-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1
Mika Hirvonen randomly hit the keyboard and managed to write on 21/03/2004 21:38:
Max Moritz Sievers wrote:
On Sunday 21 March 2004 13:28, Niklas Bergh wrote:Yes, it does. The code to download and uncompress the bzipped seednodes has been there since January. Try downloading http://www.freenetproject.org/snapshots/freenet-latest.tgz, it should contain the latest version of update.sh.
You mean like we do with
http://freenetproject.org/snapshots/seednodes.ref.bz2
That's nice to know but update.sh doesn't use it. So I guess most Freenet-users download the big uncompressed file.
However, the version that is pulled down by Fred and placed into the distrib folder doesn't.
==== update.sh #!/bin/bash wget http://freenetproject.org/snapshots/freenet-latest.jar -O freenet.jar wget http://freenetproject.org/snapshots/seednodes.ref -O seednodes.ref touch -d "1/1/1970" seednodes.ref # so we don't reseed unless necessary ====
I have re-written it thus...
==== update.sh #!/bin/bash
# make sure we only get the newest versions. wget -N http://freenetproject.org/snapshots/freenet-latest.jar wget -N http://freenetproject.org/snapshots/seednodes.ref.bz2
# Use copy so that we keep the original name (could use ln -s) # for later retrieval comparison. cp freenet-latest.jar freenet.jar
# Unpack seednodes.ref but keep the original bz2 for later # retrieval comparison. bzip2 -dkf seednodes.ref.bz2 touch -d "1/1/1970" seednodes.ref # so we don't reseed unless necessary ====
Richard
- --
======================================================================== CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org
iD8DBQFAXjNuDehCPPrjI9gRAhe1AKCs9QRZYPe6NgJN3G5mt7DYvsqVRQCfQ6ml 6augNmx491TL4EZfhHGjcjU= =vu11 -----END PGP SIGNATURE-----
-- -- This message has been swept clean of viruses by AVG Anti Virus email Scanner.
http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.627 / Virus Database: 402 - Release Date: 22/03/2004
_______________________________________________ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
