id_1, clk, val = foo_function()
id_2, key, units, delay = bar_function()
if id_1 == id_2:
print id_1, clk, val, key, units, delay
--
https://mail.python.org/mailman/listinfo/python-list
Am 01.07.16 um 12:26 schrieb Archana Sonavane:
Hello Everyone,
I am doing python code by using API.
My first API giving fields - Itemid, clock and value
second API giving fields - Itemid, key, units and delay
using for loops for both API.
Could you please tell me how to compare both id by
On Jul 1, 2016 6:30 AM, "Archana Sonavane"
wrote:
>
> Hello Everyone,
>
> I am doing python code by using API.
>
> My first API giving fields - Itemid, clock and value
> second API giving fields - Itemid, key, units and delay
>
> using for loops for both API.
>
> Could
Hello Everyone,
I am doing python code by using API.
My first API giving fields - Itemid, clock and value
second API giving fields - Itemid, key, units and delay
using for loops for both API.
Could you please tell me how to compare both id by using equal operator.
My output should be :
On Tue, 02 Feb 2010 15:07:05 -0800, Aahz wrote:
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really overkill for
the OP's problem and it certainly doesn't improve readability.
If you're going to use a quote, it works
In article mailman.1551.1264701475.28905.python-l...@python.org,
D'Arcy J.M. Cain da...@druid.net wrote:
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really overkill for
the OP's problem and it certainly doesn't improve
On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG
On Fri, 29 Jan 2010 11:23:54 +0200, Johann Spies wrote:
On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could point
out the mistake in my program. Basically, I have a huge text file
similar to the format
On Fri, Jan 29, 2010 at 10:04:33AM +, Steven D'Aprano wrote:
I know this is a python list but if you really want to get the job done
quickly this is one method without writing python code:
$ cat /tmp/y
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
On Fri, 29 Jan 2010 11:23:54 +0200
Johann Spies jsp...@sun.ac.za wrote:
I know this is a python list but if you really want to get the job
done quickly this is one method without writing python code:
[...]
$ grep -v 0 /tmp/y tmp/z
There's plenty of ways to do it without writing Python. C,
Johann Spies wrote:
On Thu, Jan 28, 2010 at 07:07:04AM -0800, evilweasel wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
AGATAAGCTAATTAAGCTACTGGGTT 1
* evilweasel:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
AGATAAGCTAATTAAGCTACTGG 0
AGATAAGCTAATTAAGCTACTGGGTT 1
On Jan 28, 3:07 pm, evilweasel karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program.
snip
for j in range(0, b):
if lister[j] == 0:
At a guess, this line should be:
if lister[j] == '0':
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
AGACTCGAGTGCGCGGA 0
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I would be grateful if someone could
point out the mistake in my program. Basically, I
On Thu, 28 Jan 2010 07:07:04 -0800 (PST)
evilweasel karthikramaswam...@gmail.com wrote:
I am a newbie to python, and I would be grateful if someone could
Welcome.
point out the mistake in my program. Basically, I have a huge text
file similar to the format below:
You don't say how it isn't
On Thu, Jan 28, 2010 at 4:31 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:28 PM, Krister Svanlund
krister.svanl...@gmail.com wrote:
On Thu, Jan 28, 2010 at 4:07 PM, evilweasel
karthikramaswam...@gmail.com wrote:
Hi folks,
I am a newbie to python, and I
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to ignore the ones
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been
nn prueba...@latinmail.com writes:
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the
On 1/28/2010 10:50 AM, evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample).
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant jeanmic...@sequans.com wrote:
Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two problems. Regex is really overkill for
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been found in a particular sample). So, I would need
to
D'Arcy J.M. Cain wrote:
On Thu, 28 Jan 2010 18:49:02 +0100
Jean-Michel Pichavant jeanmic...@sequans.com wrote:
Using regexp may increase readability (if you are familiar with it).
If you have a problem and you think that regular expressions are the
solution then now you have two
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
the sequence has been
On Jan 28, 12:28 pm, Steven Howe howe.ste...@gmail.com wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to
Steven Howe wrote:
On 01/28/2010 09:49 AM, Jean-Michel Pichavant wrote:
evilweasel wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the sequence (this is basically the number of times
Arnaud Delobelle wrote:
nn prueba...@latinmail.com writes:
On Jan 28, 10:50 am, evilweasel karthikramaswam...@gmail.com wrote:
I will make my question a little more clearer. I have close to 60,000
lines of the data similar to the one I posted. There are various
numbers next to the
nn prueba...@latinmail.com writes:
After posting I was thinking I should have posted a more
straightforward version like the one you wrote. Now there is! It
probably is more efficient too. I just have a tendency to think in
terms of pipes: pipe this junk in here, then in here, get output.
I am just learning python and I am trying to create a simple
connection to a mysql table via Python and Apache, using a Python
program
Unfortunately I keep getting an internal server error (50), when I
bring it up in my browser ... information attached.
Any help would be appreciated ...
Thx,
pythonbrian wrote:
I am just learning python and I am trying to create a simple
connection to a mysql table via Python and Apache, using a Python
program
Unfortunately I keep getting an internal server error (50), when I
bring it up in my browser ... information attached.
Any help would be
Thanks to all for your help it is now working, I rant he code through a
debugger and found that the input file I was using to create my list of
addresses to wget had newlines in them and were therefore breaking my
command line.
All your advice has been appreciated.
RiGGa
--
Brian van den Broek wrote:
Rigga said unto the world upon 2005-02-27 15:04:
Tim Jarman wrote:
SNIP
No, the r was the point - it's there to tell Python not to do any
escaping on the string. Try it again with the r and see what happens.
Brilliant!!! that works a treat thankyou!!, where
Rigga wrote:
Brian van den Broek wrote:
Rigga said unto the world upon 2005-02-27 15:04:
(snip stuff about raw strings)
Thanks for all your help with this it is appreciated, one further question
though, how do I pass a variable to the external program while using the
r
Thanks
RiGGa
Rigga wrote:
(snip)
This is the command I am trying to run:
feed is a list of web addresses
output, input = popen2(wget -q %s -O - | tr '\r' '\n' | tr \' \ | sed -n
's/.*url=\([^]*\).*/\1/p' % feed[counter])
But it does not work, if I escape the string using r and hard code in
the
Rigga wrote:
Tim Jarman wrote:
Rigga wrote:
Brian van den Broek wrote:
Rigga said unto the world upon 2005-02-27 15:04:
(snip stuff about raw strings)
Thanks for all your help with this it is appreciated, one further
question though, how do I pass a variable to the external program while
using
Rigga wrote:
Hi,
I am running the line of code below from a shell script and it works fine,
however I am at a total loss on how i can run it from within a Python
script as every option I have tried fails and it appears to be down to the
escaping of certain characters.
wget -q
Pink wrote:
Rigga wrote:
Hi,
I am running the line of code below from a shell script and it works
fine, however I am at a total loss on how i can run it from within a
Python script as every option I have tried fails and it appears to be
down to the escaping of certain characters.
I'm using wget from Python to get extactly one line from a reports page.
I made this function that works for me:
def wgetline(exp): # see Python Cookbook p. 228
print Getting result from server ...
command = 'wget -q -O - \
http://www.foobar.com/report.pl\?UserID=xxx\UserPW=xxx \
Rigga wrote:
Pink wrote:
Rigga wrote:
Hi,
I am running the line of code below from a shell script and it works
fine, however I am at a total loss on how i can run it from within a
Python script as every option I have tried fails and it appears to be
down to the escaping of certain
Tim Jarman wrote:
Rigga wrote:
Pink wrote:
Rigga wrote:
Hi,
I am running the line of code below from a shell script and it works
fine, however I am at a total loss on how i can run it from within a
Python script as every option I have tried fails and it appears to be
down to the
Rigga said unto the world upon 2005-02-27 15:04:
Tim Jarman wrote:
SNIP
No, the r was the point - it's there to tell Python not to do any escaping
on the string. Try it again with the r and see what happens.
Brilliant!!! that works a treat thankyou!!, where on earth did you find out
about the 'r'
Rigga wrote:
No, the r was the point - it's there to tell Python not to do any
escaping on the string. Try it again with the r and see what happens.
Brilliant!!! that works a treat thankyou!!, where on earth did you find
out
about the 'r' any pointers to documentation appreciated.
This is
44 matches
Mail list logo