Re: HTOD

On Wed, Aug 23, 2017 at 10:38 PM, lobo via Digitalmars-d wrote: > On Thursday, 24 August 2017 at 01:51:25 UTC, Timothee Cour wrote: >>> >>> [...] >> >> >> nim: >> it supports both targetting C++ (as well as C or javascript) and also >> calling C++ via foreign function

[Issue 17777] New: broken link: Download D 2.076.0 => 403 Forbidden

https://issues.dlang.org/show_bug.cgi?id=1 Issue ID: 1 Summary: broken link: Download D 2.076.0 => 403 Forbidden Product: D Version: D2 Hardware: x86 OS: Mac OS X Status: NEW Severity: normal

Re: HTOD

On Thursday, 24 August 2017 at 01:51:25 UTC, Timothee Cour wrote: [...] nim: it supports both targetting C++ (as well as C or javascript) and also calling C++ via foreign function interface, eg here are some links: https://github.com/nim-lang/Nim/wiki/Playing-with-CPP--VTABLE-from-Nim

wrapping a C style delegate

I want to wrap: ErrorEnum function(Struct* s, void function(Struct*, ErrorEnum status, void *userData) callback, void *userData, uint flags); as a member of a wrapping struct struct Mystruct { Struct* s; // wrapped ErrorEnum addCallback(void delegate(Struct*, ErrorEnum status))

Re: D as a Better C

On Wednesday, 23 August 2017 at 17:44:31 UTC, Jonathan M Davis wrote: On Wednesday, August 23, 2017 13:12:04 Mike Parker via Digitalmars-d- announce wrote: [...] I confess that I tend to think of betterC as a waste of time. Clearly, there are folks who find it useful, but it loses so much

Re: Future of export

On Thursday, 24 August 2017 at 00:31:26 UTC, solidstate1991 wrote: There's already a DIP on the subject (https://github.com/dlang/DIPs/blob/master/DIPs/archive/DIP45.md), but it's pretty much abandoned. I however would like to see it becoming a subject of discussion. DIP45 should be done as soon

Re: HTOD

> Do you know another language or tool that can call C++ natively? nim: it supports both targetting C++ (as well as C or javascript) and also calling C++ via foreign function interface, eg here are some links: https://github.com/nim-lang/Nim/wiki/Playing-with-CPP--VTABLE-from-Nim

Re: @safe(bool)

On Wednesday, 23 August 2017 at 13:28:37 UTC, 12345swordy wrote: On Wednesday, 23 August 2017 at 02:24:51 UTC, bitwise wrote: [...] Platitudes cause poor language design, not the completely reasonable expectation of good tools. And who is "Platitude" here specifically?

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is

Re: D as a Better C

On Thu, Aug 24, 2017 at 12:35:22AM +, Michael V. Franklin via Digitalmars-d-announce wrote: [...] > Consider this: Rust doesn't need a special switch to make it > interoperable with C. What's wrong with D's implementation that > requires such things? Granted, D is not Rust, but D's

Re: D as a Better C

On Wednesday, 23 August 2017 at 17:44:31 UTC, Jonathan M Davis wrote: I confess that I tend to think of betterC as a waste of time. Clearly, there are folks who find it useful, but it loses so much that I see no point in using it for anything unless I have no choice. As long as attempts to

Re: Future of export

On Wednesday, 23 August 2017 at 03:19:55 UTC, Nicholas Wilson wrote: I have as part of DIP 1012 ``` enum SymbolExport { neither, dynamicImport, dynamicExport } alias dynamicImport = SymbolExport .dynamicImport; alias dynamicExport = SymbolExport .dynamicExport; ``` to replace the

Re: D Code to html

On Wednesday, 23 August 2017 at 20:03:16 UTC, Andre Pany wrote: Hi, how does the D syntax highlighting in e.g. https://dlang.org/blog/2017/08/23/d-as-a-better-c/ works? From reading the html source code I understand there is some functionality prettyprint but not how it is included and what

Re: Community Rant

On 8/23/2017 3:58 PM, Mark via Digitalmars-d wrote: On Tuesday, 22 August 2017 at 15:14:33 UTC, Jonathan Shamir wrote: [...] But lets be honest. If I was just interested to learn about this "modern system programming language" that is C++ done right, I would dismiss D very quickly. We need

Re: HTOD

On Wednesday, 23 August 2017 at 13:25:20 UTC, 12345swordy wrote: On Tuesday, 22 August 2017 at 19:55:53 UTC, Jacob Carlborg wrote: On 2017-08-22 19:47, 12345swordy wrote: Use Clang frontend? DStep [1] is doing that. It handles both GCC and Microsoft extensions. [1]

Re: Community Rant

On Tuesday, 22 August 2017 at 15:14:33 UTC, Jonathan Shamir wrote: [...] But lets be honest. If I was just interested to learn about this "modern system programming language" that is C++ done right, I would dismiss D very quickly. We need to get together as a community and rethink your

Re: gdc and ldc in MacPorts

On Wednesday, 23 August 2017 at 18:03:22 UTC, lanphuonglien wrote: Whilst DMD seems to be in MacPorts, GDC and LDC appear not to be. Is this right? If it is then it is wrong – it would be great if the person handling the DMD port could be supported to get a LDC and GDC ports in place. I am a

Re: D as a Better C

On Wednesday, 23 August 2017 at 17:44:31 UTC, Jonathan M Davis wrote: I confess that I tend to think of betterC as a waste of time. The overwhelming majority of programmers don't need betterC. At all. But today we live in a world where practically everything just builds on top of C, and we

Re: D as a Better C

On Wednesday, 23 August 2017 at 16:17:57 UTC, SrMordred wrote: No structs in -betterC ??? I haven't tried the latest iteration of betterC yet, but the longstanding problem is that the compiler generates TypeInfo instances for structs, and TypeInfos are classes, which inherit from Object,

Re: D as a Better C

On Wednesday, 23 August 2017 at 17:43:27 UTC, Steven Schveighoffer wrote: On 8/23/17 11:59 AM, Walter Bright wrote: On 8/23/2017 7:37 AM, Steven Schveighoffer wrote: How do dynamic closures work without the GC? They don't allocate the closure on the GC heap. (Or do I have static/dynamic

(SIMD) Optimized multi-byte chunk scanning

I recall seeing some C/C++/D code that optimizes the comment- and whitespace-skipping parts (tokens) of lexers by operating on 2, 4 or 8-byte chunks instead of single-byte chunks. This in the case when token-terminators are expressed as sets of (alternative) ASCII-characters. For instance,

Re: Quora

A few other ones : https://www.quora.com/Is-C++-the-best-programming-language-to-learn-first https://www.quora.com/What-are-some-programming-languages-that-I-should-learn https://www.quora.com/How-do-I-learn-coding-7

Re: Tools to help me find memory leaks?

On Wednesday, 23 August 2017 at 17:30:40 UTC, Drake44 wrote: I'm on a Windows 7 machine and I'm using VisualD as my IDE. I'm trying to work out what's chewing up all the RAM in a program I'm writing... is there a tool that I can use that'll show me what in my program keeps allocating memory?

Re: Visual Studio Code code-d serve-d beta release

On Wednesday, 23 August 2017 at 15:41:02 UTC, Paolo Invernizzi wrote: On Saturday, 5 August 2017 at 22:43:31 UTC, WebFreak001 wrote: [...] It seems that under macOS, the linux executable is used, with a fresh install... iMac:~ pinver$ uname -a Darwin iMac.local 17.0.0 Darwin Kernel Version

D Code to html

Hi, how does the D syntax highlighting in e.g. https://dlang.org/blog/2017/08/23/d-as-a-better-c/ works? From reading the html source code I understand there is some functionality prettyprint but not how it is included and what I have to do to use it in my page. Kind regards André

Re: HTOD

On Wednesday, 23 August 2017 at 14:12:55 UTC, jmh530 wrote: On Wednesday, 23 August 2017 at 13:25:20 UTC, 12345swordy wrote: "Doesn't translate C++ at all" That's very disappointing. IMO, it should at least aim for the c++ 11 feature via using clang. Very disappointing? Yes I find it

Re: D as a Better C

On Wednesday, 23 August 2017 at 17:39:00 UTC, Walter Bright wrote: On 8/23/2017 10:26 AM, jmh530 wrote: Am I correct that betterC requires main to be extern(C) and must act like a C main (i.e. no void return)? Yes. This might be added to http://dlang.org/dmd-windows.html#switch-betterC or

Re: Community Rant

On 08/22/2017 08:24 AM, ixid wrote: On Tuesday, 22 August 2017 at 15:14:33 UTC, Jonathan Shamir wrote: various. Out of interest did you pick up D before or after joining the start up? If before did you introduce D to them or were they already using it? Weka uses D after their CTO Liran's

gdc and ldc in MacPorts

Whilst DMD seems to be in MacPorts, GDC and LDC appear not to be. Is this right? If it is then it is wrong – it would be great if the person handling the DMD port could be supported to get a LDC and GDC ports in place. I am a user of MacOS maybe once per year, but I'll help as I can.

Re: D as a Better C

On 8/23/17 11:59 AM, Walter Bright wrote: On 8/23/2017 7:37 AM, Steven Schveighoffer wrote: How do dynamic closures work without the GC? They don't allocate the closure on the GC heap. (Or do I have static/dynamic closures backwards?) I thought "closure" means allocating the stack onto the

Re: D as a Better C

On 8/23/2017 10:17 AM, Kagamin wrote: Also how assert failure works in C? It calls the C assert failure function.

Re: D as a Better C

On Wednesday, August 23, 2017 13:12:04 Mike Parker via Digitalmars-d- announce wrote: > To coincide with the improvements to -betterC in the upcoming DMD > 2.076, Walter has published a new article on the D blog about > what it is and why to use it. A fun read. And I'm personally > happy to see

Re: D as a Better C

On 8/23/2017 10:26 AM, jmh530 wrote: Am I correct that betterC requires main to be extern(C) and must act like a C main (i.e. no void return)? Yes. Is that something that can be changed in the future? Yes, but I don't see a need for it.

Re: D as a Better C

On 8/23/17 11:52 AM, Walter Bright wrote: On 8/23/2017 7:24 AM, Steven Schveighoffer wrote: Looks like there are some outstanding requests to be fulfilled before it's pulled. I don't agree that the requests improve matters. You may want to mention that in the PR. Right now it just looks

Re: D as a Better C

On 8/23/17 11:56 AM, Walter Bright wrote: On 8/23/2017 7:10 AM, Steven Schveighoffer wrote: Nope. A ModuleInfo is generated, as well as FMB/FM/FME sections. Those sections may not work with the C runtime. My point was simply that your small example doesn't cause any runtime or link time

Tools to help me find memory leaks?

I'm on a Windows 7 machine and I'm using VisualD as my IDE. I'm trying to work out what's chewing up all the RAM in a program I'm writing... is there a tool that I can use that'll show me what in my program keeps allocating memory? Thanks

Re: D as a Better C

On Wednesday, 23 August 2017 at 14:01:30 UTC, jmh530 wrote: Great piece. It might be useful to beef up the documentation on some of the things that betterC changes. For instance, here http://dlang.org/dmd-windows.html#switch-betterC links to TypeInfo, which has like one line of explanation

Re: D as a Better C

On Wednesday, 23 August 2017 at 14:00:34 UTC, Walter Bright wrote: One of the reasons people use C is to get that small footprint. This has been a large barrier to C programs making use of D. Not a better C, but intermediate D has small footprint for me too. 7.5kb totext.exe (encodes stdin to

[Issue 17775] dmd master __VERSION__ should match the major release that it will be for

https://issues.dlang.org/show_bug.cgi?id=17775 --- Comment #4 from Jonathan M Davis --- (In reply to ZombineDev from comment #3) > I agree that it's quite annoying. Perhaps we can add another predefined > constant like __IS_DEV_VERSION__ which would evaluate to true

[Issue 17775] dmd master __VERSION__ should match the major release that it will be for

https://issues.dlang.org/show_bug.cgi?id=17775 --- Comment #3 from ZombineDev --- I agree that it's quite annoying. Perhaps we can add another predefined constant like __IS_DEV_VERSION__ which would evaluate to true iff the ddmd.globals.global._version has any non-digit

Re: D as a Better C

On 8/23/2017 6:12 AM, Mike Parker wrote: The blog: https://dlang.org/blog/2017/08/23/d-as-a-better-c/ Reddit: https://www.reddit.com/r/programming/comments/6viswu/d_as_a_better_c/ Now on the front page of news.ycombinator.com !

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. I like this concept of "upward compatibility," -- although opposed to

Re: D as a Better C

On Wednesday, 23 August 2017 at 16:17:57 UTC, SrMordred wrote: On Wednesday, 23 August 2017 at 15:53:11 UTC, Walter Bright wrote: On 8/23/2017 7:10 AM, Steven Schveighoffer wrote: It's only if you do something that needs the runtime, such as static ctors, or use the GC. Or use asserts, or

Re: D as a Better C

On Wednesday, 23 August 2017 at 15:53:11 UTC, Walter Bright wrote: On 8/23/2017 7:10 AM, Steven Schveighoffer wrote: It's only if you do something that needs the runtime, such as static ctors, or use the GC. Or use asserts, or even declare a struct. No structs in -betterC ???

Re: D as a Better C

On 8/23/2017 7:37 AM, Steven Schveighoffer wrote: How do dynamic closures work without the GC? They don't allocate the closure on the GC heap. (Or do I have static/dynamic closures backwards?)

Re: D as a Better C

On 8/23/2017 8:05 AM, John Colvin wrote: "D polymorphic classes will not, as they rely on the garbage collector." They do? Don't have to allocate classes on the GC heap. Using them without the GC is a fairly advanced technique, and I don't want to deal with people writing: C c = new

Re: D as a Better C

On 8/23/2017 7:10 AM, Steven Schveighoffer wrote: Nope. A ModuleInfo is generated, as well as FMB/FM/FME sections. Those sections may not work with the C runtime.

Re: D as a Better C

On 8/23/2017 7:10 AM, Steven Schveighoffer wrote: It's only if you do something that needs the runtime, such as static ctors, or use the GC. Or use asserts, or even declare a struct.

Re: D as a Better C

On 8/23/2017 7:24 AM, Steven Schveighoffer wrote: Looks like there are some outstanding requests to be fulfilled before it's pulled. I don't agree that the requests improve matters.

Re: Visual Studio Code code-d serve-d beta release

On Saturday, 5 August 2017 at 22:43:31 UTC, WebFreak001 wrote: You might remember the blog post from a while back about workspace-d and serve-d, I just released a beta version on the visual studio marketplace that allows you to try out the latest features of serve-d. Note that this version

Re: D as a Better C

On Wednesday, 23 August 2017 at 15:17:31 UTC, Moritz Maxeiner wrote: On Wednesday, 23 August 2017 at 14:37:19 UTC, Steven Schveighoffer wrote: On 8/23/17 9:12 AM, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is

Re: D as a Better C

On Wednesday, 23 August 2017 at 14:37:19 UTC, Steven Schveighoffer wrote: On 8/23/17 9:12 AM, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm

[Issue 17775] dmd master __VERSION__ should match the major release that it will be for

https://issues.dlang.org/show_bug.cgi?id=17775 --- Comment #2 from Jonathan M Davis --- (In reply to ZombineDev from comment #1) > This was changed in https://github.com/dlang/dmd/pull/6935. Drat. Well, I can't say that I understand how all of that stuff with the

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is

Re: dub zsh completion

On Tuesday, August 22, 2017 22:35:53 Johannes Loher via Digitalmars-d- announce wrote: > I created a zsh completion script for dub. It is not perfect, but > it does many things well already. You can find it here: > https://github.com/ghost91-/dub-zsh-completion. > > I have seen that bash and fish

[Issue 17776] New: highlight error in betterC assert messages

https://issues.dlang.org/show_bug.cgi?id=17776 Issue ID: 17776 Summary: highlight error in betterC assert messages Product: D Version: D2 Hardware: All OS: All Status: NEW Keywords: betterC

Re: D as a Better C

On 8/23/17 9:12 AM, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is getting. I have a project

Re: D as a Better C

On Wednesday, 23 August 2017 at 14:00:34 UTC, Walter Bright wrote: On 8/23/2017 6:28 AM, Moritz Maxeiner wrote: I've been mixing C and full D for a while now (on Linux) by either having the main C program call rt_init/rt_term directly (if druntime is linked in when building a mixed C/D

Re: D as a Better C

On 8/23/17 10:11 AM, Walter Bright wrote: On 8/23/2017 7:01 AM, jmh530 wrote: ModuleInfo isn't linked to at all (and I'm still a little unclear on what that does). That's because ModuleInfo doesn't appear in the online documentation due to having a malformed Ddoc comment. I fixed it here:

Re: Community Rant

But lets be honest. If I was just interested to learn about this "modern system programming language" that is C++ done right, I would dismiss D very quickly. We need to get together as a community and rethink your priorities, because with problems like this we're making it very hard for

Re: D as a Better C

On Wednesday, 23 August 2017 at 14:01:30 UTC, jmh530 wrote: On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read.

Re: D as a Better C

On 8/23/2017 7:01 AM, jmh530 wrote: ModuleInfo isn't linked to at all (and I'm still a little unclear on what that does). That's because ModuleInfo doesn't appear in the online documentation due to having a malformed Ddoc comment. I fixed it here:

Re: D as a Better C

On 8/23/17 10:00 AM, Walter Bright wrote: On 8/23/2017 6:28 AM, Moritz Maxeiner wrote: Interesting article, though one thing that I'm confused by is Hence D libraries remain inaccessible to C programs, and chimera programs (a mix of C and D) are not practical. One cannot pragmatically “try

Re: HTOD

On Wednesday, 23 August 2017 at 13:25:20 UTC, 12345swordy wrote: "Doesn't translate C++ at all" That's very disappointing. IMO, it should at least aim for the c++ 11 feature via using clang. Very disappointing? It's not trivial to call C++ from another language.

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is

Re: D as a Better C

On 8/23/2017 6:28 AM, Moritz Maxeiner wrote: Interesting article, though one thing that I'm confused by is Hence D libraries remain inaccessible to C programs, and chimera programs (a mix of C and D) are not practical. One cannot pragmatically “try out” D by add D modules to an existing C

Re: DerelictGL3 reload crashes in 32 builds

On Wednesday, 23 August 2017 at 12:59:38 UTC, Mike Parker wrote: On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote: [...] I'm not sure what you're referring to. There are a few static if(Derelict_OS_Android) blocks in there as well. [...] Ok Mike. Thanks for the info. If I learn

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 13:14:31 UTC, Moritz Maxeiner wrote: On Wednesday, 23 August 2017 at 13:04:28 UTC, Vino.B wrote: The line it complains is std.file.FileException@std\file.d(3713):even after enabling debug it points to the same Output: D:\DScript>rdmd -debug Test.d -r dryrun

Re: D as a Better C

On Wednesday, 23 August 2017 at 13:12:04 UTC, Mike Parker wrote: To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is

Re: @safe(bool)

On Wednesday, 23 August 2017 at 02:24:51 UTC, bitwise wrote: On Tuesday, 22 August 2017 at 19:46:00 UTC, 12345swordy wrote: On Tuesday, 22 August 2017 at 19:24:08 UTC, bitwise wrote: On Tuesday, 22 August 2017 at 00:33:17 UTC, Jonathan M Davis wrote: [...] [...] There was a time that

Re: HTOD

On Tuesday, 22 August 2017 at 19:55:53 UTC, Jacob Carlborg wrote: On 2017-08-22 19:47, 12345swordy wrote: Use Clang frontend? DStep [1] is doing that. It handles both GCC and Microsoft extensions. [1] https://github.com/jacob-carlborg/dstep "Doesn't translate C++ at all" That's very

[Issue 17775] dmd master __VERSION__ should match the major release that it will be for

https://issues.dlang.org/show_bug.cgi?id=17775 ZombineDev changed: What|Removed |Added CC|

D as a Better C

To coincide with the improvements to -betterC in the upcoming DMD 2.076, Walter has published a new article on the D blog about what it is and why to use it. A fun read. And I'm personally happy to see the love this feature is getting. I have a project I'd like to use it with if I can ever

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 13:04:28 UTC, Vino.B wrote: The line it complains is std.file.FileException@std\file.d(3713):even after enabling debug it points to the same Output: D:\DScript>rdmd -debug Test.d -r dryrun std.file.FileException@std\file.d(3713):

Re: fasta parser with iopipe?

On 8/23/17 5:53 AM, biocyberman wrote: I lost my momentum to learn D and want to gain it up again. Therefore I need some help with this seemingly simple task: # Fasta sequence \>Entry1_ID header field1|header field2|... CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 12:12:47 UTC, Moritz Maxeiner wrote: On Wednesday, 23 August 2017 at 12:01:20 UTC, Vino.B wrote: On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner wrote: On which line do you get the Exception? Does it happen with shorter paths, as well? Assuming

Re: DerelictGL3 reload crashes in 32 builds

On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote: In the meantime can you tell me these two things: 1. How come DerelictGLES only has: static if( Derelict_OS_Windows ) ... else static if( Derelict_OS_Posix && !Derelict_OS_Mac )... when GLES is primarily intended for mobile platforms as

Re: Parameter File reading

On Wednesday, 23 August 2017 at 10:25:48 UTC, Vino.B wrote: Hi All, Can anyone provide me a example code on how to read a parameter file and use those parameter in the program. From, Vino.B Another small library: https://github.com/burner/inifiled

Re: DerelictGL3 reload crashes in 32 builds

On Tuesday, 22 August 2017 at 16:54:24 UTC, Igor wrote: On Tuesday, 22 August 2017 at 12:03:18 UTC, Igor wrote: On Monday, 21 August 2017 at 12:38:28 UTC, Mike Parker wrote: Have you tried to compile outside of VisualD? Hmmm... I though I tried running with just typing dub which should use

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote: Hi All, When i run the below code in windows i am getting "The system cannot find the path specified" even though the path exist , the length of the path is 516 as below, request your help. Path :

[Issue 17775] New: dmd master __VERSION__ should match the major release that it will be for

https://issues.dlang.org/show_bug.cgi?id=17775 Issue ID: 17775 Summary: dmd master __VERSION__ should match the major release that it will be for Product: D Version: D2 Hardware: All OS: All

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 12:01:20 UTC, Vino.B wrote: On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner wrote: On which line do you get the Exception? Does it happen with shorter paths, as well? Assuming it happens with all paths: Just to be sure, is each of those

Re: ore.exception.RangeError

On Wednesday, 23 August 2017 at 11:18:14 UTC, Moritz Maxeiner wrote: On Wednesday, 23 August 2017 at 05:53:46 UTC, ag0aep6g wrote: On 08/23/2017 07:45 AM, Vino.B wrote: Execution : rdmd Summary.d - Not working rdmd Summary.d test - Working Program: void main (string[] args) {

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 11:29:07 UTC, Moritz Maxeiner wrote: On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote: Hi All, When i run the below code in windows i am getting "The system cannot find the path specified" even though the path exist , the length of the path is 516

Re: Long File path Exception:The system cannot find the path specified

On Wednesday, 23 August 2017 at 05:06:50 UTC, Vino.B wrote: Hi All, When i run the below code in windows i am getting "The system cannot find the path specified" even though the path exist , the length of the path is 516 as below, request your help. Path :

[Issue 17774] New: Please include implib in setup / 7z archive

https://issues.dlang.org/show_bug.cgi?id=17774 Issue ID: 17774 Summary: Please include implib in setup / 7z archive Product: D Version: D2 Hardware: x86 OS: Windows Status: NEW Severity: enhancement

Re: ore.exception.RangeError

On Wednesday, 23 August 2017 at 05:53:46 UTC, ag0aep6g wrote: On 08/23/2017 07:45 AM, Vino.B wrote: Execution : rdmd Summary.d - Not working rdmd Summary.d test - Working Program: void main (string[] args) { if(args.length != 2 ) writefln("Unknown operation: %s", args[1]); } When

Re: Parameter File reading

On Wednesday, 23 August 2017 at 10:25:48 UTC, Vino.B wrote: Hi All, Can anyone provide me a example code on how to read a parameter file and use those parameter in the program. From, Vino.B For small tools I use JSON files via asdf[1]. As an example you can look at the tunneled settings

Re: Static inline field initialization

On Wednesday, 23 August 2017 at 09:12:19 UTC, Kagamin wrote: On Tuesday, 22 August 2017 at 16:28:43 UTC, Moritz Maxeiner wrote: class Test { ubyte[] buf = new ubyte[1000]; // thread local storage, instances in the same thread refer to the same static array } Dynamic initialization is

Re: fasta parser with iopipe?

On Wednesday, 23 August 2017 at 09:53:49 UTC, biocyberman wrote: I lost my momentum to learn D and want to gain it up again. Therefore I need some help with this seemingly simple task: # Fasta sequence \>Entry1_ID header field1|header field2|...

[Issue 6033] Better error message with numbers with leading zeros

https://issues.dlang.org/show_bug.cgi?id=6033 RazvanN changed: What|Removed |Added Status|NEW |RESOLVED

Parameter File reading

Hi All, Can anyone provide me a example code on how to read a parameter file and use those parameter in the program. From, Vino.B

[Issue 17604] Reject mutable fields initialized with reference types to data segment

https://issues.dlang.org/show_bug.cgi?id=17604 --- Comment #5 from anonymous4 --- (In reply to Vladimir Panteleev from comment #3) > I prefer the description on this bug but I'm a little biased ;) This scenario needs dynamic initialization, and D requires an explicit

fasta parser with iopipe?

I lost my momentum to learn D and want to gain it up again. Therefore I need some help with this seemingly simple task: # Fasta sequence \>Entry1_ID header field1|header field2|... CAGATATCTTTGATGTCCTGATTGGAAGGACCGTTGGCCACCCTTAGGCAG TGTATACTCTTCCATAAACGAGCTATTAGTTATGAGGTCCGTAGATTGGGG

[Issue 17666] std.c.linux.socket has no replacement

https://issues.dlang.org/show_bug.cgi?id=17666 --- Comment #7 from Jonathan M Davis --- (In reply to Sebastiaan Koppe from comment #6) > Ok, great. Whenever I get some time I will check core.sys.freebsd.inet.in_, > core.sys.linux.inet.in_, and

Re: Static inline field initialization

On Tuesday, 22 August 2017 at 16:28:43 UTC, Moritz Maxeiner wrote: class Test { ubyte[] buf = new ubyte[1000]; // thread local storage, instances in the same thread refer to the same static array } Dynamic initialization is done by constructor: class Test { static ubyte[1000] s;

Re: HTOD

On Tuesday, 22 August 2017 at 22:50:46 UTC, Walter Bright wrote: On 8/22/2017 2:50 PM, Steven Schveighoffer wrote: But it is generating D code, no? Sure. And the C subset of D has been very stable, too. Used the tool 2 years ago. Worked like a charm.

[Issue 9631] Error message not using fully qualified name when appropriate.

https://issues.dlang.org/show_bug.cgi?id=9631 Mike changed: What|Removed |Added Keywords|trivial | CC|

[Issue 17666] std.c.linux.socket has no replacement

https://issues.dlang.org/show_bug.cgi?id=17666 --- Comment #6 from Sebastiaan Koppe --- Ok, great. Whenever I get some time I will check core.sys.freebsd.inet.in_, core.sys.linux.inet.in_, and core.sys.darwin.inet.in_ to see if I see something missing, and add them in that case.

  1   2   >