I'd probably use chron for keeping track of the dates. Here's some code to get you started: Lines - CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 40 51 74.25 100 0 CVX 20070201 9 40 52 74.25 100 0 CVX 20070201 9 40 53 74.25 300 0 CVX 20070301 9 30 51 74.25 100 0 CVX 20070301 9 30 51 74.25 100 0 CVX 20070301 9 30 51 74.25 300 0 CVX 20070301 9 30 51 74.25 81400 0 CVX 20070301 9 40 51 74.25 100 0 CVX 20070301 9 40 52 74.25 100 0 CVX 20070301 9 40 53 74.25 300 0 DVX 20070201 9 30 51 73.25 81400 0 DVX 20070201 9 30 51 73.25 100 0 DVX 20070201 9 30 51 73.25 100 0 DVX 20070201 9 30 51 73.25 300 0 DVX 20070201 9 30 51 73.25 81400 0 DVX 20070201 9 40 51 74.25 100 0 DVX 20070201 9 40 52 74.25 100 0 DVX 20070201 9 40 53 74.25 300 0 DVX 20070301 9 30 51 74.25 100 0 DVX 20070301 9 30 51 74.25 100 0 DVX 20070301 9 30 51 74.25 300 0 DVX 20070301 9 30 51 74.25 81400 0 DVX 20070301 9 40 51 74.25 100 0 DVX 20070301 9 40 52 74.25 100 0 DVX 20070301 9 40 53 74.25 300 0 library(data.table) library(chron) dt - data.table(read.table(textConnection(Lines), colClasses = c(character, numeric, numeric, numeric, numeric, numeric, numeric, numeric), col.names = c(stock, date, h, m, s, Price, Volume, xx))) dt$date - as.chron(as.Date(as.character(dt$date), format = %Y%m%d)) + dt$h/24 + dt$m/(60*24) + dt$s/(60*60*24) dt$roundeddate - as.integer(floor(as.numeric(dt$date) * (24 * 12))) # data.table likes integers dt[,list(meanprice = mean(Price), volume = sum(Volume)), by = roundeddate] dt[,list(meanprice = mean(Price), volume = sum(Volume)), by = stock,roundeddate] You'd still probably want to turn the roundeddate back into a real chron object. If you use aggregation a lot, the development version of data.table has faster aggregations: http://r-forge.r-project.org/projects/datatable/ - Tom On Tue, Jan 26, 2010 at 11:23 AM, Gabor Grothendieck ggrothendi...@gmail.com wrote: Try this using the development version of read.zoo in zoo (which we source from the R-Forge on the fly). We use NULL in colClasses for those columns we don't need but in col.names we still have to include dummy names for them. Of what is left the index is the first three columns (1:3) which we convert to chron class times in FUN and then truncate to 5 seconds in FUN2. Finally we use aggregate = mean to average over the 5 second intervals. Lines - CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 40 51 73.25 100 0 CVX 20070201 9 40 52 73.25 100 0 CVX 20070201 9 40 53 73.25 300 0 library(zoo) source(http://r-forge.r-project.org/plugins/scmsvn/viewcvs.php/*checkout*/pkg/zoo/R/read.zoo.R?rev=611root=zoo;) library(chron) z - read.zoo(textConnection(Lines), colClasses = c(NULL, NULL, numeric, numeric, numeric, numeric, numeric, NULL), col.names = c(V1, V2, V3, V4, V5, Price, Volume, V8), index = 1:3, FUN = function(tt) times(paste(tt[,1], tt[,2], tt[,3], sep = :)), FUN2 = function(tt) trunc(tt, 00:00:05), aggregate = mean) The result of running the above is: z Price Volume 09:30:50 73.25 32660. 09:40:50 73.25 166.6667 On Tue, Jan 26, 2010 at 10:48 AM, Manta mantin...@libero.it wrote: Dear All, I have a large data set that looks like this: CVX 20070201 9 30 51 73.25 81400 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 100 0 CVX 20070201 9 30 51 73.25 300 0 First, I would like to import it by merging column 3 4 and 5, since that is the timestamp. Then, I would like to aggregate the data by splitting them in bins of 5 minutes size, therefore from 93000 up to 93459 etc, givin as output the average price and volume in the 5 minutes bin. Hope this helps, Best, Marco -- View this message in context: http://n4.nabble.com/Large-dataset-importing-columns-merging-and-splitting-tp1294668p1294668.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read
Re: [R] Formatting cgroup and factor level labels in Hmisc latex function
stefan.petersson wrote:
I'm trying to typeset at simple crosstable with the Hmisc latex function.
And I have two problems.
1. How do I make all columns the same width? The Latex function seems very
unwilling to break the 'cgroup' labels and the factor level labels. Please
have look at this screenshot that shows my problem:
Snippets for custom width
\newcolumntype{R}[1]{{\raggedright\hspace{0pt}\arraybackslash}p{#1}}
databasefields,results=tex=
col.just = c(l,l,R{9cm}) # You can use past to construct the width be
code
latex(... col.just=col.just,
Dieter
--
View this message in context:
http://n4.nabble.com/Formatting-cgroup-and-factor-level-labels-in-Hmisc-latex-function-tp1290232p1310708.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] PNG resolution
Dieter Menne wrote: Matthew Walker wrote: I expect that if I change only the resolution of an image, although the image would have more pixels, if viewed in the same physical size, the elements in the image would have the same physical size but with more detail. The sample you provided create figures with the same relative size of text and title on Windows and R 2.10.1. I remember, however, that I had similar problem before, so possibly it has been fixed and you are using an older version or a different operating system. Also have a look at the Cairo devices; I have used them with good success in similar cases. Thank you Dieter for your reply. I too am using R version 2.10.1 (2009-12-14), but on Linux. I compiled it against cairo-1.8.8. I tried specifying the cairo device by adding 'type=cairo' to the png() call, but it resulted in the same effect. I did notice, however, that the centre (0,0) circle is drawn at the same physical size for each of the examples. The same can be said of the outer box, and the tick marks. It is only the main text and the x and y labels that change in size. Is it possible that the text size is somehow dependant on the number of pixels in the image? Thanks again, Matthew __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] reading a string vector
thanks, it was exactly what i needed. -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1310721.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Fwd: Re: Graph color
No mate, Sorry first of all about my indefinition (I´m Spanish, I´m improving everyday but a long road to the perfection). Sorry pleae. Second, also it is diffcoult sometimes to express what we try (sorry and many thanks just for reading of course for helping). Imagine you plot X=[2 4 6 8] front a Y=[6 5 8 7] When you plot it by default all is white what I want is to use par(br=gray) to make the graph gray but I want that the area (the imaginary square defined by the axis) not to be gray I want to deffine its colour by ie lightblue. So the image will be a square image outside gray and on the axis area (not the dots, points or bar plots) the area in lightblue. I don´t now if I have expressed well if not latter I will send an example, ok? Many thanks -- Mensaje reenviado -- De: Kyle. ambe...@gmail.com Fecha: Asunto: Re: [R] Graph color Para: Jose Narillos de Santos narillosdesan...@gmail.com CC: r-help@r-project.org If I understand what you want correctly, you'll probably want to use the col argument in whatever base graphics function you're using, rather than changing something in the graphical parameters. For example, if I wanted to add red points to an existing plot, I would use something like points(c(1:10), col=red) Or, if I wanted to generate a barplot using a shading color other than gray, barplot(c(1:10), col=steelblue) Does that answer your question? Kyle H. Ambert Fellow, National Library of Medicine Department of Medical Informatics Clinical Epidemiology Oregon Health Science University On Tue, Jan 26, 2010 at 6:44 AM, Jose Narillos de Santos narillosdesan...@gmail.com wrote: Hi all I want to apply different colors on a simple plot: If I type par(br=gray) before a plot it puts all the image in gray but (imagine I run a simple plot) want to let the centrall box (where the dots are plotted) in white or image in lightblue. Can anyone guide me to apply this second step (make the box where the series are plotted in different colours). Thanks in advance. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Apply a function on an array with the parameter as an array
Hello R buddies, I want to apply a function on an array but for each element of the array I want to use a different parameter, So here is how I tried to enter the function: apply(as.matrix(X),2, function, parameter1 = arrayOfParameter) I put X as a matrix because it was initially an element of a list. It returns me an array with the same length as X but with values that I don't even understand...Can someone please help me? -- View this message in context: http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310834.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Fwd: Re: Graph color
Hi,
Try this,
x - seq(0, 10, len = 100)
y - jitter(sin(x), 1000)
old.par - par()
par(bg=grey(0.5))
plot(x, y, new = TRUE, t = n)
lims - par(usr)
plot(x, y, col = 1,
panel.first = {
rect(lims[1], lims[3], lims[2], lims[4],
col = lightblue) })
HTH,
baptiste
2010/1/26 narillosdesan...@gmail.com:
No mate,
Sorry first of all about my indefinition (I´m Spanish, I´m improving
everyday but a long road to the perfection). Sorry pleae.
Second, also it is diffcoult sometimes to express what we try (sorry and
many thanks just for reading of course for helping).
Imagine you plot
X=[2 4 6 8] front a Y=[6 5 8 7]
When you plot it by default all is white what I want is to use
par(br=gray) to make the graph gray but I want that the area (the
imaginary square defined by the axis) not to be gray I want to deffine its
colour by ie lightblue.
So the image will be a square image outside gray and on the axis area (not
the dots, points or bar plots) the area in lightblue.
I don´t now if I have expressed well if not latter I will send an example,
ok?
Many thanks
-- Mensaje reenviado --
De: Kyle. ambe...@gmail.com
Fecha:
Asunto: Re: [R] Graph color
Para: Jose Narillos de Santos narillosdesan...@gmail.com
CC: r-help@r-project.org
If I understand what you want correctly, you'll probably want to use
the col argument in whatever base graphics function you're using,
rather than changing something in the graphical parameters. For example,
if I wanted to add red points to an existing plot, I would use something
like
points(c(1:10), col=red)
Or, if I wanted to generate a barplot using a shading color other than
gray,
barplot(c(1:10), col=steelblue)
Does that answer your question?
Kyle H. Ambert
Fellow, National Library of Medicine
Department of Medical Informatics Clinical Epidemiology
Oregon Health Science University
On Tue, Jan 26, 2010 at 6:44 AM, Jose Narillos de Santos
narillosdesan...@gmail.com wrote:
Hi all I want to apply different colors on a simple plot:
If I type par(br=gray) before a plot it puts all the image in gray but
(imagine I run a simple plot) want to let the centrall box (where the dots
are plotted) in white or image in lightblue.
Can anyone guide me to apply this second step (make the box where the
series
are plotted in different colours).
Thanks in advance.
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide
http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
-Original Message- From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On Behalf Of anna Sent: Tuesday, January 26, 2010 11:48 AM To: r-help@r-project.org Subject: [R] Apply a function on an array with the parameter as an array Hello R buddies, I want to apply a function on an array but for each element of the array I want to use a different parameter, So here is how I tried to enter the function: apply(as.matrix(X),2, function, parameter1 = arrayOfParameter) I put X as a matrix because it was initially an element of a list. It returns me an array with the same length as X but with values that I don't even understand...Can someone please help me? -- Probably not. You haven't read and followed the posting guide and provided a small reproducible example so we know exactly what you tried to do. Bert Gunter Genentech Nonclinical Statistics __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
No the posting guide is quite big and I wanted to take time to read it properly, since I have been posting seriously since last wednesday and I work a lot I didn't get time to do it but will do it now ;). So you say that you know exactly what I tried to do can you explain what I tried to do if it's not looking for help? -- View this message in context: http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310849.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
I perhaps should have added that the etiquette of this list is to supply your correct name in your signature. This does not necessarily mean that you will be ignored if you fail to do so, but it does increase the likelihood that you will be. Bert Gunter Genentech Nonclinical Biostatistics __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
Speaking **only for myself**, if you don't have the time to read and follow the posting guide, I don't have the time to try to help you. Bert Gunter Genentech Nonclinical Biostatistics __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
Sorry! I am reading it now! -- View this message in context: http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310856.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] newton method for single nonlinear equation
Roslina Zakaria wrote:
newton.inputsingle - function(pars,n)
{ runi - runif(974, min=0, max=1)
lendt - length(runi)
## Parameter to estimate
z - vector(length=lendt, mode= numeric)
z - pars[1]
## Constant value
alp - 2.0165 ; rho - 0.868;
c - sqrt(pi)/(gamma(alp)*(1-rho)^alp)
for (i in 1:n)
{ t1 - exp(-pars[1]/(1-rho))
t2 - (pars[1]*(1-rho)/(2*sqrt(rho)))^(alp-0.5)
bes1 - besselI(pars[1]*sqrt(rho)/(1-rho),alp-0.5)
bes2 - besselI(pars[1]*sqrt(rho)/(1-rho),alp-1.5)
bes3 - besselI(pars[1]*sqrt(rho)/(1-rho),alp+0.5)
## Equation
f - c*t1*t2*bes1 - runi
## derivative
fprime - c*t1*t2*( -bes1/(1-rho) + (alp-0.5)*bes1/pars[1] +
sqrt(rho)*(bes2-bes3)/(2*(1-rho)))
z[i+1] - z[i] - f/fprime
}
z
}
pars - 0.5
newton.inputsingle(pars,5)
The output :
pars - 0.5
newton.inputsingle(pars,5)
[1] 0.500 -0.4826946 -1.4653892 -2.4480838 -3.4307784 -4.4134730
Warning messages:
1: In z[i + 1] - z[i] - f/fprime :
number of items to replace is not a multiple of replacement length
The warning message is the result of assigning a vector (f/fprime) to a
scalar.
You are also redefining an R built-in function: c
Furthermore it is unclear what you are trying to do.
I would advise: Keep It Simple and Stupid (KISS).
To help you along I have lifted the relevant function out of your
newton.inputsingle
(or at least what I think your function is)
zztest - function(x) {
## Constant value
alp - 2.0165 ; rho - 0.868;
czz - sqrt(pi)/(gamma(alp)*(1-rho)^alp)
t1 - exp(-x/(1-rho))
t2 - (x*(1-rho)/(2*sqrt(rho)))^(alp-0.5)
bes1 - besselI(x*sqrt(rho)/(1-rho),alp-0.5)
bes2 - besselI(x*sqrt(rho)/(1-rho),alp-1.5)
bes3 - besselI(x*sqrt(rho)/(1-rho),alp+0.5)
## Equation
f - czz*t1*t2*bes1 - .1
}
pars - 0.5
zztest(pars)
plot(zztest,0,10)
abline(0,0,lty=2)
uniroot(zztest, c(0,2))
uniroot(zztest, c(4,8))
The plot indicates how your function behaves.
The two uniroot calls solve for the two roots that appear in the plot.
You should be able to proceed on your own from here.
BTW: I do hope that this not homework.
good luck
Berend
--
View this message in context:
http://n4.nabble.com/newton-method-for-single-nonlinear-equation-tp1289991p1310861.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] splitting a factor column into binary columns for each factor
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig - c(rep('',10),rep('',20),rep(''
,30),rep('',40))
orig.unique - unique(orig)
system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig==x, 1, 0
I received a response via e-mail which was **extremely** useful.
=answer==
Using sapply instead of lapply here is a waste. sapply() calls lapply(), which
returns a list that sapply() turns into a list by making each list element a
column of the matrix. data.frame(matrix) then makes a list from the columns of
the matrix.
The one thing that sapply gives you and lapply doesn't is column names. If you
attach names to orig.unique then lapply's output will have them.
Also ifelse(orig==x,1,0) slower than the equivalent as.numeric(orig==x). I
wrote functions g0 (containing your code), g1 (using lapply), and g2
(ifelse-as.numeric). I parameterized them by the number of '111' elements
and they each return the data.frame created and the time it took to do it:
g0
function(n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
time - system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g1
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g2
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) as.numeric(orig == x
list(time = time, df = df)
}
For n=10^5 the times were
g0(1e5)$time
user system elapsed
20.650.41 20.64
g1(1e5)$time
user system elapsed
2.350.052.36
g2(1e5)$time
user system elapsed
0.730.100.77
and the data.frames each produced were identical.
Another approach is to use outer() to make a matrix that gets passed to
data.frame(). It seems slightly slower than g2, but small changes might make
it faster.
g3
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2 * n), rep(, 3 *
n), rep(, 4 * n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, outer(orig,
orig.unique, function(x, y) as.numeric(x==y
list(time = time, df = df)
}
g3(1e5)$time
user system elapsed
1.020.000.97
When you want to optimize code it is often handy to write functions like this
to do the timing for various problem sizes. You can quickly experiment with
small versions of the problem to make sure the results are correct and the time
looks reasonable and later see if the times scale up as hoped to your desired
problem size.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] splitting a factor column into binary columns for each factor
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig - c(rep('',10),rep('',20),rep(''
,30),rep('',40))
orig.unique - unique(orig)
system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig==x, 1, 0
I received a response via e-mail which was **extremely** useful.
=answer==
Using sapply instead of lapply here is a waste. sapply() calls lapply(), which
returns a list that sapply() turns into a list by making each list element a
column of the matrix. data.frame(matrix) then makes a list from the columns of
the matrix.
The one thing that sapply gives you and lapply doesn't is column names. If you
attach names to orig.unique then lapply's output will have them.
Also ifelse(orig==x,1,0) slower than the equivalent as.numeric(orig==x). I
wrote functions g0 (containing your code), g1 (using lapply), and g2
(ifelse-as.numeric). I parameterized them by the number of '111' elements
and they each return the data.frame created and the time it took to do it:
g0
function(n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
time - system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g1
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g2
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) as.numeric(orig == x
list(time = time, df = df)
}
For n=10^5 the times were
g0(1e5)$time
user system elapsed
20.650.41 20.64
g1(1e5)$time
user system elapsed
2.350.052.36
g2(1e5)$time
user system elapsed
0.730.100.77
and the data.frames each produced were identical.
Another approach is to use outer() to make a matrix that gets passed to
data.frame(). It seems slightly slower than g2, but small changes might make
it faster.
g3
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2 * n), rep(, 3 *
n), rep(, 4 * n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, outer(orig,
orig.unique, function(x, y) as.numeric(x==y
list(time = time, df = df)
}
g3(1e5)$time
user system elapsed
1.020.000.97
When you want to optimize code it is often handy to write functions like this
to do the timing for various problem sizes. You can quickly experiment with
small versions of the problem to make sure the results are correct and the time
looks reasonable and later see if the times scale up as hoped to your desired
problem size.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] splitting a factor column into binary columns for each level
Yesterday I posted the following question (my apologies for not putting a
subject line):
=question==
Hello -- I would like to know of a more efficient way of writing the following
piece of code. Thanks.
options(stringsAsFactors=FALSE)
orig - c(rep('',10),rep('',20),rep(''
,30),rep('',40))
orig.unique - unique(orig)
system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig==x, 1, 0
I received a response via e-mail which was **extremely** useful.
=answer==
Using sapply instead of lapply here is a waste. sapply() calls lapply(), which
returns a list that sapply() turns into a list by making each list element a
column of the matrix. data.frame(matrix) then makes a list from the columns of
the matrix.
The one thing that sapply gives you and lapply doesn't is column names. If you
attach names to orig.unique then lapply's output will have them.
Also ifelse(orig==x,1,0) slower than the equivalent as.numeric(orig==x). I
wrote functions g0 (containing your code), g1 (using lapply), and g2
(ifelse-as.numeric). I parameterized them by the number of '111' elements
and they each return the data.frame created and the time it took to do it:
g0
function(n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
time - system.time(df - as.data.frame(sapply(orig.unique, function(x)
ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g1
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) ifelse(orig == x, 1, 0
list(time = time, df = df)
}
g2
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2*n), rep(, 3*n),
rep(, 4*n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, lapply(orig.unique,
function(x) as.numeric(orig == x
list(time = time, df = df)
}
For n=10^5 the times were
g0(1e5)$time
user system elapsed
20.650.41 20.64
g1(1e5)$time
user system elapsed
2.350.052.36
g2(1e5)$time
user system elapsed
0.730.100.77
and the data.frames each produced were identical.
Another approach is to use outer() to make a matrix that gets passed to
data.frame(). It seems slightly slower than g2, but small changes might make
it faster.
g3
function (n = 1e+05) {
orig - c(rep(, n), rep(, 2 * n), rep(, 3 *
n), rep(, 4 * n))
orig.unique - unique(orig)
names(orig.unique) - orig.unique
time - system.time(df - data.frame(check.names=FALSE, outer(orig,
orig.unique, function(x, y) as.numeric(x==y
list(time = time, df = df)
}
g3(1e5)$time
user system elapsed
1.020.000.97
When you want to optimize code it is often handy to write functions like this
to do the timing for various problem sizes. You can quickly experiment with
small versions of the problem to make sure the results are correct and the time
looks reasonable and later see if the times scale up as hoped to your desired
problem size.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] tapply and more than one function, with different arguments
Hi Dennis,
now that's a very nice function, and this seems to be just what I need!
Thanks a lot!
-Heinrich.
Von: Dennis Murphy [djmu...@gmail.com]
Gesendet: Dienstag, 26. Januar 2010 19:44
An: RINNER Heinrich
Cc: r-help
Betreff: Re: [R] tapply and more than one function, with different arguments
Hi:
Using the plyr package, we can get the result as follows:
library(plyr)
my.fun - function(x, mult) mult*sum(x)
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
ddply(dat, .(grp), summarize, max = max(x), myfun = my.fun(x, 10))
grp max myfun
1 a 230
2 b 470
HTH,
Dennis
On Tue, Jan 26, 2010 at 8:26 AM, RINNER Heinrich
heinrich.rin...@tirol.gv.atmailto:heinrich.rin...@tirol.gv.at wrote:
Dear R-users,
I am working with R version 2.10.1.
Say I have is a simple function like this:
my.fun - function(x, mult) mult*sum(x)
Now, I want to apply this function along with some other (say 'max') to a
simple data.frame, like:
dat - data.frame(x = 1:4, grp = c(a,a,b,b))
Ideally, the result would look something like this (if mult = 10):
max my.fun
a 2 30
b 4 70
I have tried it that way:
apply.more.functions - function(dat, FUN = c(max, my.fun), ...) {
res - NULL
for(f in FUN) res[[f]] - tapply(dat$x, dat$grp, FUN = f, ...)
data.frame(res)
}
# let's test it:
apply.more.functions(dat, FUN = c(max, min))
max min
a 2 1
b 4 3
# perfect!
# now, with an additional argument:
apply.more.functions(dat, FUN = c(max, my.fun), mult = 10)
max my.fun
a 10 30
b 10 70
# uhuh!
Apparently, 'mult' has been used in the calculation of 'max' as well.
How can I modify apply.more.functions in order to avoid this?
Your advice would be appreciated;
Kind regards
Heinrich.
__
R-help@r-project.orgmailto:R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] Trouble Highlighting outliers on Time Series Plot
I am having trouble plotting outliers on time series.
Give then following code:
# find STL Outliers by weight and append sh2, use Robust
# this should allow the initial outliers to be filtered
# this section may be commented out.
tsSourceDiag - stl(tsSource,s.window=per, robust=TRUE)
#
tsSourceIO - which(tsSourceDiag $ weights 1e-8)
#
# This is how to append run-time regessors
for(z in tsSourceIO) {
tmpname -paste(PreIO,z,sep=)
#COPY EOM REGRESSOR AS A TEMPLATE
sh2[[tmpname]] - sh2[[EOM]]
#SET IT ALL TO 0
sh2[[tmpname]][]-FALSE
#SET The Proper Indice to TRUE
sh2[[tmpname]][z]- TRUE
}
Ok so I have a time series tsSource. I yank out the index of each
tsSourceDiag and appending it to an existing list of regressors with all
false save one that is true for the index of the suspected outlier.
I decided that a plot of the time series as points was in order and thought,
Hey I should really fill the circle that is considered an outlier red so I
can eye ball check the graph to see if that is indeed an outlier needing
agent Fox and Scully to investigate (yes my later list of outliers is in
fact called XFILES).
So I am like, BOOM! plot(tsSource) and points(tsSource[tsSourceIO]). Nada.
A plot of tsSource[tsSourceIO] reveals a hint of what is wrong. tsSource is
as time series with date info while tsSource[tsSourceIO] is just a series
with no proper alignment with the cosmic universe... errr... I mean time
series.
Anyone have some sweet voodoo on how to get a proper time series plot while
properly overplotting various indicies? (e.g. tsSeries[c=(1,22,11,61)])
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Strange tick in ggplot geom_area; and ordering, again
can you also reproduce the “triangles” problem? Is it just a trivial corollary of the order-bug? The triangles are there because you have a layer of points (from the qplot default) and layer of areas. Setting geom = area in qplot fixes that. Hadley -- http://had.co.nz/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Strange tick in ggplot geom_area; and ordering, again
In case you have a temporary workaround, it would be nice to have it. It’s a show stopper for my report. Bars are not an option, because the curve looks too jaggy. I just remember that to work around the problem, you can just manually order the data frame: cf1 - cf1[with(cf1, order(dur, score, decreasing = T)), ] qplot(dur,p,data=cf1, fill=score, order = rev(score), geom = area) Hadley -- http://had.co.nz/ __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
Ok, I read the entire posting guide and updated my signature. So I come back on my question, should I use an apply in an apply to make this? - Anna Lippel -- View this message in context: http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310922.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] problems saving an mpfr object into a file
Hi All, I have a problem cbind two vectors one is a numeric and the other is an mpfr object and then saving the result into a .csv file. I am unable to save the mpfr vector into .csv file . here is the error that I get Error in as.data.frame.default(x[[i]], optional = TRUE) : cannot coerce class mpfr1 into a data.frame any ideas? Thanks for the help -- View this message in context: http://n4.nabble.com/problems-saving-an-mpfr-object-into-a-file-tp1310857p1310857.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] large integers in R
Has there been any update on R's handling large integers greater than 10^9 (between 10^9 and 4x10^9) ? as.integer() in R 2.9.2 lists this as a restriction but doesnt list the actual limit or cause, nor if anyone was looking at fixing it. Glenn D Blanford, PhD mailto:glenn.blanf...@us.army.mil Scientific Research Corporation gblanf...@scires.commailto:gblanf...@scires.com [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] large integers in R
On 26/01/2010 3:25 PM, Blanford, Glenn wrote: Has there been any update on R's handling large integers greater than 10^9 (between 10^9 and 4x10^9) ? as.integer() in R 2.9.2 lists this as a restriction but doesnt list the actual limit or cause, nor if anyone was looking at fixing it. Integers in R are 4 byte signed integers, so the upper limit is 2^31-1. That's not likely to change soon. The double type in R can hold exact integer values up to around 2^52. So for example calculations like this work fine: x - 2^50 y - x + 1 y-x [1] 1 Just don't ask R to put those values into a 4 byte integer, they won't fit: as.integer(c(x,y)) [1] NA NA Warning message: NAs introduced by coercion Duncan Murdoch Glenn D Blanford, PhD mailto:glenn.blanf...@us.army.mil Scientific Research Corporation gblanf...@scires.commailto:gblanf...@scires.com [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Install R 2.10.1 on Windows XP Errors
I have just upgraded from 2.9.2 to 2.10.1 on my XP machine. I rec'd the following error message: Error in strsplit(x[ok], [.-]) : 5 arguments passed to .Internal(strsplit) which requires 6 I also tried update.packages(checkBuilt=TRUE, ask = FALSE) update.packages(checkBuilt=TRUE, ask=FALSE) Error: could not find function update.packages Has anyone else experienced this - what is the fix ? Thanks in advance. Steve Friedman Ph. D. Spatial Statistical Analyst Everglades and Dry Tortugas National Park 950 N Krome Ave (3rd Floor) Homestead, Florida 33034 steve_fried...@nps.gov Office (305) 224 - 4282 Fax (305) 224 - 4147 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Apply a function on an array with the parameter as an array
You can do something like this:
lapply(1:nrow(X), function(.indx, param){
X[.indx,] * param[.indx] # apply param[i] to row i of X
}, param=arrayOf Params)
On Tue, Jan 26, 2010 at 3:52 PM, anna lippelann...@hotmail.com wrote:
Ok, I read the entire posting guide and updated my signature. So I come back
on my question, should I use an apply in an apply to make this?
-
Anna Lippel
--
View this message in context:
http://n4.nabble.com/Apply-a-function-on-an-array-with-the-parameter-as-an-array-tp1310834p1310922.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
--
Jim Holtman
Cincinnati, OH
+1 513 646 9390
What is the problem that you are trying to solve?
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] Install R 2.10.1 on Windows XP Errors
On 26.01.2010 22:09, steve_fried...@nps.gov wrote: I have just upgraded from 2.9.2 to 2.10.1 on my XP machine. I rec'd the following error message: Error in strsplit(x[ok], [.-]) : 5 arguments passed to .Internal(strsplit) which requires 6 I also tried update.packages(checkBuilt=TRUE, ask = FALSE) update.packages(checkBuilt=TRUE, ask=FALSE) Error: could not find function update.packages Has anyone else experienced this - what is the fix ? The fix is not to mix up base packages for old versions of R that you have in some library in your search path with a new version of R. Best wishes, Uwe Ligges Thanks in advance. Steve Friedman Ph. D. Spatial Statistical Analyst Everglades and Dry Tortugas National Park 950 N Krome Ave (3rd Floor) Homestead, Florida 33034 steve_fried...@nps.gov Office (305) 224 - 4282 Fax (305) 224 - 4147 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] ANCOVA with measurement error in x and y
Hi,
I am looking for some tips on how to incorporate known measurement error into
the comparison of slopes in an analysis of covariance. Specifically, if I
know that each measurement comes with a 5% error, is it possible to 'expand'
the confidence intervals around the estimates for the slope of the line
passing through the data defined by the grouping variable? With standard
linear regression the confidence intervals are probably too narrow for the
slope and intercept estimates.
# example data:
# these are measured with error, by an analytical machine
x.1 - rnorm(100, mean=1, sd=1)
x.2 - rnorm(100, mean=1, sd=1)
y.1 - (x.1 / 9) + rnorm(100, mean=0, sd=0.05)
y.2 - (x.2 / 11) + rnorm(100, mean=0, sd=0.05)
# combine and add group labels
d - rbind(data.frame(x=x.1, y=y.1), data.frame(x=x.2, y=y.2))
d$id - gl(n=2, k=100, labels=c('run 1', 'run 2'))
# plot:
library(lattice)
xyplot(y ~ x, data=d, groups=id, type=c('p','r'))
# ANCOVA
summary(l - lm(y ~ x * id, data=d))
# plot confidence intervals
dotplot(confint(l), col=1, xlab='95% Conf. Int.')
Is there any way to tell if these two populations have different slopes, given
the measurement errors?
Thanks in advance,
Dylan
--
Dylan Beaudette
Soil Resource Laboratory
http://casoilresource.lawr.ucdavis.edu/
University of California at Davis
530.754.7341
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
[R] add points to 3D plot using p3d {onion}
Hi, Can anyone guide me as to how I can add points to a p3d() plot from the onion package? I want to plot points with different colors on the same 3D plot. Perhaps I can do this without adding points but somehow directing the 'h' parameter to give different color to points based on a factor I assign to them? FYI, I can do this using using scatterplot3d() and points3d(), but these plots lack perspective and hence it is hard to sense depth without the use of color. Thanks, Brad __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] unidentifiable problem..
Hi All, My R installation is acting strangely and I'm hoping somebody might have an idea what's going on: I can't seem to load the RMySQL function. It seems to have installed without a problem, but when I enter: library(RMySQL) R tells me: Error in utils::readRegistry(SOFTWARE\\MySQL AB, hive = HLM, maxdepth = 2) : Registry key 'SOFTWARE\MySQL AB' not found Error : .onLoad failed in 'loadNamespace' for 'RMySQL' Error: package/namespace load failed for 'RMySQL' Moreover, If I try to get information about a function (fisher exact test, for example) by typing: ?fisher.test R tells me: Error in shell.exec(url) : access to 'http://127.0.0.1:12625/library/stats/html/fisher.test.html' denied If I manually open, in a web browser, the html file whose address is given, I can see and read the document. I'm wondering whether there is some kind of problem with the registry (any ideas at all welcome). Thanks, Jon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] unidentifiable problem..
On 26/01/2010 4:54 PM, Jonathan wrote: Hi All, My R installation is acting strangely and I'm hoping somebody might have an idea what's going on: You need to give more details. Which R version? (If less than 2.10.1, install that and try again.) Do you have MySQL installed on that machine? (If not, install it.) Which Windows version are you using? Are you able to open other URLs from R, e.g. does browseURL(http://www.r-project.org;) work? Duncan Murdoch I can't seem to load the RMySQL function. It seems to have installed without a problem, but when I enter: library(RMySQL) R tells me: Error in utils::readRegistry(SOFTWARE\\MySQL AB, hive = HLM, maxdepth = 2) : Registry key 'SOFTWARE\MySQL AB' not found Error : .onLoad failed in 'loadNamespace' for 'RMySQL' Error: package/namespace load failed for 'RMySQL' Moreover, If I try to get information about a function (fisher exact test, for example) by typing: ?fisher.test R tells me: Error in shell.exec(url) : access to 'http://127.0.0.1:12625/library/stats/html/fisher.test.html' denied If I manually open, in a web browser, the html file whose address is given, I can see and read the document. I'm wondering whether there is some kind of problem with the registry (any ideas at all welcome). Thanks, Jon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] library.dynam
hi, i'm having some trouble getting a package to load a shared library
object in .onLoad(...)
i have a shared object file, say mylib.so.
if i start an R session, and via the CLI specify the actual library
via:
dyn.load(mylib.so)
everything works quite well (i.e. i can then follow with some .Call
(...) methods)
now, i'd like to include this shared library in my package.
assume that the .c file has already been compiled and i have the .so
file at some PATH.
in my zzz.R file i include:
.onLoad - function(libname, pkgname) {
library.dynam(mylib, lib.loc = PATH)
}
when i load the package, however, i get:
Error in .find.package(package, lib.loc, verbose = verbose) :
there are no packages called 'RCurl', 'bitops', 'rjson', 'stats',
'graphics', 'grDevices', 'utils', 'datasets', 'methods', 'base'
so it appears i need to specify the package name, so if i change the
call to:
library.dynam(mylib, pkgname, lib.loc = PATH), i get:
Error in .find.package(package, lib.loc, verbose = verbose) :
there is no package called 'mypackage'
Error : .onLoad failed in 'loadNamespace' for 'mypackage'
which makes sense because the package namespace isn't attached yet.
so i'm not really sure what to specify for the package parameter of
library.dynam.
i've elected to try to use library.dynam() instead of useDynLib() in
the NAMESPACE file because this is a VERY customized package and the
library i'm using will change often enough and will probably be placed
in a non-standard location on the user's system.
ideas?
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] library.dynam
to clarify the example a bit, assume that for lib.loc i always want to
search the current working directory of the R session (thus forcing
the user to have mylib.so sitting in the directory returned by getwd()
when loading the package).
NOTE: this is not how i will finally implement this package, but is a
temporary requirement for my writing this package for some colleagues.
On Jan 26, 5:16 pm, Murat Tasan mmu...@gmail.com wrote:
hi, i'm having some trouble getting a package to load a shared library
object in .onLoad(...)
i have a shared object file, say mylib.so.
if i start an R session, and via the CLI specify the actual library
via: dyn.load(mylib.so)
everything works quite well (i.e. i can then follow with some .Call
(...) methods)
now, i'd like to include this shared library in my package.
assume that the .c file has already been compiled and i have the .so
file at some PATH.
in my zzz.R file i include:
.onLoad - function(libname, pkgname) {
library.dynam(mylib, lib.loc = PATH)
}
when i load the package, however, i get:
Error in .find.package(package, lib.loc, verbose = verbose) :
there are no packages called 'RCurl', 'bitops', 'rjson', 'stats',
'graphics', 'grDevices', 'utils', 'datasets', 'methods', 'base'
so it appears i need to specify the package name, so if i change the
call to:
library.dynam(mylib, pkgname, lib.loc = PATH), i get:
Error in .find.package(package, lib.loc, verbose = verbose) :
there is no package called 'mypackage'
Error : .onLoad failed in 'loadNamespace' for 'mypackage'
which makes sense because the package namespace isn't attached yet.
so i'm not really sure what to specify for the package parameter of
library.dynam.
i've elected to try to use library.dynam() instead of useDynLib() in
the NAMESPACE file because this is a VERY customized package and the
library i'm using will change often enough and will probably be placed
in a non-standard location on the user's system.
ideas?
__
r-h...@r-project.org mailing listhttps://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guidehttp://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.
Re: [R] heatmap.2 color range
thanks, I think I got the color ranges down, however, I just realized that the colors don't match the data. When I execute: grad - ifelse(randMat 5,yelPal,ifelse(randMat1.5,redPal,bluPal)) the grad matrix contains the correct hex codes corresponding to the randMat data matrix but when I run: heatmap(randMat, Rowv=NA, Colv=NA, col = grad, scale=none, margins=c(5,10)) The colors displayed don't match up. I'm not sure if it's re-ordering the data somehow but I'm not getting any warning or errors and can't find any similiar postings. -- View this message in context: http://n4.nabble.com/heatmap-2-color-range-tp1293498p1311023.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] heatmap.2 color range
also, can you point me to some example of how to omit colors from a palette -- View this message in context: http://n4.nabble.com/heatmap-2-color-range-tp1293498p1311031.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
