On Wed, Oct 17, 2012 at 5:59 AM, Monte Milanuk memila...@gmail.com wrote:
Hello,
I'm working on a python script to take the sql script, create a sqlite3
database, create the tables, and then populate them using the info from the
csv file.
The sticking point seems to be creating the foreign
On Tue, 16 Oct 2012 10:30:54 +0100 Alan Gauld wrote
Yes but then it wouldn't be OOP. You'd be back in the world of
traditional procedural programming passing explicit data references
around. Its much better to make it an instance method with the self
reference being passed implicitly
I
I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
On 17/10/2012 09:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James
The author(s) have chosen not to place it there.
--
Cheers.
Mark Lawrence.
___
Tutor maillist -
On 17/10/2012 03:22, Alexander wrote:
On Tue, Oct 16, 2012 at 20:43 EST, Mark Lawrence
breamore...@yahoo.co.uk wrote:
For the record Access is not a database, or so some geezer called Alex
Martelli reckons http://code.activestate.com/lists/python-list/48130/, so
please don't shoot the
On Tue, Oct 16, 2012 at 11:59 PM, Monte Milanuk memila...@gmail.com wrote:
address = list(row)
address.append(person)
row = tuple(address)
The rows from the csv.reader are already lists. Also, the parameter
list in the 2nd argument only needs to be a sequence (e.g.
If your app has a standard usage of phrases, you can place a file in
that translates a tag into a particular language phrase.
if submit_tag_selection == 'english':
submit = 'Submit'
if submit_tag_selection == 'english':
submit = 'Soumettre'
Of course this could be done without the
__
I'm not a professional programmer, so I might be way off base here.
You mean you haven't dealt with this subject yet...
But what I like about Pythons modulo solution is that I can use it to
right and left shift in lists or tuples, and I will link
On Tue, Oct 16, 2012 at 12:57 PM, Abhishek Pratap
abhishek@gmail.com wrote:
Hi Guys
For my problem I need to store 400-800 million 20 characters keys in a
dictionary and do counting. This data structure takes about 60-100 Gb
of RAM.
I am wondering if there are slick ways to map the
Hello,
I am using python to calculate distances across the cell.
I used this command: python calculate_distances.py
This was the response:
Traceback (most recent call last):
file calculate_distances.py line 4, in module
import celltool.simple_interface as si
ImportError: No module named
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
___
Tutor maillist -
On Oct 7, 2012, at 8:06 PM, Dave Angel d...@davea.name wrote:
On 10/07/2012 08:00 PM, Jan Karel Schreuder wrote:
On Oct 7, 2012, at 7:24 PM, Dave Angel d...@davea.name wrote:
It still makes no sense to me. There are at least two equally silly
ways to define the results of a
Hi,I am trying to develop a python code that takes a character string as input
and finds for the occurrence of letters that are occurring thrice or more
consecutively.For E.g.
a = 'ataattaaacagagtgagcagt'In the output I want a list of those
characters that are occuring thrice or more.
Hello, I'm using Python 2.6 to generate switch lists for a model railroad.
I had some help before, possibly from this site but have encountered
another problem. I realise the code could be better written, but learning
Python is a work in progress. The program works much as expected except
when I
tutor-requ...@python.org编写：
Send Tutor mailing list submissions to
tutor@python.org
To subscribe or unsubscribe via the World Wide Web, visit
http://mail.python.org/mailman/listinfo/tutor
or, via email, send a message with subject or body 'help' to
tutor-requ...@python.org
On Thu, Oct 11, 2012 at 3:29 PM, Stephen Hooker sct...@googlemail.com wrote:
I try to store 1 result it works fine. If I try to store more than 1 result
I get one or the other, never both. The code is below (not the whole
program)
for i in range(2):
pos =
On 17/10/12 19:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from
www.python.org). Why ?
You'd have to ask the author of VPython. Being on PyPI is not
compulsory, nobody is going to force him to use PyPI if he
doesn't want to.
--
Steven
On 08/10/2012 16:55, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
On 17/10/12 12:30, Dwight Hutto wrote:
My inexperienced advice would be to begin with the storage areas
available. I would begin by eliminating certain things such as:
x = {'one_entry' : 1}
into
x = {'one_entry':1}
Those two entries are exactly the same. The presence of absence of
spaces,
On 10/13/2012 07:02 AM, syed zaidi wrote:
Hi,I am trying to develop a python code that takes a character string as
input and finds for the occurrence of letters that are occurring thrice or
more consecutively.For E.g.
a = 'ataattaaacagagtgagcagt'In the output I want a list of those
On 10/05/2012 11:55 PM, Benjamin Lee wrote:
Hello,
I am using python to calculate distances across the cell.
I used this command: python calculate_distances.py
This was the response:
Traceback (most recent call last):
file calculate_distances.py line 4, in module
import
On Wed, Oct 17, 2012 at 8:02 AM, Dave Angel d...@davea.name wrote:
Is this a homework assignment where you might be expected to build a
complex loop, or is it a problem you're solving where you would be
allowed to use itertools.groupby ?
May as well post a groupby solution. I doubt it would
Thanks for the help! Not sure why I assumed that csv.reader was returning
row as a tuple instead of a list... that makes that part easier ;)
As for the 'INSTEAD OF' trigger on a VIEW... that *does* look pretty
handy. I was trying to remember why I hadn't heard of that before, or why
I hadn't
On 10/8/2012 11:55 AM, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports
the corresponding number of euros by using the current exchange rate.
As the list name (Tutor) suggests we are here to help
On 17/10/12 11:29, Cheng wrote:
I couldn't see any comment or question in there.
When posting could you please follow the instructions:
When replying, please edit your Subject line so it is more specific
than Re: Contents of Tutor digest...
And also delete any irrelevant content. It makes
Mike,
A brief comment before I start:
your post would be a lot more readable and understandable if you were to
break it up into smaller paragraphs, each of which explains one point.
Otherwise it is a great wall of text which is fairly intimidating.
On 18/10/12 06:51, Mike wrote:
My program
From Programming in Python 3, 2nd edition (p. 22-23):
a = [Retention, 3, None]
b = [Retention, 3, None]
a is b
False
b = a
a is b
True
My current understanding is as follows: On the first two lines, two
separate objects are defined, stored in two separate blocks of memory.
These two objects
On 10/17/2012 11:41 PM, boB Stepp wrote:
From Programming in Python 3, 2nd edition (p. 22-23):
a = [Retention, 3, None]
b = [Retention, 3, None]
a is b
False
b = a
a is b
True
My current understanding is as follows: On the first two lines, two
separate objects are defined, stored in
28 matches
Mail list logo
