Re: How to find any documentation for smbus?

Il Sat, 28 Oct 2023 17:08:00 +0100, Chris Green ha scritto: > I am using the python3 smbus module, but it's hard work because of the > lack of documentation. Web searches confirm that the documentation is > somewhat thin! > > If you do the obvious this is what you get:- > > >>> import

[issue46641] multiplication error 2.2 and 2.1

New submission from Br Km : Python 3.6.9 (default, Dec 8 2021, 21:08:43) [GCC 8.4.0] on linux Type "help", "copyright", "credits" or "license" for more information. >>> 2.2 * 2.1 4.621 >>> -- messages: 412532 no

Re: we want python software

lt;abhi.darkn...@gmail.com> wrote: > > > On Wed, Dec 6, 2017 at 10:08 AM, km <srikrishnamo...@gmail.com> wrote: > >> I dont know how these students are selected into b tech stream in India. >> they are so dumb. All they know is a to open a program we need to doub

Re: we want python software

I dont know how these students are selected into b tech stream in India. they are so dumb. All they know is a to open a program we need to double click it and it runs.- windoze legacy. most of the time they pay huge amount to a greedy college and get into tech stream. Now that Java boom (jobs) is

Re: learning and experimenting python.

You are wasting our time instead of learning python. On Dec 31, 2016 2:09 PM, wrote: > It is moderatable. You can delete your all messages except topics. > -- > https://mail.python.org/mailman/listinfo/python-list > -- https://mail.python.org/mailman/listinfo/python-list

Re: HELP!! How to ask a girl out with a simple witty Python code??

show her your python and and impress her. Regards, Krishna On Thu, Mar 5, 2015 at 7:04 AM, Xrrific xiaok...@gmail.com wrote: Guys, please Help!!! I am trying to impress a girl who is learning python and want ask her out at the same time. Could you please come up with something witty

Re: PyPy updated

I tried compiling pandas on pypy 2.3 but it gave error as follows numpy/core/src/multiarray/scalarapi.c:742:16: error: 'PyUnicodeObject' has no member named 'str' uni-str[length] = 0; ^ numpy/core/src/multiarray/scalarapi.c:743:16: error: 'PyUnicodeObject' has no

regex multiple patterns in order

I am trying to find sub sequence patterns but constrained by the order in which they occur For example p = re.compile('(CAA)+?(TCT)+?(TA)+?') p.findall('CAACAACAATCTTCTTCTTCTTATATA') [('CAA', 'TCT', 'TA')] But I instead find only one instance of the CAA/TCT/TA in that order. How can I get 3

Re: regex multiple patterns in order

Aah! I understand now. Thank you Regards, Krishna Mohan On Mon, Jan 20, 2014 at 4:48 PM, Ben Finney ben+pyt...@benfinney.id.auwrote: km srikrishnamo...@gmail.com writes: I am trying to find sub sequence patterns but constrained by the order in which they occur There are also specific

pkg_resources ?

', 'run.py') ##code # What are the advantages of using pkg_resources stuff ? Thanks Regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Python Developers with 5 years of experience

probably it is good to post jobs in python-list itself rather than posting it on someother site. Many mailing lists do that. It gives a feel of what jobs we come across for the Python developers. KM On Thu, May 5, 2011 at 3:16 AM, Ben Finney ben+pyt...@benfinney.id.auwrote: Jerome jjcpl.rpo

Python 3.2 vs Java 1.6

Hi All, How does python 3.2 fare compared to Java 1.6 in terms of performance ? any pointers or observations ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

shared python module ?

Hi all, I have two version of python 2.6 and 2.7. Now Is there any way that I install a python module (from pypi) and import it across both the versions ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: do something every n seconds

while True: time.sleep(10) print('hello python!') HTH, KM On Thu, Nov 25, 2010 at 8:35 PM, Steve Holden st...@holdenweb.com wrote: On 11/25/2010 6:38 AM, Santiago Caracol wrote Hello, how can I do something (e.g. check if new files are in the working directory) every n seconds

Re: NoSQL Movement?

Hi, this would be a good place to start http://en.wikipedia.org/wiki/NoSQL http://nosql-database.org/ HTH, Krishna On Thu, Mar 4, 2010 at 7:41 AM, Avid Fan m...@privacy.net wrote: Jonathan Gardner wrote: I see it as a sign of maturity with sufficiently scaled software that they no longer

Re: Dictionary or Database輝lease advise

Hi, Probably u should try couchdb! its a document oriented database. ( apache.couchdb.org) u can store your dictionaries as json documents and yes they are simple text files; data structures cna be directly stored into JSON documents. memory efficient too.. python module @

Re: Manyfile Processing

use glob module Krishna On Fri, Dec 4, 2009 at 6:37 PM, Diez B. Roggisch de...@nospam.web.dewrote: u...@domain.invalid schrieb: Hey, sorry if i bother you with a beginners question but i have an issue with processing a bunch of files. They are some arithmetic lists the processing of one

Re: Delaunay triangulation

check CGAL (cgal.org) it has python bindings Krishna On Wed, Dec 2, 2009 at 11:28 PM, David Robinow drobi...@gmail.com wrote: On Tue, Dec 1, 2009 at 8:31 PM, Vincent Davis vinc...@vincentdavis.net wrote: Anyone know of a python implementation of Delaunay triangulation? Matplotlib has one.

Re: Implementation of Book Organization tool (Python2.[x])

Though many would disagree, I consider XML as a form of database though it is only suitable for data exchange. XML is suitable for low- to medium-volume purpose and when compatibility with various systems is extremely important (nearly any OS and any programming language has XML parsers;

Implementation of Book Organization tool (Python2.[x])

Hi together, I'm a python-proficient newbie and want to tackle a program with Python 2.x, which basically organizes all my digital books (*.pdf, *.chm, etc..) and to give them specific labels, such as: Author - string Read - boolean Last Opened: - string and so on.. Now my question is: Is it a

Re: Shebang line problems and python

assuming that ur on linux/unix and assuming that u have shebang line as #!/usr/bin/python in ur script set permissions like this chmod 755 myscript.py and then run the script as ./myscripy.py OR simply run the python script as python myscript.py at the shell prompt (note that this doesnt need

Re: bad behaviour in interactive Python prompt

On 14 Jul., 15:26, Mark Dickinson dicki...@gmail.com wrote: Where did your version of Python 2.6 come from? If you built your copy of Python 2.6 from source, then the problem is probably that either the readline library is missing, or (much more likely) the include files for the readline

Re: bad behaviour in interactive Python prompt

On 14 Jul., 15:26, Mark Dickinson dicki...@gmail.com wrote: Where did your version of Python 2.6 come from? If you built your copy of Python 2.6 from source, then the problem is probably that either the readline library is missing, or (much more likely) the include files for the readline

update python version

Hi all, Is there a way to update python 2.6.1 to 2.6.2 using easy_install ? thanks, regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Geometry package

Hi, I hope this is what u need : http://cgal-python.gforge.inria.fr/ HTH KM On Sun, Mar 29, 2009 at 1:55 AM, Justin Pearson justin.pear...@gmail.comwrote: Hi all, I'm looking for a geometry package in Python; something that will let me define line segments, and can tell me if two line

multiprocessing python2.6.1

. KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Embarrasing questio

Hi, you could do it this way also : if i in [3,5]: do something... KM ~ On Fri, Feb 13, 2009 at 1:19 AM, Michele Simionato michele.simion...@gmail.com wrote: On Feb 12, 5:07 pm, TechieInsights gdoerm...@gmail.com wrote: On Feb 12, 9:03 am, Catherine Heathcote

Re: python for *nix system admins

import os HTH KM ~~ On Sat, Sep 27, 2008 at 1:35 PM, Lars Stavholm [EMAIL PROTECTED] wrote: Hi All, I'm new to this list and hoping that this is not off-topic. If it is, please point me in the right direction. I seem to recollect a python module or library for *nix sysadmins

python 3.x third party modules

Hi all, I would like to look at third party modules which are python 3.0 ready. could some one point me to such a resource ? If its not available, it would be useful to host a page regarding this on python.org ? any comments ? KM -- http://mail.python.org/mailman/listinfo/python-list

Re: improving a huge double-for cycle

how abt this ? N = len(IN) for k in range(N): for j in range(N): if j = k: # or k = j doSomething() KM ~~~ On Thu, Sep 18, 2008 at 6:27 PM, Tim Chase [EMAIL PROTECTED]wrote: Code: Select all for i in range(len(IN)): #scan all elements

Re: ANN: Resolver One 1.2 released

Hi, sounds great - but disappointing to find it only available on window$. Is there any Linux release in near future ??? KM ~~ On Tue, Aug 19, 2008 at 6:10 PM, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote: We are proud to announce the release

Re: A GUI framework for running simulations

Hi, check SimPy module and then http://www.showmedo.com/videos/series?name=pythonThompsonVPythonSeries KM On Jan 23, 2008 8:10 PM, Guilherme Polo [EMAIL PROTECTED] wrote: 2008/1/23, [EMAIL PROTECTED] [EMAIL PROTECTED]: Hello! I am currently working on writing a simulation engine

Re: Python Trajectory Module?

Hi have a look at these demos (includes trajectory etc) with VPython http://showmedo.com/videos/series?name=pythonThompsonVPythonSeries best wishes, KM -- On Jan 2, 2008 5

Re: joining rows

dictionary keys are A,B, C ,D and corresponding values are list if items (ie., 1,2,3 ...) Once u have such a dict loaded, its kust a matter of accessing that list via a key and display it joined! HTH KM -- http://mail.python.org/mailman/listinfo/python-list -- http://mail.python.org/mailman

Re: comparing dictionaries to find the identical keys

of the two sets, by which u get the commonly occuring items. HTH KM -- http://mail.python.org/mailman/listinfo/python-list -- http://mail.python.org/mailman/listinfo/python-list

module level subclassing

that possible ? kindly enlighten regards, KM -- http://mail.python.org/mailman/listinfo/python-list

module organization/inheritance problem

missing something ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: metaclasses: timestamping instances

Hi, But why does it show varied difference in the time between a and b instance creations when __metaclass__ hook is used and when not used in class Y ? I dont understand that point ! KM On 9/1/07, Michele Simionato [EMAIL PROTECTED] wrote: On Sep 1, 6:07 pm, Steve Holden [EMAIL PROTECTED

metaclasses: timestamping instances

regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: beginner in python

for indent. Another problem is that u have not closed the filehandle in the program! HTH KM -- http://mail.python.org/mailman/listinfo/python-list

Re: beginner in python

consider the whole line in the data file, they are all unique - there is no redundancy. KM --- On 8/2/07, Beema shafreen [EMAIL PROTECTED] wrote: Hi everybody , I am a beginner in python, I have to fetch the redundant entries

Re: Please help on Binary file manipulation

Hi, I assume ur on a linux/unix box... pls check the manual for 'split' command in linux/unix this does ur job regards, KM --- On 6/5/07, Pieter Potgieter [EMAIL PROTECTED

Re: Inheriting from Python list object(type?)

= y p = Point(2,3) print dir(p) print type(p) code regards KM -- On 23 May 2007 09:58:36 -0700, Mangabasi [EMAIL PROTECTED] wrote: Howdy, I would like to create a Point class that lets me

Re: __getattr__ and __getattribute__

Oh thats lucid! thanks for the explanation. regards KM - On 5/9/07, Gabriel Genellina [EMAIL PROTECTED] wrote: En Tue, 08 May 2007 08:22:03 -0300, km [EMAIL PROTECTED] escribió: i find it difficult to understand the difference

__getattr__ and __getattribute__

Hi all, i find it difficult to understand the difference between the magic methods __getattr__ and __getattribute__ and so donot know when to use former or later. can someone brief me on it ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

distance map

Hi all, Is there any module to make a network diagram given a 2-D matrix of distances ? any hints regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Best Free and Open Source Python IDE

check out SPE (StanisPpython Editor) KM On 9 Feb 2007 10:43:00 -0800, Bastos [EMAIL PROTECTED] wrote: On Feb 8, 10:03 am, Srikanth [EMAIL PROTECTED] wrote: Yes, All I need is a good IDE, I can't find something like Eclipse (JDT). Eclipse has a Python IDE plug-in but it's not that great

Re: best package for a physical simulation?

Hi, checkout MMTK package http://dirac.cnrs-orleans.fr/MMTK/ regards, KM On 1/24/07, Robert Kern [EMAIL PROTECTED] wrote: [EMAIL PROTECTED] wrote: Hello everyone, i would like to use python to perform some simulation involving collisions of colloidal particles. which is the best package

setup.py ./configure arguments

Hi, how do i pass '--enable-shared' etc arguments to Python2.5 setup.py ? do i need to edit some file ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

module hierarchy snapshot

Hi, Is there any good tool get a snapshot of module hierarchy for custom python modules ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

regex problem

doesnt it match the group(4) item of the match ? any idea whats wrong with it ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: regex problem

HI Tim, oof! thats true! thanks a lot. Is there any tool to simplify building the regex ? regards, KM On 11/23/06, Tim Chase [EMAIL PROTECTED] wrote: line is am trying to match is 1959400|Q2BYK3|Q2BYK3_9GAMM Hypothetical outer membra29.90.00011 1 regex i have written

Re: how to print pdf with python on a inkjet printer.

i dont see os.startfile in python2.5 installation on my system :-( KM On 11/19/06, Thomas Heller [EMAIL PROTECTED] wrote: Gabriel Genellina schrieb: At Friday 17/11/2006 17:40, Tim Roberts wrote: double wow! as it is my customer wants me to print to the default printer. can you please

Re: What python modules are available?

Hi all, Thats ridiculous! why is that the numpy implementation documentation is put on sale and not available freely to everyone? regards, KM --- On 11/18/06, Robert Kern [EMAIL PROTECTED

biopython SProt

Hi all, Biopython's SProt module doesnt seem to work with current Uniprot KB . do anyone have a parser to read Uniprot format files ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

java python GPL

Hi all, what does Java released under GPL mean to python ? could it hamper python development on the long run? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: __init__.py

/__init__.py so that i can access them by foo.mypath1 in first and second submodule class definitions? if not anyother way out ? regards, KMOn 11/14/06, Fredrik Lundh [EMAIL PROTECTED] wrote: km wrote: what is the use of __init__.py file in a module dir ?it tells Python that the directory

Re: __init__.py

Hi, wow ! i tried it and it works like charm! could access variables declared at root module dir in submodules. also i would like to know if i can have an abstract class declared in __init__.py with common variables ? regards, KMOn 11/14/06, Fredrik Lundh [EMAIL PROTECTED] wrote: km wrote: I

__init__.py

Hi all, what is the use of __init__.py file in a module dir ? Is it used to initialize variables that could be shared across sub modules if set in __init__.py at root dir of module ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

cross connecting

are suitable for this sort of a work ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Python and CMS

Hi, check out Plone atop Zope. http://plone.org regards, KMOn 10/23/06, Sybren Stuvel [EMAIL PROTECTED] wrote: Kjell Magne Fauske enlightened us with: I recommend taking a look at Django [1]. It is not a CMS right out of the box, but writing one using the Django framework is not that

references and buffer()

id(x) -1085476384 now the ids of y and x are not the same - why ? In which situatons are buffers used against the strings ? can i create a write buffer instead of readonly buffer ? what exactly are buffer object types ? and how can i instantiate them ? regards, KM -- http://mail.python.org

Re: references and buffer()

in the referenced variables/buffers objects . am i wrong ? does it mean that references in python are not true references ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: references and buffer()

the references point to will eventually be deleted. Variables are one way to have a reference to anobject. References to an object may also exist in a list, hash, orother data type. so the object exists until there are no references to it and will be Garbage Collected immediately? regards, KM

Re: references and buffer()

. why is that python doesnt implement direct memory addressing provided a reference to an object exists ? GC intercedes at various intervals when convenient. I don't think itwould be immediate though. what is the interval and what is its effect on the performance of python interpreter ? regards, KM

psycopg: tz import error

to import.do i need to set any env variable specially for 2.4.3 ? regards,KM -- http://mail.python.org/mailman/listinfo/python-list

Re: ANN: dmath 0.9 - Math routines for the Decimal type

and how different is MIT licence to GPL ? could u elaborate on that ? regards, KM On 9/26/06, Brian Beck [EMAIL PROTECTED] wrote: Brian Beck wrote: What is dmath? == dmath provides the standard math routines for Python's arbitrary-precision Decimal type. These include acos

memory

Hi all,Is there any module to limit the memory usage of the python program ?regards,KM -- http://mail.python.org/mailman/listinfo/python-list

variable update

Hi all Is there any handy untility for checking if a variable is populated at runtime ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Ann: CoreBio 0.4

On 11 Sep 2006 00:59:30 -0700, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote: Announcing CoreBio 0.4 CoreBio home page: http://code.google.com/p/corebio/ Download: http://corebio.googlecode.com/svn/dist/CoreBio-0.4.1.tar.gz CoreBio is an open source python

Re: Ann: CoreBio 0.4

Hi,why are u reinventing the wheel when Biopython[1] is already existing ? is there any specific reason u wanted to develop this CoreBio ? why dont u just extend the existing BioPython package itself ?regards,KM [1]http://biopython.org

Re: best small database?

checkout gadfly database.regards,KMOn 9/11/06, David Isaac [EMAIL PROTECTED] wrote: I have no experience with database applications.This database will likely hold only a few hundred items,including both textfiles and binary files.I would like a pure Python solution to the extent reasonable.

Re: threading support in python

Where is Guido ? would be great to hear his opinion on GIL/ GC issues in future versionsofPython. regards, KM On 7 Sep 2006 08:02:57 GMT, Antoon Pardon [EMAIL PROTECTED] wrote: On 2006-09-06, [EMAIL PROTECTED] [EMAIL

Re: Building Python Based Web Application

Hi, I use Plone/Zope forand interface it with PostgreSQL . its pretty good. saves lot of time. ofcourse the learning curve is steep. Zope uses CSS heavily and since ur comfortable with it it shouldnt take muchtime building the sitewith much less coding inpython. regards, KM On 9/9/06, Ramon

Re: threading support in python

': for python_version in range(python2.4.x, python3.x, x): if python_version.GIL: print 'unusable for computation intensive multiprocessor architecture' else: print cmp(python,java) regards, KM -- http

Re: threading support in python

True, since smartness is a comparison, my friends who have chosen java over python for considerations of a true threading support in a language are smarter, which makes me a dumbo ! :-) KM On 9/5/06, Richard Brodie [EMAIL PROTECTED] wrote: km [EMAIL PROTECTED] wrote in message news:[EMAIL

threading support in python

Hi all, Is there any PEP to introduce true threading features into python's next version as in java? i mean without having GIL. when compared to other languages, python is fun to code but i feel its is lacking behind in threading regards, KM -- http://mail.python.org/mailman/listinfo/python

Re: threading support in python

Hi all, Are there any alternate ways of attaining true threading in python ? if GIL doesnt go then does it mean that python is useless for computation intensive scientific applications which are in need of parallelization in threading context ? regards, KM

Re: subprocess woes

Hi Dennis, That works great ! thanks for the correction regards, KM-- On 8/29/06, Dennis Lee Bieber [EMAIL PROTECTED] wrote: On Tue, 29 Aug 2006 18:17:47 +0530, km [EMAIL PROTECTED] declaimed the following in comp.lang.python: ##code start

Re: subprocess woes

Hi Dennis, That works great. thanks for the correction. The 'output' variablehas the returneddata as string obbject. how can i get it as a list object with elements as line by line? Is it that p1.communicate()[0] by default returns a singlestring only ? regards, KM On 8/29/06, Dennis Lee Bieber

subprocess woes

above. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

XMLSchema Parsing

Hi all, i'd like to know if there are any good XMLSchema (.xsd files) parsing modules in python. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: loop in python

, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: loop in python

regards, KM -- http://mail.python.org/mailman/listinfo/python-list

loop in python

0.005 seconds only !!! Is python runtime slow at all aspects when compared to perl ? I really wonder what makes python slower than perl ? Is there any proposal to make python faster in future versions ? curious to know all these ... regards, KM -- http://mail.python.org/mailman/listinfo

Re: loop in python

() in python snippet, it not better , it takes 0.57 seconds. just test it urself and see. what more do i need to accept python is slow when it comes to loops concept ? PS : my linux box is running fedora core 2 with 256 MB RAM regards, KM

Re: loop in python

is faster than python in most of the aspects. Also the first thing any newbie to python asks me is abt raw speed in comparison with similar languages like perl when i advocate python to perl. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

global interpreter lock

Hi all, is true parallelism possible in python ? or atleast in the coming versions ? is global interpreter lock a bane in this context ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

multiple inheritance super()

Hi all, In the following code why am i not able to access class A's object attribute - 'a' ? I wishto extent class D with all the attributes of its base classes. how do i do that ? thanks in advance for enlightment ... here's the snippet #!/usr/bin/python class A(object): def

Re: multiple inheritance super()

Hi peter, ya got it working :-) now i understand mro better. thanks, KM - On Tue, Jul 26, 2005 at 04:09:55PM -0400, Peter Hansen wrote: km wrote: Hi all, In the following code why am i not able to access class A's object

without shell

hi all, can any linux command be invoked/ executed without using shell (bash) ? what abt security concerns ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

decimal numarray

Hi all, is there any support for decimal type in numarray module ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: 20050111: list basics

Hi all, Perl's pack function will allow you to do direct memory access if you ask it to via the p and P templates. can we do direct memory accessing in python also ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

80 bit precision ?

Hi all, does python currently support 80 bit precision Floating Point Unit ? regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: OOPS concept

Hi all, Well this doesnt explain new style classes. let me be more clear. is there any online tutorial/ recommended book which deals explicitly with object oriented programming in python? regards, KM --- Try this online

OOPS concept

Hi all, Is there any good step by step online tutorial on OOPS concepts in python ? i have checked some on the python.org.__doc__ page but couldnt make much sense. especially i need help on newstyle classes. regards, KM -- http://mail.python.org/mailman/listinfo/python-list

Re: Supercomputer and encryption and compression @ rate of 96%

to create a file with such a big filename ? any workarounds ? regards, KM On Thu, Apr 14, 2005 at 01:49:22PM +0200, Fredrik Lundh wrote: Will McGugan wrote: Please implement this as a Python module. I would like

Re: Python - what is the fastest database ?

Hi all, Google has specially designed file system 'Goolgle File System' too. KM - On Mon, Feb 28, 2005 at 01:43:53PM -0500, Terry Reedy wrote: [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] How

Re: Chart Director?

Hi all, Chart Director is a good module to implement graphs using in python. i have been using it since 6 months for scientific data visualisation. great module !!! regards, KM -- On Sat, Feb 19, 2005 at 08:22:19AM +0100, Vincent Wehren wrote

Re: IPython colors in windows

Hi all, Have u tried Colors0.1 module from python.org ? KM On Fri, Feb 04, 2005 at 07:21:29AM -0800, Fuzzyman wrote: Are you really using the readline module from newcenturycomputers ? I've got a feeling that's broken

  1   2   >