Re: [SLUG] Re: Creating PDFs
Terry Collins wrote: > > Mike Lake wrote: > > > > Terry wrote > > ! Undefined control sequence. > > l.4 \documentclass > > [a4paper,12pt]{report} > > ? > > > > And it repeats for every latex command > > Well, at least the first 10. > > > > What does it do if you try latex ie not pdflatex ? > > Works fine for latex. Right then we do have a valid LaTeX file not a Tex file. > By going latex -> dvips -> ps2pdf -> I can get a pdf with fuzzy text. So > I'm assuming that there is nothing wrong with the document. Thats a different problem. The fonts in the PDF are bitmapped and that can be solved easy. We will tackle that later by embedding the fonts or using PS TYpe 1 fonts instead. . > > Is there anything in the file before \documentclass that might be > > causing the error? > > % This is /home/terryc/latex/terryc/resumes/2002/20020417.tex > % Updated by Terry Collins on 20020417. Thats OK. > That is the $64K question. I can not see anything, but latex > occcassionally seems to find phantoms. Retyping those lines made no > difference. Removing those lines made no difference. Guess I just have > to wait for the wind to change {:-). Following Gus's suggestion, I will > just start with a simple one pager, then two, etc until I work out what > it doesn't like. Yep. Just have one paragraph after the begin{document} and before the \end{document}. See if it barfs on that. Mike -- Available signature space taken up by legal waffle, insufficient space for normal signature. UTS CRICOS Provider Code: 00099F DISCLAIMER = This email message and any accompanying attachments may contain confidential information. If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or attachments. If you have received this message in error, please notify the sender immediately and delete this message. Any views expressed in this message are those of the individual sender, except where the sender expressly, and with authority, states them to be the views the University of Technology Sydney. Before opening any attachments, please check them for viruses and defects. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
On Thu, Apr 18, 2002 at 03:14:12PM +1000, Terry Collins wrote: > Angus Lees wrote: > > On Thu, Apr 18, 2002 at 01:12:29PM +1000, Terry Collins wrote: > > > Angus Lees wrote: > > > > At Wed, 3 Apr 2002 11:39:31 +1000, marty wrote: > > > > > what tools are people using to create PDFs? > > > > > > > > i use pdftex (or rather, pdflatex). > > > > > > Can I ask how? > > > both pdftex & pdflatex just reject all the latex stuff with !undefined > > > control sequence and the doco is no help. > > > > hmm.. it just works for me (unless you do something silly like try and > > use pstricks) > > Okay, that means I'm fundamentally doing the correct thing. Just a few > crinkles involved > > > > > what version of pdftex (--version) ? > > [terryc@owl 2002]$ pdftex -version > pdfTeX (Web2C 7.3.1) 3.14159-0.13d 0.13d is *ancient* (by pdftex standards) my (standard debian "unstable" tetex packages) have: pdfTeX (Web2C 7.3.7) 3.14159-1.00a-pretest-2004-ojmw iirc, the latest pdftex release is 1.00b-pretest and included in tex live. its possible to compile a newer pdftex and drop it over an existing install (i've done it). you have to remember to rebuild the pdflatex format, and install the relevant .pool files - not just the pdftex binary. > > which tex installation? version? (distro?) > > Whatever came on the RH7.1 CDs from Everything Linux. I haven't upgraded > anything yet. redhat use the latest stable release of tetex. everyone else (suse, debian, tex live) are using tetex-beta. the only places where tex is evolving fast enough these days for that to be a problem is pdftex and context. if you need either of these, always look around for a newer version. it looks like thomas esser will be releasing a new "stable" version of tetex fairly soon though. -- - Gus -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
On Thu, Apr 18, 2002 at 01:47:48PM +1000, Terry Collins wrote: > > [terryc@owl 2002]$ pdftex 20020417-perm.tex You're running TeX (well, pdftex)... > (20020417-perm.tex[/usr/share/texmf/pdftex/config/pdftex.cfg] > Babel and hyphenation patterns for american, french, german, > ngerman, i > talian, portuges, russian, spanish, nohyphenation, loaded. > ! Undefined control sequence. > l.4 \documentclass > [a4paper,12pt]{report} > ? > > And it repeats for every latex command ...but you say it's a LaTeX document. Do you get the same problem if you use pdflatex instead of pdftex? If not, does it work, or what error does it give? -Andrew. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [Re: [SLUG] newbie to Linux]
>"..Thirdly, I have a largish HDD, and rather than re-format the whole thing, if I could somehow 'create' a multiboot with Linux/Windoze over my existing system, it would be better. I've heard lots of different stuff, the upshot was that most say you can't, and one guy said you can, with Partition Magic. Any ideas?..." >If its a FAT partition you can use FIPS (www.igd.fhg.de/~aschaefe/fips/) to resize it. Its free and worked for me without any dramas when I first installed linux ~6 months ago. It may already be on your distributions cd. I think there is a GNU tool called parted which does a similar thing but don't know much about it. *** I have used Partition Magic (www.powerquest.com) to resize partitions. How is your HDD partitioned at present. Is it just one whole chunk with windows ? What is your HDD size ? What you can do is shrink the first partition which I presume is Windows. You can install Linux right next to it. But beware you may not be able to install /swap though. It would not do it for me. As for booting between the two I used Boot Magic [BM](include with Partition magic). Install in Windows, and after Linux is installed, BM will see it. Just add it to your boot menu . Or better yet you can use VMWare for Windows or Linux. With VMware from within either Linux or Windows (depending on for which OS version you get) you can switch between them without having to reboot your PC to change OS. It creates a Virtual Machine for each OS you install. Just install VMWare for Windows, run it, create a Virtual machine for Linux, Power On, and load your Linux CD in. This will install Linux, and then you can boot to it from within Windows. Louis. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Printing: Software or Hardware problem?
Crossfire was once rumoured to have said: > ben_donohue was once rumoured to have said: > > Ah, well, hope i don't get flamed for this on a Linux list but... > > > > Back in my DOS days i'd do a... > > dir>lpt1: > > which would do a directory listing to the printer. So it's a lower down test > > than an application printing. > > > > maybe there is a Linux equiv. like... > > ls>/dev/lp0 or something from the console and not from an application? > > Something i'd like to know anyway. > > If you have lpr/lpd configured correctly, > > ls | lpr > > should work. Should have read back in the thread. You can try pumping output raw to /dev/lp[012], or /dev/usb/lp0, or whatever your printer is connected as - I certainly don't recommend it however since various modern printers don't support raw-ascii printing. Also, check dmesg to see if you're getting printer port error messages there - they can also provide insight into whats going wrong. C. -- --==-- Crossfire | This email was brought to you [EMAIL PROTECTED] | on 100% Recycled Electrons --==-- -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Printing: Software or Hardware problem?
ben_donohue was once rumoured to have said: > Ah, well, hope i don't get flamed for this on a Linux list but... > > Back in my DOS days i'd do a... > dir>lpt1: > which would do a directory listing to the printer. So it's a lower down test > than an application printing. > > maybe there is a Linux equiv. like... > ls>/dev/lp0 or something from the console and not from an application? > Something i'd like to know anyway. If you have lpr/lpd configured correctly, ls | lpr should work. However, in this moder age of intelligent printers, you might want to use an ascii to postscript filter, and let lpr/lpd use ghostscript to convert it back to your printer's native control language. mpage is my personal favourite - using mpage, it'd be more along the lines of: ls | mpage -2 -ba4 -Plp to do a 2up print on a sheet of a4. C. -- --==-- Crossfire | This email was brought to you [EMAIL PROTECTED] | on 100% Recycled Electrons --==-- -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] ask a common question
On Wed, 17 Apr 2002, henry wrote: > Sometimes I make Makefile ,I get lots of error messages so that I cant look them in >time. > I try to "make > tmp.log" , but it fail (I cant dump those error message into >tmp.log). > Could someone show a good solution ? Depending on the length of your output, simply press shift and page up. As long as you haven't changed virtual consoles {I.E. pressed ALT F2 or similar}, you can scroll back to the end of your video buffer - usually 5 or 6 pages worth. DaZZa -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Terry Collins <[EMAIL PROTECTED]> writes: > [terryc@owl 2002]$ pdftex 20020417-perm.tex > This is pdfTeX, Version 3.14159-13d (Web2C 7.3.1) > (20020417-perm.tex[/usr/share/texmf/pdftex/config/pdftex.cfg] > Babel and hyphenation patterns for american, french, german, > ngerman, i > talian, portuges, russian, spanish, nohyphenation, loaded. > ! Undefined control sequence. > l.4 \documentclass > [a4paper,12pt]{report} > ? > > And it repeats for every latex command pdftex is "equivalent" to tex and can only run with plain TeX. If your LaTeX document doesn't include any EPS/PS, pdflatex should work. Here is template so that you can run both latex and pdflatex: %% Preamble \ifx\pdfoutput\undefined% We're not running pdftex \documentclass[a4paper,12pt]{report} \else \documentclass[pdftex,a4paper,12pt]{report} %% More options described in pdfTeX manual \pdfcompresslevel=9 \pdfinfo { /Title (Title of Document) /Author (Your Name) /Subject (???) /Keywords (???) } \fi ... \begin{document} ... %% Example of including figures: pdflatex supports PDF, PNG and JPEG graphics \begin{figure} \centering \ifx\pdfoutput\undefined \includegraphics{fig.eps} \else \includegraphics{fig.pdf} \fi \end{figure} ... \end{documnent} -- Triet H. Lai -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Mike Lake wrote: > > Terry wrote > ! Undefined control sequence. > l.4 \documentclass > [a4paper,12pt]{report} > ? > > And it repeats for every latex command Well, at least the first 10. > > What does it do if you try latex ie not pdflatex ? Works fine for latex. By going latex -> dvips -> ps2pdf -> I can get a pdf with fuzzy text. So I'm assuming that there is nothing wrong with the document. > What does it do if you use article class instead of report for latex or > pdflatex. Same problem > Is there anything in the file before \documentclass that might be > causing the error? % This is /home/terryc/latex/terryc/resumes/2002/20020417.tex % Updated by Terry Collins on 20020417. That is the $64K question. I can not see anything, but latex occcassionally seems to find phantoms. Retyping those lines made no difference. Removing those lines made no difference. Guess I just have to wait for the wind to change {:-). Following Gus's suggestion, I will just start with a simple one pager, then two, etc until I work out what it doesn't like. Thanks. -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] newbie to Linux
"..Thirdly, I have a largish HDD, and rather than re-format the whole thing, if I could somehow 'create' a multiboot with Linux/Windoze over my existing system, it would be better. I've heard lots of different stuff, the upshot was that most say you can't, and one guy said you can, with Partition Magic. Any ideas?..." If its a FAT partition you can use FIPS (www.igd.fhg.de/~aschaefe/fips/) to resize it. Its free and worked for me without any dramas when I first installed linux ~6 months ago. It may already be on your distributions cd. I think there is a GNU tool called parted which does a similar thing but don't know much about it. Steve. ps. still quite newbie-ish myself so don't know the answer to your other q's.. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] Printing: Software or Hardware problem?
Ah, well, hope i don't get flamed for this on a Linux list but... Back in my DOS days i'd do a... dir>lpt1: which would do a directory listing to the printer. So it's a lower down test than an application printing. maybe there is a Linux equiv. like... ls>/dev/lp0 or something from the console and not from an application? Something i'd like to know anyway. Ben -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] newbie to Linux
Hi All, Newbie alert! Let me first introduce myself. My name is Ian Nicoll. Any of you out there who know me 'hi'. To those who don't know me..'hi'. I've been interested in computers for many years now, and been interested in Linux for about 3 or 4 years, but just haven't managed to get it going yet. I am now having some problems with my computer, and am thinking 'stuff it, lets re-format the whole damned thing, start from scratch and install Linux'. Probably I'll chicken out and go Linux with a multi-boot into Windoze. I guess I have a couple of preliminary questions: Firstly, I'm running a system with a NVIDIA GeForce2 as the graphics card. I noted on the NVIDIA website that they had drivers for Linux, which is good, HOWEVER, I also noted that when I downloaded my new updated drivers for Win95/98 that my problems started. Secondly, are there any decent DVD drivers out there that will allow me to watch my vast collection of DVD's (one disk) on my computer and on my TV through the NVIDIA card? Thirdly, I have a largish HDD, and rather than re-format the whole thing, if I could somehow 'create' a multiboot with Linux/Windoze over my existing system, it would be better. I've heard lots of different stuff, the upshot was that most say you can't, and one guy said you can, with Partition Magic. Any ideas? Fourth, if I CAN'T do #3 is it easy/possible to setup a new hard drive and boot between the two? I think that is enough questions for today. See ya all (or those that I see) on Friday week. Ian -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Printing: Software or Hardware problem?
Geoffrey Cowling wrote: Have you tried another printer cable? -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] Printing: Software or Hardware problem?
Is there a command to send a signal to a printer to see if parallel port is working? I have lost all printing (and am hopelessly lost in the Printing HOWTO also). I have had intermittent printing problems for some time (after upgrading to RH 7.2, from 7.0, which may or may not have any relevance)-- a print job might start suddenly 1/2 hour after it was started -- plain ASCII file, or a .png might print immediately. A short .dvi might print, a long one print,slowly, 6 pages and then time out. (Sometimes "waiting for subserver to end" or "processing", but generally lpq showed all well, and lp0 "busy") I removed cable to try another printer, which failed completely. Now my inkjet will not print at all. Is it possible that the parallel port -- which is not well supported on the box--has broken connection on the motherboard rather than it being a linux problem? Can I find out? *Plea for sympathy* :-) as an old guy I find myself empathising with Linuxchix--wherever do you go for basic help without feeling a fool or a tedious bore ... read what manual?? --Geoffrey GATCAATGAGGTGGACACCAGAGGCACTTGTAAATAACACTGGGCTGTAGGAGTGA -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Terry wrote ! Undefined control sequence. l.4 \documentclass [a4paper,12pt]{report} ? And it repeats for every latex command What does it do if you try latex ie not pdflatex ? What does it do if you use article class instead of report for latex or pdflatex. Is there anything in the file before \documentclass that might be causing the error? -- One way to make your old car run better is to look up the price of a new model. Michael Lake, University of Technology, Sydney Work: [EMAIL PROTECTED] Ph: 02 9514 1724 Fx: 02 9514 1628 Home: http://www.speleonics.com.au Linux enthusiast, active caver and interested in anything technical. *** UTS CRICOS Provider Code: 00099F DISCLAIMER = This email message and any accompanying attachments may contain confidential information. If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or attachments. If you have received this message in error, please notify the sender immediately and delete this message. Any views expressed in this message are those of the individual sender, except where the sender expressly, and with authority, states them to be the views the University of Technology Sydney. Before opening any attachments, please check them for viruses and defects. = -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Michael Lake wrote: > > Terry Collins wrote: > > Can I ask how? > > both pdftex & pdflatex just reject all the latex stuff with !undefined > > control sequence and the doco is no help. > > Details [terryc@owl 2002]$ pdftex 20020417-perm.tex This is pdfTeX, Version 3.14159-13d (Web2C 7.3.1) (20020417-perm.tex[/usr/share/texmf/pdftex/config/pdftex.cfg] Babel and hyphenation patterns for american, french, german, ngerman, i talian, portuges, russian, spanish, nohyphenation, loaded. ! Undefined control sequence. l.4 \documentclass [a4paper,12pt]{report} ? And it repeats for every latex command -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Terry Collins wrote: > Can I ask how? > both pdftex & pdflatex just reject all the latex stuff with !undefined > control sequence and the doco is no help. Details -- Michael Lake University of Technology, Sydney Email: mailto:[EMAIL PROTECTED] Ph: 02 9514 1724 Fx: 02 9514 1628 Linux enthusiast, active caver and interested in anything technical. UTS CRICOS Provider Code: 00099F DISCLAIMER = This email message and any accompanying attachments may contain confidential information. If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or attachments. If you have received this message in error, please notify the sender immediately and delete this message. Any views expressed in this message are those of the individual sender, except where the sender expressly, and with authority, states them to be the views the University of Technology Sydney. Before opening any attachments, please check them for viruses and defects. = -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] (FWD) The Microsoft penalty that isn't - Tech News -CNET.com
Doug Foskey wrote: > I agree (sometimes with KF. BUT, we could set up a check for 'M$' in the > code, & so generate another 'BSofD' for M$. (They would be so silly they > probably would never check for the foreign code enclosed - otherwise why dont > they fix some of the existing bugs?? ) yeah have something in code like. if (M$) { load into browser file://c:\con\con } elseif (Linux) { be nice } -- Michael Lake University of Technology, Sydney Linux enthusiast, active caver and interested in anything technical. UTS CRICOS Provider Code: 00099F DISCLAIMER = This email message and any accompanying attachments may contain confidential information. If you are not the intended recipient, do not read, use, disseminate, distribute or copy this message or attachments. If you have received this message in error, please notify the sender immediately and delete this message. Any views expressed in this message are those of the individual sender, except where the sender expressly, and with authority, states them to be the views the University of Technology Sydney. Before opening any attachments, please check them for viruses and defects. = -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Re: Creating PDFs
Angus Lees wrote: > > At Wed, 3 Apr 2002 11:39:31 +1000, marty wrote: > > what tools are people using to create PDFs? > > i use pdftex (or rather, pdflatex). Can I ask how? both pdftex & pdflatex just reject all the latex stuff with !undefined control sequence and the doco is no help. -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] Dual boot Macs
Dear list, Is there a program for Macs similar to Partion Magic? reg -- Richard Hayes Talent Internet http://www.talent.com.au Tel: (02) 9439 8300 Fax: (02) 9439 8327 Mob: 0414 618 425 ABN 94 002 775 215 -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] (FWD) The Microsoft penalty that isn't - Tech News - CNET.com
Of course, if you own the entire copyright on your GPL application/code you don't have a problem. Just require anyone that wants to run your application on Windows to buy a commercial liscence... It avoids the Microsoft liscence problem, and encourages people to move to linux, especially when you tell them that the version for Windows is exactly the same as the version for linux, and the only reason you have to charge them to use it on Windows is that Microsoft won't allow you to give them the program free ( beer and libre ). :) Of course, I'm being a little overly simplistics, but the tactic appeals to me, at least in a "send me a free pizza to use my program on Windows" kind of way. Adam -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]]On Behalf Of Doug Foskey Sent: Thursday, 18 April 2002 1:17 PM To: SLUG List Subject: Re: [SLUG] (FWD) The Microsoft penalty that isn't - Tech News - CNET.com I agree (sometimes with KF. BUT, we could set up a check for 'M$' in the code, & so generate another 'BSofD' for M$. (They would be so silly they probably would never check for the foreign code enclosed - otherwise why dont they fix some of the existing bugs?? ) DF -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] (FWD) The Microsoft penalty that isn't - Tech News - CNET.com
I agree (sometimes with KF. BUT, we could set up a check for 'M$' in the code, & so generate another 'BSofD' for M$. (They would be so silly they probably would never check for the foreign code enclosed - otherwise why dont they fix some of the existing bugs?? ) DF -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] PDA Sharp SL5500
My apologies if this has done the rounds already? Has anyone used the Sharp SL5500 PDA (running Linux) and if so what is it like? -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: Fw: [SLUG] ask a common question
how about "make &> tmp.log" or even "make > tmp.log 2>&1" BB on Thu, Apr 18, 2002 at 11:27:32AM +1000, Karun <[EMAIL PROTECTED]> wrote: > > > > You could use the script command > and run something like > script tmp.log > make > exit > > Karun > - Original Message - > From: henry > To: [EMAIL PROTECTED] > Sent: Wednesday, April 17, 2002 7:10 PM > Subject: [SLUG] ask a common question > > > Dear List : > > Sometimes I make Makefile ,I get lots of error messages so that I cant look > them in time. > I try to "make > tmp.log" , but it fail (I cant dump those error message > into tmp.log). > Could someone show a good solution ? > > BestRegards' > Henry > > > === > This mail checked by Mcafee outbound getway in Zinwell. > === > > > -- > SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ > More Info: http://lists.slug.org.au/listinfo/slug -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Sync of filesystem on multiple SCSI hosts
Wienand Ian wrote: ..snip > i've never seen anything like this -- two pc's essentially using a single > disk. FYI - DEC has Storageworks, which essentially allows hard disks to be partitioned and amalgamated into virtual hard disks and accessable to different machines. It was accessed by SCSI buses. -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] ask a common question
::> ::>I use shift-pageup to scroll back up in the xterm or console. ::> I think 'xterm*saveLines: 500' in .Xdefaults will increase the xterm screen buffer size. (I stand corrected on this). Also: % (make) >& tmp.log Regards, Rajnish -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] Sync of filesystem on multiple SCSI hosts
On Thu, 18 Apr 2002, Wienand Ian wrote: > firstly what file system are you using? i can't see this working with any > standard non distributed file system. It will work with most filesystems as long as the two machines coordinate meta-data usage. It may not be quick with some filesystems. > i've never seen anything like this -- two pc's essentially using a single > disk. DEC clusters have had this feature for years, which is exactly why SCSI allows it. > i can't see how this setup can guarantee normal unix semantics You need to run a 'distributed lock manager' to share and sequence meta-data changes and to retain file lock semantics. There are a few projects working on this, and Compaq recently contributed DEC's DLM code to the high availability Linux effort. > the scsi bus handles putting blocks onto the disk, and that is all SCSI also allows the disk itself to run a filesystem. See the Object Based Storage Devices Command Set. Of course, your disk has to support OSD for this to be an option, and only disks in supercomputer clusters do this today. But now the code has been written it's only a matter of time before it appears on commodity storage. The choices today are to be cutting-edge and run a DLM. Or to run a networked file system on one of the machines (with a necessary performance hit). Or not to use both disks hosts at once (eg: to allow failover rather than load-sharing). -- Glen Turner Network Engineer (08) 8303 3936 Australian Academic and Research Network [EMAIL PROTECTED] http://www.aarnet.edu.au/ -- The revolution will not be televised, it will be digitised -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] Why
Hi all quick question I keep getting this error in my logs. The only thing is I don't have a /home/jeff/.forward and what is /home/jeff/.forward.dalston. Apr 17 22:00:06 dalston sendmail[23944]: g3HC05123944: forward /home/jeff/.forward.dalston: Group writable directory Apr 17 22:00:06 dalston sendmail[23944]: g3HC05123944: forward /home/jeff/.forward: Group writable directory TIA Jeff -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Sync of filesystem on multiple SCSI hosts
Matthew Hannigan was once rumoured to have said: > Grant, > > Some names that come to mind are coda, gfs or the latest > (and greatest?) is inter-mezzo coda and intermezzo are the wrong things (tm). They're distributed filesystems, not cluster/glboal filesystems. gfs (as in the real gfs, not the gnome vfs) is designed for this sort of solution, but does have some other requirements, like the servers being able to take each other down in the case of coherancy-loss. I believe Vertias Volume manager (or whatever its called) can also deal with multiport storage. C. -- --==-- Crossfire | This email was brought to you [EMAIL PROTECTED] | on 100% Recycled Electrons --==-- -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Fw: [SLUG] ask a common question
You could use the script command and run something like script tmp.log make exit Karun - Original Message - From: henry To: [EMAIL PROTECTED] Sent: Wednesday, April 17, 2002 7:10 PM Subject: [SLUG] ask a common question Dear List : Sometimes I make Makefile ,I get lots of error messages so that I cant look them in time. I try to "make > tmp.log" , but it fail (I cant dump those error message into tmp.log). Could someone show a good solution ? BestRegards' Henry === This mail checked by Mcafee outbound getway in Zinwell. === -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] ask a common question
This one time, at band camp, henry wrote: > >Dear List : > >Sometimes I make Makefile ,I get lots of error messages so that I cant look >them in time. >I try to "make > tmp.log" , but it fail (I cant dump those error message into >tmp.log). >Could someone show a good solution ? I use shift-pageup to scroll back up in the xterm or console. -- [EMAIL PROTECTED] http://spacepants.org/jaq.gpg -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Sync of filesystem on multiple SCSI hosts
Grant, I agree with Ian! I think you're heading for major pain. You should not mount filesystems simulataneously! Have a read around for cluster (or global) filesystems. Some names that come to mind are coda, gfs or the latest (and greatest?) is inter-mezzo I have used that setup under solaris, but that was using solaris8's cluster 3 software which used their gfs. Regards, -Matt Wienand Ian wrote: > firstly what file system are you using? i can't see this working with any > standard non distributed file system. > > i've never seen anything like this -- two pc's essentially using a single > disk. but everything makes me think that this would not be a good solution > as i can't think of any file system that was developed to be used like this. > the problem is one of abstraction; the scsi bus handles putting blocks onto > the disk, and that is all. the os filesystem functions organise those > blocks into an entity that is file system. a user space protocol and > daemons such as NFS can handle multiple accesses and sort them out for > handing down the chain. > > i can't see how this setup can guarantee normal unix semantics ; i.e. a read > after write returns the value just written and two writes returns the latest > write. if this fails, then so does everything built ontop of it. why you > can't see updates i don't know, but i think that would only be a symptom of > a larger problem. > > for what it's worth, i can't see this working without some sort of > distributed file system, e.g. nfs or samba. failing that, you would have to > write your own file system that implements some sort of session semantics, > immutable files or atomic transactions or some other scheme you think of > yourself. sounds like fun but probably not the easiest way to solve the > problem. > > i'm happy to be corrected on any of the above points, however. > > -i > >>-Original Message- >>From: Grant Parnell [SMTP:[EMAIL PROTECTED]] >>Sent: Thursday, April 18, 2002 10:40 AM >>To: [EMAIL PROTECTED] >>Subject: [SLUG] Sync of filesystem on multiple SCSI hosts >> >>I have a client with the following setup: >> >> __ >> | | >> | Firewire storage | >> |__| >> || >> || >> |_ _| >>| || | >>| Server A || Server B | >>|__||__| >> >>This is not an NFS mount, the box has multiple SCSI buses. >> >>Both Server A and Server B mount the same filesystem and my client says >>that when files are written by Server A the only way they can be seen on >>Server B is to unmount the filesystem and re-mount it. I did suggest using >>the sync option when mounting the filesystems and also trying the sync >>command but this didn't help. >> >>Effectively we need to lose the linux filesystem buffers (and yes, all the >>efficiency that goes with that) I think but I don't know how to do that. >> >>Possibly this could be done periodically on each server to allow some >>level of filesystem efficiency but I'm guessing this would be more >>trouble. >> >>If this isn't easy I'm going to have to suggest NFS... wonder if you can >>do NFS over SCSI? I've heard of TCP/IP over SCSI I think. I do not know if >>the Servers can see each other on the SCSI buses, certainly not visible in >>/proc/scsi areas so my guess is no. >> >>-- >>-- >>Grant Parnell - senior consultant >>For all your Linux Commercial quality support and consulting needs >>Web: http://www.linuxhelp.com.au Email: [EMAIL PROTECTED] >>For retail sales see http://www.everythinglinux.com.au >>Phone 02 8753 0792 to book service. >> >>-- >>SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ >>More Info: http://lists.slug.org.au/listinfo/slug > > ** > CAUTION: This message may contain confidential information intended only for the use >of the addressee named above. If you are not the intended recipient of this message, >any use or disclosure of this message is prohibited. If you received this message in >error please notify Mail Administrators immediately. You must obtain all necessary >intellectual property clearances before doing anything other than displaying this >message on your monitor. There is no intellectual property licence. Any views >expressed in this message are those of the individual sender and may not necessarily >reflect the views of Woolworths Ltd. > ** -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] Sync of filesystem on multiple SCSI hosts
Weird, man. Why not re-arrange it like this: _ | | | NAS storage | |_| | | ethernet __|__ | | | hub | |_| ||___ || |ethernet| ethernet |_ _| | || | | Server A || Server B | |__||__| NASs (look in the Harris Tech catalogue) http://www.ht.com.au might not be as fast as direct SCSI connection but they do allow NFS connections and, well, NFS is a bit like magic. Both machines would be able to "see" the mounted partition provided it was mounted as NFS. Warning: some of the NASs run Windoze; avoid if you are using it with an all-Linux system as you are only paying for a license you don't need (blablabla). Cheers, Jill. -- Jill Rowling, Snr Des. Eng. & Unix System Administrator Eng. Systems Dept, Aristocrat Technologies Australia Level 2, 55 Mentmore Ave Rosebery NSW 2018 Phone: (02) 9697-4484 Fax: (02) 9663-1412 Email: [EMAIL PROTECTED] -Original Message- From: Wienand Ian [mailto:[EMAIL PROTECTED]] Sent: Thursday, 18 April 2002 11:07 To: 'Grant Parnell' Cc: [EMAIL PROTECTED] Subject: RE: [SLUG] Sync of filesystem on multiple SCSI hosts firstly what file system are you using? i can't see this working with any standard non distributed file system. i've never seen anything like this -- two pc's essentially using a single disk. but everything makes me think that this would not be a good solution as i can't think of any file system that was developed to be used like this. the problem is one of abstraction; the scsi bus handles putting blocks onto the disk, and that is all. the os filesystem functions organise those blocks into an entity that is file system. a user space protocol and daemons such as NFS can handle multiple accesses and sort them out for handing down the chain. i can't see how this setup can guarantee normal unix semantics ; i.e. a read after write returns the value just written and two writes returns the latest write. if this fails, then so does everything built ontop of it. why you can't see updates i don't know, but i think that would only be a symptom of a larger problem. for what it's worth, i can't see this working without some sort of distributed file system, e.g. nfs or samba. failing that, you would have to write your own file system that implements some sort of session semantics, immutable files or atomic transactions or some other scheme you think of yourself. sounds like fun but probably not the easiest way to solve the problem. i'm happy to be corrected on any of the above points, however. -i > -Original Message- > From: Grant Parnell [SMTP:[EMAIL PROTECTED]] > Sent: Thursday, April 18, 2002 10:40 AM > To: [EMAIL PROTECTED] > Subject: [SLUG] Sync of filesystem on multiple SCSI hosts > > I have a client with the following setup: > >__ > | | > | Firewire storage | > |__| > || > || > |_ _| > | || | > | Server A || Server B | > |__||__| > > This is not an NFS mount, the box has multiple SCSI buses. > > Both Server A and Server B mount the same filesystem and my client says > that when files are written by Server A the only way they can be seen on > Server B is to unmount the filesystem and re-mount it. I did suggest using > the sync option when mounting the filesystems and also trying the sync > command but this didn't help. > > Effectively we need to lose the linux filesystem buffers (and yes, all the > efficiency that goes with that) I think but I don't know how to do that. > > Possibly this could be done periodically on each server to allow some > level of filesystem efficiency but I'm guessing this would be more > trouble. > > If this isn't easy I'm going to have to suggest NFS... wonder if you can > do NFS over SCSI? I've heard of TCP/IP over SCSI I think. I do not know if > the Servers can see each other on the SCSI buses, certainly not visible in > /proc/scsi areas so my guess is no. > > -- > -- > Grant Parnell - senior consultant > For all your Linux Commercial quality support and consulting needs > Web: http://www.linuxhelp.com.au Email: [EMAIL PROTECTED] > For retail sales see http://www.everythinglinux.com.au > Phone 02 8753 0792 to book service. > > -- > SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ > More Info: http://lists.slug.org.au/listinfo/slug ** CAUTION: This message may contain confidential information intended only for the use of the addressee named above. If you are not the intended recipient of this message, any use or disclosure of this message is prohibi
RE: [SLUG] Sync of filesystem on multiple SCSI hosts
firstly what file system are you using? i can't see this working with any standard non distributed file system. i've never seen anything like this -- two pc's essentially using a single disk. but everything makes me think that this would not be a good solution as i can't think of any file system that was developed to be used like this. the problem is one of abstraction; the scsi bus handles putting blocks onto the disk, and that is all. the os filesystem functions organise those blocks into an entity that is file system. a user space protocol and daemons such as NFS can handle multiple accesses and sort them out for handing down the chain. i can't see how this setup can guarantee normal unix semantics ; i.e. a read after write returns the value just written and two writes returns the latest write. if this fails, then so does everything built ontop of it. why you can't see updates i don't know, but i think that would only be a symptom of a larger problem. for what it's worth, i can't see this working without some sort of distributed file system, e.g. nfs or samba. failing that, you would have to write your own file system that implements some sort of session semantics, immutable files or atomic transactions or some other scheme you think of yourself. sounds like fun but probably not the easiest way to solve the problem. i'm happy to be corrected on any of the above points, however. -i > -Original Message- > From: Grant Parnell [SMTP:[EMAIL PROTECTED]] > Sent: Thursday, April 18, 2002 10:40 AM > To: [EMAIL PROTECTED] > Subject: [SLUG] Sync of filesystem on multiple SCSI hosts > > I have a client with the following setup: > >__ > | | > | Firewire storage | > |__| > || > || > |_ _| > | || | > | Server A || Server B | > |__||__| > > This is not an NFS mount, the box has multiple SCSI buses. > > Both Server A and Server B mount the same filesystem and my client says > that when files are written by Server A the only way they can be seen on > Server B is to unmount the filesystem and re-mount it. I did suggest using > the sync option when mounting the filesystems and also trying the sync > command but this didn't help. > > Effectively we need to lose the linux filesystem buffers (and yes, all the > efficiency that goes with that) I think but I don't know how to do that. > > Possibly this could be done periodically on each server to allow some > level of filesystem efficiency but I'm guessing this would be more > trouble. > > If this isn't easy I'm going to have to suggest NFS... wonder if you can > do NFS over SCSI? I've heard of TCP/IP over SCSI I think. I do not know if > the Servers can see each other on the SCSI buses, certainly not visible in > /proc/scsi areas so my guess is no. > > -- > -- > Grant Parnell - senior consultant > For all your Linux Commercial quality support and consulting needs > Web: http://www.linuxhelp.com.au Email: [EMAIL PROTECTED] > For retail sales see http://www.everythinglinux.com.au > Phone 02 8753 0792 to book service. > > -- > SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ > More Info: http://lists.slug.org.au/listinfo/slug ** CAUTION: This message may contain confidential information intended only for the use of the addressee named above. If you are not the intended recipient of this message, any use or disclosure of this message is prohibited. If you received this message in error please notify Mail Administrators immediately. You must obtain all necessary intellectual property clearances before doing anything other than displaying this message on your monitor. There is no intellectual property licence. Any views expressed in this message are those of the individual sender and may not necessarily reflect the views of Woolworths Ltd. ** -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] cron running some scheduled jobs twice
On Tue, Oct 30, 2001 at 04:33:46PM +1100, John Clarke wrote: > Anyone seen this? Sometimes cron (vixie-cron-3.0.1-61 RH 7.0) runs > scheduled jobs twice, and sometimes even three times. This happens > only two or three times a day, and only on one of the three machines I > have running the same version of vixie-cron. Thanks to Jonas Larsson, I now know why this was happening. It's a race condition in vixie-cron-3.0.1-61, caused by an earlier fix to the scheduling logic. See: http://bugzilla.redhat.com/bugzilla/show_bug.cgi?id=29868 RH have apparently released an updated package, vixie-cron-3.0.1-63, but it's a rawhide package rather than one of the normal RH7.0 updates. Jonas has installed the updated package and has seen no problems so far. Cheers, John -- whois [EMAIL PROTECTED] GPG key id: 0xD59C360F http://kirriwa.net/john/ -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] Sync of filesystem on multiple SCSI hosts
I have a client with the following setup: __ | | | Firewire storage | |__| || || |_ _| | || | | Server A || Server B | |__||__| This is not an NFS mount, the box has multiple SCSI buses. Both Server A and Server B mount the same filesystem and my client says that when files are written by Server A the only way they can be seen on Server B is to unmount the filesystem and re-mount it. I did suggest using the sync option when mounting the filesystems and also trying the sync command but this didn't help. Effectively we need to lose the linux filesystem buffers (and yes, all the efficiency that goes with that) I think but I don't know how to do that. Possibly this could be done periodically on each server to allow some level of filesystem efficiency but I'm guessing this would be more trouble. If this isn't easy I'm going to have to suggest NFS... wonder if you can do NFS over SCSI? I've heard of TCP/IP over SCSI I think. I do not know if the Servers can see each other on the SCSI buses, certainly not visible in /proc/scsi areas so my guess is no. -- -- Grant Parnell - senior consultant For all your Linux Commercial quality support and consulting needs Web: http://www.linuxhelp.com.au Email: [EMAIL PROTECTED] For retail sales see http://www.everythinglinux.com.au Phone 02 8753 0792 to book service. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] CDROM mounting Question.
::>works and then ::>load extras one by one. This is exactly the stage I am at !!! (I've already installed it 3 times :-( Thanks. Regards, Rajnish -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] CDROM mounting Question.
well, a simple idea that has worked for me in the past... Rebuild it from scratch. I've had strange errors that shouldnt happen sometimes where a rebuild with the same options worked perfectly the second time round. Maybe some software somewhere had a glitch on install and you'll never find it. Rebuilding it may be quicker than trying to figure out where it has gone wrong. If it happens *every* time you build, then spend the time looking for errors *or* change some install options to see if something you're loading is causing the problem. Ie. simplify the install even further till it works and then load extras one by one. (experiance of a seasoned windows installer here;-) Ben -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
RE: [SLUG] CDROM mounting Question.
Hi All, Upon investigation (as suggested by Tony Green below), I discovered the following message appears in /var/log/messages file: ".../sr_mod.o: insmod major-block-11 failed" (or was it 'block-major' ... sorry folks, I am quoting from memory. I have left my notes at home :-( ) Any ideas good folks ? (This is a fresh but custom install with whatever RH7.2 decides to put in. No kernel rebuilds). Thanks. Regards, Rajnish ::>-Original Message- ::>From: Tony Green [mailto:[EMAIL PROTECTED]] ::>Sent: Tuesday, 16 April 2002 10:04 AM ::>To: '[EMAIL PROTECTED]' ::>Subject: Re: [SLUG] CDROM mounting Question. ::> ::> ::>On Tue, 2002-04-16 at 09:33, Tiwari, Rajnish wrote: ::>> Hi All, ::>> ::>>Mount fails for any data CD on my rh7.2 box. ::>>I have a ricoh CD-(Re)writer - on hdc. The /etc/lilo.conf ::>>contains [append="hdc=ide-scsi"]. And dmesg shows the ::>>ricoh CDRW being detected. (This was the same drive ::>>that was used to install rh7.2 onto this box). ::>> ::>Make sure you have the scsi cdrom modules loaded (sr_mod) ::>and try mount ::>/dev/sr0 /cdrom ::> ::>Greeno ::>-- ::>Tony Green <[EMAIL PROTECTED]> ::>Tel : +61-(0)2-9500-9996 ::>Mobile: +61-(0)4-2521-9996 ::>GnuPG Key : 1024D/B5657C8B ::>Key fingerprint = 9ED8 59CC C161 B857 462E 51E6 7DFB 465B B565 7C8B ::> ::>-- ::>SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ ::>More Info: http://lists.slug.org.au/listinfo/slug ::> -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] ask a common question
>Sometimes I make Makefile ,I get lots of error messages so that I cant >look them in time. >I try to "make > tmp.log" , but it fail (I cant dump those error message >into tmp.log). >Could someone show a good solution ? > The reason for this is that when programs are started, they have 2 output streams attached, called standard output and standard error (STDOUT and STDERR). When make prints output, it does so to the standard error stream, whereas the redirect command you are using redirects only standard output. The way around this depends on the shell you are using. In bash, which I use at home, I would do make &> tmp.log This command tells bash to redirect both standard output and standard error to the file. More information on this can be found in 'man bash', or in the manual page for your favourite shell. You could also do make 2> tmp.log to just save standard error to the file. Cheers, J. -- Jan Schmidt [EMAIL PROTECTED] "Computer games don't affect kids; I mean if Pac-Man affected us as kids, we'd all be running around in darkened rooms, munching magic pills and listening to repetitive electronic music." - Unknown -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] ask a common question
On Wed, 2002-04-17 at 19:10, henry wrote: > Dear List : > > Sometimes I make Makefile ,I get lots of error messages so that I cant look them in >time. > I try to "make > tmp.log" , but it fail (I cant dump those error message into >tmp.log). > Could someone show a good solution ? > This is valid for bash/ksh make 2>errors 1>nonerrors make 2>&1 > tmp.log take your pick (also see the man page for your shell and look for redirection) -- Tony Green <[EMAIL PROTECTED]> Tel : +61-(0)2-9500-9996 Mobile: +61-(0)4-2521-9996 GnuPG Key : 1024D/B5657C8B Key fingerprint = 9ED8 59CC C161 B857 462E 51E6 7DFB 465B B565 7C8B -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
[SLUG] ask a common question
Dear List : Sometimes I make Makefile ,I get lots of error messages so that I cant look them in time. I try to "make > tmp.log" , but it fail (I cant dump those error message into tmp.log). Could someone show a good solution ? BestRegards' Henry ===This mail checked by Mcafee outbound getway in Zinwell.===
Re: [Re: [SLUG] Re: [Re: Cannot See Perl CPAN Modules for Linux]]
Louis Selvon wrote: > *** It's not just this directory. Other directory part of @INC has the same > problem. Hmmm ... see below. > >Next step: print out the mounts, /etc/fstab and look carefully along > each element in the path /usr/lib/perl5/site_perl/5.6.0/i386-linux/ > for mount points, nfs mounts, Samba shares and/or symlinks. > > What do you mean by "look carefully along > each element in the path /usr/lib/perl5/site_perl/5.6.0/i386-linux/ > for mount points, nfs mounts, Samba shares and/or symlinks" ?? You could ls -l {each path element} and see if it is a symlink. > The fstab is shown below: Your fstab looks fine. Now let's check *which* perl is being used for root and user: 1. login as root: which perl 2. login as user: which perl Let us know what the output from each of 1 and 2 are. -rickw -- _ Rick Welykochy || Praxis Services Pty Limited Don't ask me the difference between analysis and design. The distinction is spiritual and has to do with the afterlife. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Any recommendations for an on line secondhand computer shop located in Australia?
Antony Stace wrote: > > Any recommendations for an on line secondhand computer shop located in Australia? Listing - not recommendations http:\\\www.recyclenet.com.au http:\\www.dsb.com.au I've been happy with the printers and scanners that I've brought off DSB, but not so impressed with their laptop prices {:-(. -- Terry Collins {:-)}}} Ph(02) 4627 2186 Fax(02) 4628 7861 email: [EMAIL PROTECTED] www: http://www.woa.com.au Wombat Outdoor Adventures "People without trees are like fish without clean water" -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [Re: [SLUG] Re: [Re: Cannot See Perl CPAN Modules for Linux]]
>I strongly suspect that you have a mount point somewhere along the path /usr/lib/perl5/site_perl/5.6.0/i386-linux/ that the user is seeing and root is not, or vice versa. *** It's not just this directory. Other directory part of @INC has the same problem. >Next step: print out the mounts, /etc/fstab and look carefully along each element in the path /usr/lib/perl5/site_perl/5.6.0/i386-linux/ for mount points, nfs mounts, Samba shares and/or symlinks. What do you mean by "look carefully along each element in the path /usr/lib/perl5/site_perl/5.6.0/i386-linux/ for mount points, nfs mounts, Samba shares and/or symlinks" ?? The fstab is shown below: LABEL=/ / ext2defaults1 1 LABEL=/boot /boot ext2defaults1 2 LABEL=/home /home ext2usrquota,grpquota,defaults 1 2 /dev/fd0/mnt/floppy autonoauto,owner0 0 none/proc procdefaults0 0 none/dev/ptsdevpts gid=5,mode=620 0 0 /dev/hda6 swapswapdefaults0 0 Louis. -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug
Re: [SLUG] Any recommendations for an on line secondhand computer shop located in Australia?
--- Antony Stace <[EMAIL PROTECTED]> wrote: > Any recommendations for an on line secondhand computer shop located > in Australia? Here are some web addresses that I found the last time I was looking (August). I haven't dealt with any of these organizations personally. I bought my machine at the monthly computer fair at UNSW. http://www.pcrecyclers.net/ http://www.techrentals.com.au/index_ie.htm http://www.mri.com.au/ http://www.pcxs.com.au/contact.html - mark __ Do You Yahoo!? Yahoo! Tax Center - online filing with TurboTax http://taxes.yahoo.com/ -- SLUG - Sydney Linux User Group Mailing List - http://slug.org.au/ More Info: http://lists.slug.org.au/listinfo/slug