This is only a theoretical distinction, isn’t it, given that it’s CoV2 that is predominant right now?
V. Nagarajan On Tue, Mar 31, 2020 at 11:56 PM Sahil Batra <artabli...@gmail.com> wrote: > Dear Prof. Holton, > > An innovative idea; however all of the 30 kb genome may not be useful for > specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity. > > A similar fluorescent detection approach for SARS Cov2 -- using the > indiscriminate collateral activity of Cas12 nuclease -- has been reported > here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf > Although not tested on samples from patients. > > Regards, > Sahil Batra > PhD candidate, IIT Kanpur > > On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu> wrote: > >> One problem I see is the sputum, there’s a reason why swabs are made to >> get sufficient viral material. >> >> Since stool samples test PCR positive that might be an easier approach to >> get sufficient viral material. As a side note, these are not infectious >> anymore, or at least one has not been able to infect tissue cultures from >> stool samples. >> >> It’s worth a thought, I’ll need to read those papers you referenced. >> >> I believe I read a suitable preprint for viral load, will search for it >> tomorrow. >> >> Jürgen >> >> >> >> >> __________________________________________ >> Jürgen Bosch, Ph.D. >> Division of Pediatric Pulmonology and Allergy/Immunology >> Case Western Reserve University >> 2109 Adelbert Rd, BRB 835 >> Cleveland, OH 44106 >> Phone: 216.368.7565 >> Fax: 216.368.4223 >> >> CEO & Co-Founder at InterRayBio, LLC >> >> Johns Hopkins University >> Bloomberg School of Public Health >> Department of Biochemistry & Molecular Biology >> >> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov> wrote: >> >> In order to do global survelinace of this new virus I figure we're >> going >> to need billions of tests. The biggest barriers I believe are >> logistical. Shipping back and forth to a central labs isn't going to >> cut it, and neither are test kits that cost $800 each. >> >> I think I may have a plausible way forward to a low-cost and easily >> mass-produced test for the SARS-CoV-2 virus using mostly items people >> already have, such as smartphones. The most expensive reagent required >> will be labeled oligos, but those scale very well. >> >> The key observation is that smartphones can detect as few as 1e6 >> particles/mL if they do long exposures (180s). This was using >> bioluminescence. Reported here: >> https://www.nature.com/articles/srep40203.pdf >> >> The other side of that coin is the expected titer of the virus in >> sputum. I don't know of any reports for SARS-CoV-2 itself, but for four >> other respiratory viruses, including one coronavirus, it ranges from 1e6 >> to 1e8 particles/mL : >> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ >> >> This is encouraging! The challenge will be to detect viral genomes in >> "the field" without sophisticated lab equipment like a PCR machine, >> lasers, 3D printers, etc. The concentration will be 1e-15 M, a >> challenge, but then again we can detect single molecules using >> fluorescence. The questions are: >> 1) can we get the background low enough so that the dark current of the >> camera dominates >> 2) can we make the signal high enough to overcome the dark current. >> >> 1) will depend on the availability of mass-produced filter technology. >> However, the best filter may simply be time. Provided the fluorophore >> lifetime is long enough and the camera synchronization tight enough one >> could simply measure the "afterglow" after the camera flash has turned >> off. An interesting candidate is europium. Most fluorophores decay in >> nanoseconds, but lanthanides can be microseconds to milliseconds. In >> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. >> Those decay over minutes to hours. What I'm not sure about is using >> them for FRET. I would appreciate input on experience with this. >> >> 2) I believe signal could be enhanced by using very luminous tags (such >> as quantum dots), and/or by using multiple tags per genome. This virus >> has the largest RNA genome known to date at 30 kbases. That means there >> is room for up to 2000 15-mer tags, each with its own label. The set-up >> cost for doing ~2000 oligo synthesis reactions will be high, but it can >> be done at scale. You only need ~2 fmol of each oligo, 10 umol >> synthesis is about $1k, so I estimate about $1 per test using 1000 >> different oligos. This price point will be important if we want to make >> billions of tests to be used all over the world. In some countries $1 >> is a lot. >> >> The detection strategy I am focusing on is FRET. That is, oligos would >> be made in pairs, recognizing abutting sections of the viral genome. >> Like this: >> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' >> which would anneal to one of the current CDC test primer sites: >> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' >> The result in this case would be maximum FRET efficiency only when both >> oligos are bound. From what I can tell, the ATTO465 dye is one that is >> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and >> ATTO550 should give maximum contrast between the green and red channels >> of the iPhone camera. That way you would discriminate presence/absence >> by color. Red=virus, Green=clear. That is just an example. Other tags >> might work better. Maybe quantum dots. >> >> Additional aparatus would be required, of course, and at least a few >> reagents to crack open the capsids (DTT and guanidine). These could be >> shipped dry in foil packs. The end user would simply tear it open and >> spit into it. If the intersted party is performing the test on >> themselves, then there is no biohazard. Heating to 70C (cup of coffee?) >> should kill the virus, and these reagents will make it even more dead. >> I'm not sure how much purification would be required. The assay volume >> in the Nature paper above was 1 mL. I expect signal would be improved >> by concentrating the RNA as close to the camera as possible. It may >> even be possible to absorb the nucleic acid directly onto the cover >> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and >> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are >> nothing but silica glass beads after all. >> >> There are still details to work out, but I am intruiged by the fact that >> this seems physically possible and the potential of being very cheap, >> rugged, portable and scaled up rapidly. It would be nice to be able to >> leverage a device that is in already in the hand of half the people on >> the planet. >> >> Comments? Insights? >> >> -James Holton >> MAD Scientist >> >> ######################################################################## >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> >> >> ------------------------------ >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
